This publication is Open Access under the license indicated. Learn More
Article
Suitcase Lab for Rapid Detection of SARS-CoV-2 Based on Recombinase Polymerase Amplification AssayClick to copy article linkArticle link copied!
- Ahmed Abd El Wahed*Ahmed Abd El Wahed*Email: [email protected]Institute of Animal Hygiene and Veterinary Public Health, University of Leipzig, 04103 Leipzig, GermanyDivision of Microbiology and Animal Hygiene, Georg-August-University, 37077 Goettingen, GermanyMore by Ahmed Abd El Wahed
- Pranav Patel
- Melanie MaierMelanie MaierInstitute of Medical Microbiology and VirologyLeipzig University Hospital, 04103 Leipzig, GermanyMore by Melanie Maier
- Corinna PietschCorinna PietschInstitute of Medical Microbiology and VirologyLeipzig University Hospital, 04103 Leipzig, GermanyMore by Corinna Pietsch
- Dana RüsterDana RüsterInstitute of Animal Hygiene and Veterinary Public Health, University of Leipzig, 04103 Leipzig, GermanyMore by Dana Rüster
- Susanne Böhlken-FascherSusanne Böhlken-FascherDivision of Microbiology and Animal Hygiene, Georg-August-University, 37077 Goettingen, GermanyMore by Susanne Böhlken-Fascher
- Jonas KissenkötterJonas KissenkötterDivision of Microbiology and Animal Hygiene, Georg-August-University, 37077 Goettingen, GermanyMore by Jonas Kissenkötter
- Ole BehrmannOle BehrmannInstitute of Microbiology & Virology, Brandenburg Medical School, 01968 Senftenberg, GermanyMore by Ole Behrmann
- Michael FrimpongMichael FrimpongKumasi Centre for Collaborative Research in Tropical Medicine, Department of Molecular Medicine, Kwame Nkrumah University of Science and Technology, Kumasi, GhanaMore by Michael Frimpong
- Moussa Moïse DiagneMoussa Moïse DiagneVirology Department, Institute Pasteur de Dakar, BP 220, Dakar, SenegalMore by Moussa Moïse Diagne
- Martin FayeMartin FayeVirology Department, Institute Pasteur de Dakar, BP 220, Dakar, SenegalMore by Martin Faye
- Ndongo Dia
- Mohamed A. ShalabyMohamed A. ShalabyVirology Department, Faculty of Veterinary Medicine, Cairo University, 12211 Giza, EgyptMore by Mohamed A. Shalaby
- Haitham AmerHaitham AmerVirology Department, Faculty of Veterinary Medicine, Cairo University, 12211 Giza, EgyptMore by Haitham Amer
- Mahmoud ElgamalMahmoud ElgamalVirology Department, Faculty of Veterinary Medicine, Cairo University, 12211 Giza, EgyptMore by Mahmoud Elgamal
- Ali ZakiAli ZakiDepartment of Medical Microbiology and Immunology, Faculty of Medicine, Ain Shams University, 11591 Cairo, EgyptMore by Ali Zaki
- Ghada IsmailGhada IsmailDepartment of Clinical Pathology, Faculty of Medicine, Ain Shams University, 11591 Cairo, EgyptMore by Ghada Ismail
- Marco Kaiser
- Victor M. CormanVictor M. CormanCharité−Universitätsmedizin Berlin, Institute of Virology, Berlin, GermanyGerman Centre for Infection Research (DZIF), 10117 Berlin, GermanyMore by Victor M. Corman
- Matthias Niedrig
- Olfert Landt
- Ousmane FayeOusmane FayeVirology Department, Institute Pasteur de Dakar, BP 220, Dakar, SenegalMore by Ousmane Faye
- Amadou A. SallAmadou A. SallVirology Department, Institute Pasteur de Dakar, BP 220, Dakar, SenegalMore by Amadou A. Sall
- Frank T. HufertFrank T. HufertInstitute of Microbiology & Virology, Brandenburg Medical School, 01968 Senftenberg, GermanyMore by Frank T. Hufert
- Uwe TruyenUwe TruyenInstitute of Animal Hygiene and Veterinary Public Health, University of Leipzig, 04103 Leipzig, GermanyMore by Uwe Truyen
- Uwe G. LiebertUwe G. LiebertInstitute of Medical Microbiology and VirologyLeipzig University Hospital, 04103 Leipzig, GermanyMore by Uwe G. Liebert
- Manfred WeidmannManfred WeidmannInstitute of Microbiology & Virology, Brandenburg Medical School, 01968 Senftenberg, GermanyMore by Manfred Weidmann
Abstract
Click to copy section linkSection link copied!
In March 2020, the SARS-CoV-2 virus outbreak was declared as a world pandemic by the World Health Organization (WHO). The only measures for controlling the outbreak are testing and isolation of infected cases. Molecular real-time polymerase chain reaction (PCR) assays are very sensitive but require highly equipped laboratories and well-trained personnel. In this study, a rapid point-of-need detection method was developed to detect the RNA-dependent RNA polymerase (RdRP), envelope protein (E), and nucleocapsid protein (N) genes of SARS-CoV-2 based on the reverse transcription recombinase polymerase amplification (RT-RPA) assay. RdRP, E, and N RT-RPA assays required approximately 15 min to amplify 2, 15, and 15 RNA molecules of molecular standard/reaction, respectively. RdRP and E RT-RPA assays detected SARS-CoV-1 and 2 genomic RNA, whereas the N RT-RPA assay identified only SARS-CoV-2 RNA. All established assays did not cross-react with nucleic acids of other respiratory pathogens. The RT-RPA assay’s clinical sensitivity and specificity in comparison to real-time RT-PCR (n = 36) were 94 and 100% for RdRP; 65 and 77% for E; and 83 and 94% for the N RT-RPA assay. The assays were deployed to the field, where the RdRP RT-RPA assays confirmed to produce the most accurate results in three different laboratories in Africa (n = 89). The RPA assays were run in a mobile suitcase laboratory to facilitate the deployment at point of need. The assays can contribute to speed up the control measures as well as assist in the detection of COVID-19 cases in low-resource settings.
Copyright © 2021 The Authors. Published by American Chemical Society
In December 2019, a virus causing severe acute respiratory syndrome (SARS-CoV-2) was first identified in diseased patients in China. Genome sequencing and phylogenic analysis identified the virus as a close relative of SARS-CoV in the genus Betacornavirus of subfamily Coronavirinae within the family Coronaviridae. (1) The respiratory disease soon after was designated COVID-19 and rapidly spread first inside and then outside of China. The World Health Organization (WHO) announced COVID-19 as a global pandemic in March 2020. (2) Currently, SARS-CoV-2 has infected more than 50 million individuals worldwide due to a high transmissibility rate and a low infectious dose. (3) The only effective control measures are early identification and isolation of infected cases, contact tracing, as well as social distancing and compulsory use of facial masks in closed rooms. (4)
Real-time reverse transcription polymerase chain reaction (real-time RT-PCR) assays were quickly developed for the detection of SARS-CoV-2. (5) Real-time RT-PCR is highly sensitive and specific. In general, the results can be produced in less than 3 h under optimal conditions. If local diagnostic capacity is not available, samples collected from suspected cases have to be transported to diagnostic laboratories providing suitable test capacities. In most of the cases, the test results can be provided within a timeframe ranging from 24 h up to 3 days. Noteworthy, in the early phase of the epidemic, diagnostic laboratories, e.g., in Germany, were overwhelmed with the number of incoming samples. (6)
RPA is conducted at a single constant temperature (∼42 °C) and results are produced in 15 min or less. The speed of the RPA is achieved via a more-than-exponential amplification based on a mixture of enzymes and proteins (recombinase, single-stranded DNA-binding protein, and strand-displacing polymerase). (7) Polyethylenglycol (Carbowax20M) is used as a crowding agent in the reaction and contributes significantly to the amplification process by concentrating the proteins into smaller reaction volumes. Real-time data acquisition is possible using a fluorescent exo-probe. (8) Recently, mathematical analysis methods have been developed to allow quantification. (9,10)
RPA assays have been successfully evaluated for detection of several emerging and neglected pathogens. (11−19) It has been successfully implemented into a solar-powered mobile suitcase laboratory (Figure S1) and used as a point-of-need molecular diagnostic tool during the Ebola virus outbreak in West Africa. (12)
In this study, we developed and evaluated three real-time reverse transcription-RPA (RT-RPA) assays targeting the RNA-dependent RNA polymerase (RdRP), envelope protein (E), and nucleocapsid protein (N) genes of SARS-CoV-2. The limit of detection, cross-reactivity, and clinical performance were determined and compared with real-time RT-PCR.
Experimental Methods
Click to copy section linkSection link copied!
Molecular RNA Standard and RPA Oligonucleotide
For assay validation, molecular RNA standards based on the RdRP, E, and N genes (accession number: NC_045512, nucleotides: 14977–15975, 26112–26479, and 28280–29536, respectively) were synthesized by GenExpress (Berlin, Germany). The E gene RNA was also used as a positive control for the RT-PCR. Oligonucleotides for the RdRP and E genes were updated from our previous design for SARS-CoV and MERS CoV (unpublished data), whereas the N gene amplicon was modified from a previously published article (20) (Table 1). All oligonucleotides were synthesized by TIB MOLBIOL GmbH (Berlin, Germany).
Table 1. RT-RPA Assay Oligonucleotidesa
| gene | oligonucleotide | sequence 5′-3′ |
|---|---|---|
| RdRP | forward | TATGCCATTAGTGCAAAGAATAGAGCTCGCAC |
| reverse | CAACCACCATAGAATTTGCTTGTTCCAATTAC | |
| exo-probe | TCCTCTAGTGGCGGCTATTGATTTCAATAAbTXfTTTGATGAAACTGTCTATTG-PH | |
| E | forward | GAAGAGACAGGTACGTTAATAGTTAATAGCGTA |
| reverse | AAAAAGAAGGTTTTACAAGACTCACGTTAACsA | |
| exo-probe | ATCGAAGCGCAGTAAGGATGGCTAGbTXfTAACTAGCAAGAATAC-PH | |
| N | forward | CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC |
| reverse | AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT | |
| exo-probe | TAGAATGGCTGGCAATGGCGGTGATGCTGCbTXfTTGCTTTGCTGCTGCTT-PH |
a
BHQ1-dt (bT), tetrahydrofuran (X), Fam-dT (fT), phosphothioate backbone (s), and PH: 3′ phosphate to block elongation.
RT-RPA Analytical Sensitivity and Specificity
Serial dilutions of the molecular standards (106–100 RNA molecules/per reaction) were screened in the respective RT-RPA assays. To determine the minimal number of RNA molecules per reaction detected in 95% of cases, a probit regression analysis of five datasets from the replicate RPA reactions of the complete standard dilution range was performed using STATISTICA software (StatSoft, Hamburg, Germany), and the graph was created by GraphPad Prism version 6.07 software (GraphPad Software, Inc., San Diego, California). The analytical specificity of the RT-RPA assays was tested with genomes of the viruses listed in Table 2. The nucleic acid extracts were provided by Charité Medical University (Berlin, Germany), Robert Koch Institute (Berlin, Germany), Landesgesundheitsamt Niedersachsen (Hannover, Germany), Quality Control for Molecular Diagnostics (Glasgow, Scotland), and the Friedrich-Loeffler-Institute (Greifswald-Insel Riems, Germany).
Table 2. Viral Genomes Analyzed for the Cross-Reactivity by the Three SARS-CoV-2 RT-RPA Assays
| viral nucleic acid | RdRP | E | N |
|---|---|---|---|
| SARS-CoV-2 | + | + | + |
| SARS-CoV-1 | + | + | – |
| coronavirus 229E | – | – | – |
| coronavirus NL63 | – | – | – |
| coronavirus OC43 | – | – | – |
| MERS-Coronavirus | – | – | – |
| influenza A (H1N1 pdm09) | – | – | – |
| influenza A (H3N2) | – | – | – |
| influenza A (H5N1) | – | – | – |
| influenza A (H1N1 H275Y) | – | – | – |
| influenza B (Victoria) | – | – | – |
| influenza B (Yamagata) | – | – | – |
| parainfluenza virus 1 (patient isolate) | – | – | – |
| parainfluenza virus 2 (patient isolate) | – | – | – |
| parainfluenza virus 3 (patient isolate) | – | – | – |
| parainfluenza virus 4 (patient isolate) | – | – | – |
| respiratory syncytial virus A and B | – | – | – |
| human rhinovirus A 16 | – | – | – |
| human rhinovirus B 5 | – | – | – |
| human metapneumovirus A1 | – | – | – |
| human metapneumovirus B2 | – | – | – |
| adenovirus type 1 | – | – | – |
| adenovirus type 4 | – | – | – |
| adenovirus type 34 | – | – | – |
| A/Anhui/1/13 (H7N9) | – | – | – |
| A/ Chicken/Germany/79 “Taucha“ (H7N7) | – | – | – |
| A/Chicken/Brescia/19/02 (H7N7) | – | – | – |
| A/Cygnusolor/Germany/R1377/07 (H5N1) | – | – | – |
| newcastle disease virus clone 30 | – | – | – |
| infectious laryngotracheitis virus U76 | – | – | – |
| infectious bronchitis M41 | – | – | – |
RT-RPA Reaction Conditions
For RT-RPA, the TwistAmp exo kit (TwistDx, Cambridge, UK) was used in combination with lyophilized RevertAid reverse transcriptase (Life Technologies, Darmstadt, Germany). Per reaction, 29.5 μL of rehydration buffer, 2.5 μL of RevertAid reverse transcriptase (200 U/μL), 9.7 μL of H2O, 2.1 μL of forward primer (10 pmol/μL), 2.1 μL of reverse primer (20 pmol/μL), 0.6 μL of exo-probe (10 pmol/μL), 2.5 μL of 280 mM magnesium acetate, and 1 μL of the template were added into the lid of the reaction tube containing the freeze-dried pellet. The tube was closed, centrifuged, mixed, centrifuged, and placed immediately into the T8 (Axxin, Fairfield, Australia) isothermal fluorescence reader. The reaction was incubated at 42 °C for 15 min. A mixing step was conducted after 230 s for the RdRP and E RT-RPA assays and after 320 s for the N RT-RPA assay. The threshold time (TT) was calculated as the starting point of the amplification curve above the threshold of the negative control (water as template) in the first derivative analysis in the T8 Desktop software (Axxin, Fairfield, Australia).
Clinical Samples
The three RT-RPA assays were validated with leftover RNA extracts from suspected COVID-19 cases diagnosed at the Leipzig University Hospital by real-time RT-PCR (E based assay as screening test and RdRP as confirmatory test). A total of 18 positive and 18 negative samples (blinded) were tested. Diagnostic sensitivity and specificity, positive predictive value (PPV), and negative predictive value (NPV) for the RT-RPA assays were calculated using standard formulas against the real-time RT-PCR as reference test (Table 3). (21) Preliminary testing of clinical samples was performed at the Institute Pasteur Dakar in Dakar (Senegal), laboratory at the Kumasi Centre for Collaborative Research in Tropical Medicine (Ghana), and Ain Shams and Cairo Universities (Egypt), in comparison to real-time RT-PCR assays used in these laboratories.
Table 3. Retrospective Samples University of Leipziga
| result tables | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| RT-RPA | real-time RT-PCR | |||||||||
| reference test real-time RT-PCRCT | analyzed test RT-RPA | sensitivity | specificity | PPV | NPV | n | RT-RPA | pos | neg | |
| <35 | RdRP | estimate: | 0.93 [0.69; 0.99] | 1 [0.82; 1.0] | 1 [0.77; 1.0] | 0.95 [0.76; 0.99] | 32 | pos | 13 | 0 |
| neg | 1 | 18 | ||||||||
| >35 | 95% CI: | 1 [0.5; 1.0] | 1 [0.84; 1.0] | 1 [0.51; 1.0] | 1 [0.84; 1.0] | 22 | pos | 4 | 0 | |
| neg | 0 | 18 | ||||||||
| <35 | E | estimate: | 0.93 [0.69; 0.99] | 0.5 [0.29; 0.71] | 0.59 [0.39; 0.77] | 0.9 [0.60; 0.98] | 32 | pos | 13 | 9 |
| neg | 1 | 9 | ||||||||
| >35 | 95% CI: | 0.5 [0.15; 0.85] | 0.5 [0.29; 0.71] | 0.18 [0.05; 0.48] | 0.82 [0.52; 0.95] | 22 | pos | 2 | 9 | |
| neg | 2 | 9 | ||||||||
| <35 | N | estimate: | 0.93 [0.66; 0.99] | 0.94 [0.74; 0.99] | 0.93 [0.69; 0.99] | 0.94 [0.74; 0.99] | 32 | pos | 13 | 1 |
| neg | 1 | 17 | ||||||||
| >35 | 95% CI: | 0.5 [0.15; 0.85] | 0.5 [0.29; 0.71] | 0.18 [0.05; 0.48] | 0.81 [0.52; 0.95] | 22 | pos | 2 | 9 | |
| neg | 2 | 9 | ||||||||
a
Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of RdRP, E, and N RT-RPA assays in comparison to real-time RT-PCR results (n = 36).
Real-Time RT-PCR
In Germany, the RNA extracts from patient materials were tested with a real-time PCR assay combining commercial SARS-CoV-2-E oligonucleotides (TIB MOLBIOL GmbH, Berlin, Germany) and Superscript III Platinum One-Step qRT-PCR kits (Life Technologies, Darmstadt, Germany) according to the manufacturer’s instructions using the following temperature profile: 50 °C for 15 min, 95 °C for 2 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s on an Agilent Technologies Stratagene Mx 3000p Real-Time PCR system. The same protocol was followed in Egypt but using the LightCycler Multiplex RNA Virus Master kit (Roche, Mannheim, Germany). At the laboratory in Dakar, RNA was extracted from 140 μL of swab VTM using the QIAamp viral RNA mini kit (Qiagen, Heiden, Germany). The samples were tested with the same SARS-CoV-2-E oligonucleotides as above using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, UK) according to the manufacturer’s instructions using the following temperature profile: 55 °C for 10 min, 95 °C for 1 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s on a CFX96 Real-Time PCR System (Bio-Rad, CA). At the Kumasi Centre for Collaborative Research in Ghana, RNA was extracted from swab VTM using the nucleic acid extraction and purification reagents series C—spin column method (Guangzhou LBP Medical Science & Technology Co. Ltd.). The RT-PCR used was the DA AN Gene PCR kit (Da an Gene Co. Ltd. Sun Yat-Sen University, Guangzhou, China) targeting the SARS-CoV 2 ORF1ab and N genes, according to the manufacturer’s instructions. Three microliters of the RNA extracts were used in the RT-PCR assays.
Results
Click to copy section linkSection link copied!
Analytical Sensitivity and Specificity
To determine the analytical sensitivity of the RdRP, E, and N RT-RPA assays, each assay was tested with a serial dilution of 106–100 RNA molecules/reaction of the respective molecular RNA standard in five replicates. Molecular RNA standards with the concentration from 106 to 102 molecules/reaction were detected in all five RPA runs of the three RT-RPA-assays. The E and N RT-RPA identified 100 RNA molecules in 3/5 RT-RPA runs, while in RdRP RT-RPA, all five runs were positive. Only the RdRP RT-RPA amplified one RNA copy in 2/5 RT-RPA runs. With this dataset, probit regression analysis was performed and revealed a 95% detection limit of two RNA molecules for the RdRP RT-RPA assay, and 15 RNA molecules each for E and N RT-RPA assays (Figure 1).
Figure 1
Figure 1. Probit regression analysis for RdRP, E, and N RT-RPA assays. The limit of detection in 95% of cases is two RNA molecules/reaction for the RdRP RT-RPA assay (red) and 15 RNA molecules per reaction each for E and N RT-RPA assays (black).
Clinical Samples
All extracted RNA samples provided by the University of Leipzig, which had been stored at −80 °C were first tested by the three RT-RPA assays and retested by real-time RT-PCR to confirm previous results. The RT-RPA assay targeting the RdRP gene produced the best clinical performance (Table 3). All RT-RPA assays detected samples with a CT > 30 at a maximum of 12 min (Figure 2).
Figure 2
Figure 2. Results of 36 clinical samples analyzed with real-time RT-PCR for the E gene and RT-RPA assays for the RdRP, E, and N genes. CT is the cycle threshold, and TT is the threshold time. The red dot represents the real-time RT-PCR sample not detected by the RdRP RT-RPA, and the horizontal red lines indicate the median of TT or CT values.
In Dakar, Senegal, CT range 19.1–39.1 was scored positive by the RdRP RT-RPA assay, whereas the E and N assays showed poor performance (Table S1(i)). Initially, it was unclear why the RdRP RT-RPA assay performed poorly in the lab in Kumasi (Table S1(ii)), where only 7/11 scored positive (CT range 18.1–36.1) until it emerged that RNA extracts had been stored at −20 °C. In Egypt (Table S1(iii)), the RNA extracts were stored at −80 °C, but were subsequently transported to another laboratory, where they were refrozen (7/16 positive; CT range, 17.0–39.7). The RdRP RT-RPA results from Dakar were confirmed when testing was repeated in Egypt with extracts from fresh swabs (26/26). Similar results were achieved at the lab in Dakar where 16/16 samples albeit in a low CT range (19–39) scored positive by RdRP RT-RPA. We calculated the clinical sensitivity and specificity for all RdRP RT-RPA results from African labs, which resulted in similar values as those observed for the samples from Germany (Table 4); however, the RdRP RT-RPA assay showed 100% concordance with real-time RT-PCR results when the results from fresh extracts only (Table S1(i and iv)) were considered.
| result tables | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| RT-RPA | real-time RT-PCR | |||||||||
| reference test real-time RT-PCRCT | analyzed test RT-RPA | sensitivity | specificity | PPV | NPV | n | RT-RPA | pos | neg | |
| <35 | RdRP | estimate: 95% CI: | 0.93 [0.87; 0.98] | 1.00 [0.84; 1] | 1.0 [0.93; 1] | 0.87 [0.768; 0.96] | 73 | pos | 50 | 0 |
| neg | 3 | 20 | ||||||||
| >35 | RdRP | estimate: 95% CI: | 0.31 [0.14; 0.55] | 1.0 [0.84;1] | 1.0 [0.57; 1] | 0.64 [0.47; 0.79] | 36 | pos | 5 | 0 |
| neg | 11 | 20 | ||||||||
a
All results were used (n = 89 samples) to calculate sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of the RdRP RT-RPA assay in comparison to real-time RT-PCR assays.
Suitcase Lab
The assays were performed in the suitcase lab (Figure S1), which is a water- and dust-resistant case and fully equipped to conduct isothermal amplification assay at low-resource settings. The suitcase lab has a size of 62 + 49 + 30 cm. The power source is via a solar-powered battery (Goal Zero South Bluffdale, UT). (19) To protect the lab technician while handling highly infectious samples, glovebox (Bodo Koennecke, Berlin, Germany) was used to achieve the first lysis step. (16)
Discussion
Click to copy section linkSection link copied!
For molecular amplification targets, the CDC, Atlanta, recommends two regions in the N gene, while the WHO recommends two targets, e.g., the E gene followed by a SARS-CoV-2 confirmatory assay targeting RdRP. (22)
To identify a highly sensitive and specific SARS-CoV-2 RPA assay, three RT-RPA assays targeting the RdRP, E, and N genes of the SARS-CoV-2 genome were evaluated. The RdRP RT-RPA assay produced sensitivity and specificity similar to a real-time RT-PCR within less than 15 min. The speed and clinical accuracy of the RT-RPA assay make it an ideal candidate molecular assay at point of need.
Real-time RT-PCR is currently the method of choice for molecular laboratory screening of samples from suspected COVID-19 patients. Satisfactory results have been achieved from swab and saliva samples (23) and also sputum, blood, urine, and stool have been successfully tested. (24) The identification of asymptomatic carriers relies entirely on nasopharyngeal, oropharyngeal swab, or saliva testing. (25)
In general, state and commercial diagnostic laboratories in developed countries have all the infrastructure for real-time RT-PCR. A compilation of SARS-CoV-2 diagnostic kits hosted by Foundation for Innovative New Diagnostics (FIND) currently lists 108 commercial PCR kits and more than 200 in-house real-time RT-PCR kits. (26) In emerging nations, usually only reference laboratories are adequately equipped to perform real-time RT-PCR (16) and alternative testing formats are needed. For direct virus detection, the FIND webpage currently lists only 21 rapid antigen detection tests (RDT) with an IVD license. (27) RDT are easy to use, very fast, and cheap to produce, but less sensitive and can produce a high false-negative rate. (28) Since the pandemic spread to Africa and South America, there is an urgent need for molecular assays with performance and accuracy known from real-time RT-PCR and applicability in low-resource settings. Isothermal amplification assays have the potential to provide rapid direct virus detection in infrastructure limited settings. (19)
Although there has been a flurry of publications on LAMP assays, only two are commercially available with an IVD license. (29) The pH drop occurring during the LAMP amplification reaction has been recently exploited for the detection of SARS-CoV-2 to allow simple phenol red- or cresol red-based colorimetric distinction between positives and negatives just by sight. (30,31) In general, RT-LAMP assays have a run time of about 30 min and need devices to maintain an amplification temperature of 65 °C. The longer run time of this isothermal amplification, however, makes unspecific amplifications more likely and requires to define a cutoff for each LAMP assay. (32) In contrast, RPA is very fast (3–15 min), requires a lower temperature, and has already shown to perform at high clinical sensitivity and specificity during the Ebola virus disease outbreak in Guinea. (12)
The RdRP RT-RPA assay described here shows great accuracy even with samples containing less than 10 target molecules corresponding to real-time RT-PCR CT values > 35 (Figure 2 and Table 3). In this respect, the performance of RdRP RT-RPA is comparable to several real-time RT-PCRs. (33)
The N gene is the main target of the CDC real-time RT-PCR (22) and the reverse transcription recombinase-aided amplification (RT-RAA) assay, (34) and both generated excellent clinical sensitivity and specificity. Both the N and E RT-RPA assays described here produced very good analytical sensitivity (15 copies per reaction); nevertheless, the clinical performances were poor, especially for samples with low viral loads. RPA oligonucleotide design has a great influence on the sensitivity of RPA assays, and RPA amplicons always need to be validated with patient material to come to a final assessment.
The E gene RT-RPA was disqualified because it produced too many false positives in a TT range of 10–12 min (Figure 2), i.e., at a low-target RNA load. Contamination as described for real-time RT-PCR developments was excluded since amplification was not observed in any of the negative controls. (35,36) False-positive real-time RT-PCR results in clinical material with low viral loads have been observed for PCR assays. (37) By comparing three RT-RPA assays and validating them with clinical samples, we were able to pick a highly accurate RPA assay, i.e., RdRP RT-RPA.
Our preliminary result indicates that the developed RdRP RT-RPA assay performs well across several laboratories if RNA is extracted from fresh swab samples (Table 3, S1(i and iv)) and can achieve concordance to real-time RT-PCR results. The observation on the quality of the RNA or sample confirms earlier observations made for the foot and mouth disease virus and for dengue virus RT-RPA assays. (8,11) Therefore, to achieve the best results, RT-RPA should be used directly with RNA extracts and results obtained with stored samples may underestimate the performance of the assay. Moreover, the postextraction contamination with RNase must be avoided.
The limitation of the study is that several different real-time RT-PCR assays were used in the various laboratories; moreover, the sample size is small. Therefore, a larger study is needed to determine reliable clinical sensitivities and specificity in comparison to a real-time RT-PCR used across all participating labs. This has already been shown by a Chinese group, which tested 926 samples by RT-RAA, an RT-RPA equivalent using E.coli SSB instead of GP32 in the enzyme mixture. (38) These results indicate that a good performance of the RPA assays with clinical samples can be expected. Inclusion of an internal positive control will increase the practicability of the developed RPA assay since the effect of inhibitors will be excluded in case of false-negative results. In addition, establishing a duplex RPA assay relaying on both RdRP and N genes will boost the assay clinical specificity.
The ID-Now system (Abbott) combines a simple extraction nonpurification protocol in combination with the isothermal nicking enzyme amplification reaction (NEAR). The total turnaround time is 17 min. The ID-Now showed great efficacy for Influenza A and B testing, (39) but has a limited clinical sensitivity for SARS-CoV-2, especially for samples with CT value > 30, (40) which drove the FDA to release an alert against using the ID-Now. (41)
We introduced few improvements during the development of the RPA assays for SARS-CoV-2. First, the best assay sensitivity was achieved using double concentration of the reverse primer. Coronaviruses have a positive-sense single-stranded RNA genome and more reverse primer produces more cDNA for the following amplification step. (42,43) Second, during the oligonucleotide design, any sequences pairing to the human genome were strictly excluded to avoid problems as reported for some real-time RT-PCR assays. (44) Third, to avoid primer dimer and nonspecific amplification, phosphothioate nucleotides were introduced in selected RPA primers. (45)
In addition to the amplification and detection, the virus inactivation and extraction are crucial steps in the diagnosis of SARS-CoV-2. To assure the safety of the healthcare worker or laboratory technician, sample inactivation is recommended in a BSL-2 cabinet and under field condition in a mobile glovebox. (22) The German committee for biological reagents (ABAS) has, however, recently relaxed its regulations and a BSL-2 bench is now not required if swabs are immersed into an inactivating lysis buffer immediately after sampling while wearing PPE. (46)
For swabs collected from an Ebola-infected patient, we showed that the combination of detergent and heat in the SPEEDXTRACT protocol can be achieved in 10 min. (12) Several rapid and simple extraction procedures that use a mix of detergents and heating have now been published for SARS-CoV-2 samples. (47−49) Most of these methods generate crude extracts, and RPA is very robust in crude samples and works in the presence of agents with an inhibitory effect on PCR including 15 ± 25% of milk, 50 g/L hemoglobin, 4% V/V ethanol, and 0.5 U of heparin. (50) Virus RNA was detectable in preparations containing 1:10 dilutions of crude human serum, urine, and tick pool homogenate. (50−52) We are now investigating such an approach for integration into the suitcase laboratory.
Conclusions
Click to copy section linkSection link copied!
With the current clinical performance of the developed RdRP RT-RPA assay, the test provides a promising approach for the use at point of need. It could be deployed at local hospitals, healthcare centers, and walk-through test centers. The robust suitcase laboratory concept would work in infrastructure limited settings. Currently, the limited commercial availability of RT-RPA reagents is an obstacle for wide implementation of RT-RPA for in vitro diagnostic use. License-free RT-RPA reagents would be a boost for diagnostics in infrastructure-poor settings.
Supporting Information
Click to copy section linkSection link copied!
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acs.analchem.0c04779.
Mobile suitcase lab (Figure S1) and raw data of screening clinical samples in African settings (Table S1) (PDF)
Terms & Conditions
Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.
Author Information
Click to copy section linkSection link copied!
- Ahmed Abd El Wahed - Institute of Animal Hygiene and Veterinary Public Health, University of Leipzig, 04103 Leipzig, Germany; Division of Microbiology and Animal Hygiene, Georg-August-University, 37077 Goettingen, Germany;
http://orcid.org/0000-0003-3347-6075;
- Ole Behrmann - Institute of Microbiology & Virology, Brandenburg Medical School, 01968 Senftenberg, Germany;http://orcid.org/0000-0002-7846-7917
A.A.E.W. and P.P. contributed equally to this work. Conceptualization was performed by A.A.E.W., P.P., F.T.H., and M.W. A.A.E.W., P.P., M.M., C.P., D.R., S.B.-F., J.K., O.B., M.F., M.M.D., M.G., N.D., M.K., M.N., O.L., A.A.S., M.A.S., O.F., U.T., U.G.L., and M.W. contributed to data curation. Formal analysis was conducted by A.A.E.W., P.P., M.M., C.P., D.R., J.K., O.B., M.F., M.M.D., M.G., M.K., H.A., M.E., A.Z., G.I., and M.W. A.A.E.W., P.P., M.M., C.P., D.R., S.B.-F., and M.W. performed the investigation. Methodology was designed by A.A.E.W., P.P., V.M.C., M.F, F.T.H., U.T., U.G.L., and M.W. Resources were obtained by N.D., O.F., A.A.S., M.A.S., V.M.C., O.L., F.T.H., U.T., and U.G.L. A.A.E.W., P.P., D.R., and M.W. contributed to software. A.A.E.W., N.D., O.F., A.A.S., F.T.H., U.T., U.G.L., and M.W. supervised the study. A.A.E.W., P.P., and M.W. contributed to validation, visualization, and writing of the original draft. Review and editing was done by all authors.
Acknowledgments
Click to copy section linkSection link copied!
The clinical evaluation in Ghana and Senegal was supported by EDCTP grant RIA2020EF-2937. The reference viral RNA extracts from cell culture used for the cross-detection studies were part of the Bill & Melinda Gates Foundation (grant ID INV-005971) to Charite—Universitätsmedizin Berlin. The findings and conclusions contained within are those of the authors and do not necessarily reflect positions or policies of the Bill & Melinda Gates Foundation.
References
Click to copy section linkSection link copied!
This article references 52 other publications.
- 1Coronaviridae Study Group of the International Committee on Taxonomy of, V. The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536– 544, DOI: 10.1038/s41564-020-0695-zGoogle Scholar1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktFemu7Y%253D&md5=3e43e7781469c6d748726b24b3a60361The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2Coronaviridae Study Group of the International Committee on Taxonomy of VirusesNature Microbiology (2020), 5 (4), 536-544CODEN: NMAICH; ISSN:2058-5276. (Nature Research)A review. The present outbreak of a coronavirus-assocd. acute respiratory disease called coronavirus disease 19 (COVID-19) is the third documented spillover of an animal coronavirus to humans in only two decades that has resulted in a major epidemic. The Coronaviridae Study Group (CSG) of the International Committee on Taxonomy of Viruses, which is responsible for developing the classification of viruses and taxon nomenclature of the family Coronaviridae, has assessed the placement of the human pathogen, tentatively named 2019-nCoV, within the Coronaviridae. Based on phylogeny, taxonomy and established practice, the CSG recognizes this virus as forming a sister clade to the prototype human and bat severe acute respiratory syndrome coronaviruses (SARS-CoVs) of the species Severe acute respiratory syndrome-related coronavirus, and designates it as SARS-CoV-2. In order to facilitate communication, the CSG proposes to use the following naming convention for individual isolates: SARS-CoV-2/host/location/isolate/date. While the full spectrum of clin. manifestations assocd. with SARS-CoV-2 infections in humans remains to be detd., the independent zoonotic transmission of SARS-CoV and SARS-CoV-2 highlights the need for studying viruses at the species level to complement research focused on individual pathogenic viruses of immediate significance. This will improve our understanding of virus-host interactions in an ever-changing environment and enhance our preparedness for future outbreaks.
- 2WHO. WHO announces COVID-19 outbreak apandemic. https://www.euro.who.int/en/health-topics/health-emergencies/coronavirus-covid-19/news/news/2020/3/who-announces-covid-19-outbreak-a-pandemic (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 3Li, R.; Pei, S.; Chen, B.; Song, Y.; Zhang, T.; Yang, W.; Shaman, J. Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2). Science 2020, 368, 489– 493, DOI: 10.1126/science.abb3221Google Scholar3https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXosVSjur0%253D&md5=26e8c17708ba96946dbe89d942ef9190Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2)Li, Ruiyun; Pei, Sen; Chen, Bin; Song, Yimeng; Zhang, Tao; Yang, Wan; Shaman, JeffreyScience (Washington, DC, United States) (2020), 368 (6490), 489-493CODEN: SCIEAS; ISSN:1095-9203. (American Association for the Advancement of Science)Estn. of the prevalence and contagiousness of undocumented novel coronavirus [severe acute respiratory syndrome - coronavirus 2 (SARS-CoV-2)] infections is crit. for understanding the overall prevalence and pandemic potential of this disease. Here, we use observations of reported infection within China, in conjunction with mobility data, a networked dynamic metapopulation model, and Bayesian inference, to infer crit. epidemiol. characteristics assocd. with SARS-CoV-2, including the fraction of undocumented infections and their contagiousness. We est. that 86% of all infections were undocumented [95% credible interval (CI): 82-90%] before the 23 Jan. 2020 travel restrictions. The transmission rate of undocumented infections per person was 55% the transmission rate of documented infections (95% CI: 46-62%), yet, because of their greater nos., undocumented infections were the source of 79% of the documented cases. These findings explain the rapid geog. spread of SARS-CoV-2 and indicate that containment of this virus will be particularly challenging.
- 4Leung, C. C.; Cheng, K. K.; Lam, T. H.; Migliori, G. B. Mask wearing to complement social distancing and save lives during COVID-19. Int. J. Tuberc. Lung Dis. 2020, 24, 556– 558, DOI: 10.5588/ijtld.20.0244Google Scholar4https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38nhtlGisg%253D%253D&md5=908516e413860ba4532e01b949d1d94dMask wearing to complement social distancing and save lives during COVID-19Leung C C; Cheng K K; Lam T H; Migliori G BThe international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease (2020), 24 (6), 556-558 ISSN:.There is no expanded citation for this reference.
- 5Corman, V. M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D. K.; Bleicker, T.; Brunink, S.; Schneider, J.; Schmidt, M. L.; Mulders, D. G.; Haagmans, B. L.; van der Veer, B.; van den Brink, S.; Wijsman, L.; Goderski, G.; Romette, J. L.; Ellis, J.; Zambon, M.; Peiris, M.; Goossens, H.; Reusken, C.; Koopmans, M. P.; Drosten, C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045 DOI: 10.2807/1560-7917.ES.2020.25.3.2000045Google ScholarThere is no corresponding record for this reference.
- 6Sheridan, C. Coronavirus and the race to distribute reliable diagnostics. Nat. Biotechnol. 2020, 38, 382– 384, DOI: 10.1038/d41587-020-00002-2Google Scholar6https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksFOjs78%253D&md5=d68bd337702677030b41e24e8a0c3f3fCoronavirus and the race to distribute reliable diagnosticsSheridan, CormacNature Biotechnology (2020), 38 (4), 382-384CODEN: NABIF9; ISSN:1087-0156. (Nature Research)A brief review. International teams worked at speed to make tests for the virus available in record time.
- 7Piepenburg, O.; Williams, C. H.; Stemple, D. L.; Armes, N. A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204 DOI: 10.1371/journal.pbio.0040204Google Scholar7https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BD28npt12nsg%253D%253D&md5=267960cb82d153b8b72385c4f86e548bDNA detection using recombination proteinsPiepenburg Olaf; Williams Colin H; Stemple Derek L; Armes Niall APLoS biology (2006), 4 (7), e204 ISSN:.DNA amplification is essential to most nucleic acid testing strategies, but established techniques require sophisticated equipment or complex experimental procedures, and their uptake outside specialised laboratories has been limited. Our novel approach, recombinase polymerase amplification (RPA), couples isothermal recombinase-driven primer targeting of template material with strand-displacement DNA synthesis. It achieves exponential amplification with no need for pretreatment of sample DNA. Reactions are sensitive, specific, and rapid and operate at constant low temperature. We have also developed a probe-based detection system. Key aspects of the combined RPA amplification/detection process are illustrated by a test for the pathogen methicillin-resistant Staphylococcus aureus. The technology proves to be sensitive to fewer than ten copies of genomic DNA. Furthermore, products can be detected in a simple sandwich assay, thereby establishing an instrument-free DNA testing system. This unique combination of properties is a significant advance in the development of portable and widely accessible nucleic acid-based tests.
- 8Abd El Wahed, A.; El-Deeb, A.; El-Tholoth, M.; Abd El Kader, H.; Ahmed, A.; Hassan, S.; Hoffmann, B.; Haas, B.; Shalaby, M. A.; Hufert, F. T.; Weidmann, M. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus. PLoS One 2013, 8, e71642 DOI: 10.1371/journal.pone.0071642Google Scholar8https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhtlKmurfN&md5=6636c29b398ecc9f2187d6bef3244ba3A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virusAbd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, ManfredPLoS One (2013), 8 (8), e71642CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt mol. RNA std. was used for assay validation. The RT-RPA assay was fast (4-10 min) and the anal. sensitivity was detd. at 1436 RNA mols. detected by probit regression anal. The FMDV RT-RPA assay detected RNA prepd. from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clin. samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, resp. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.
- 9Gordon, M. I.; Klemer, D. P.; Fuller, S. L.; Chang, J. H.; Klemer, D. R.; Putnam, M. L. Mathematical modeling of a real-time isothermal amplification assay for Erwinia amylovora. Eng. Rep. 2019, 1, e12047 DOI: 10.1002/eng2.12047Google Scholar9https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmslaltbY%253D&md5=5b3f5bd6268ec1c41530c06e767e45eeMathematical modeling of a real-time isothermal amplification assay for Erwinia amylovoraGordon, Michael I.; Klemer, David P.; Fuller, Skylar L.; Chang, Jeff H.; Klemer, Daniel R.; Putnam, Melodie L.Engineering Reports (2019), 1 (3), e12047CODEN: ERNEHB; ISSN:2577-8196. (John Wiley & Sons, Inc.)A general math. model that describes the temporal behavior of a real-time isothermal process used for nucleic acid amplification is derived. A monotonically-increasing fluorescence signal s(t) generated and measured during the amplification reaction can be modeled in the form of a logistic function of time that is completely described by three parameters (k, t50, and Smax), which may be readily estd. from exptl. acquired s(t) data. Exptl. data obtained from a real-time loop-mediated isothermal amplification (LAMP) assay for the infectious pathogen Erwinia amylovora (E. amylovora) are used to illustrate and validate the math. model. Implementation of such a modeling approach can allow for the extn. of quant. information from real-time LAMP data through parameter estn. techniques; this is demonstrated exptl. using real-time amplification data acquired using the real-time E. amylovora assay.
- 10Moody, C.; Newell, H.; Viljoen, H. A mathematical model of recombinase polymerase amplification under continuously stirred conditions. Biochem. Eng. J. 2016, 112, 193– 201, DOI: 10.1016/j.bej.2016.04.017Google Scholar10https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XnsFWgtLg%253D&md5=bd7b12d644207c54f50d43fe0dfc8cecFA mathematical model of recombinase polymerase amplification under continuously stirred conditionsMoody, Clint; Newell, Heather; Viljoen, HendrikBiochemical Engineering Journal (2016), 112 (), 193-201CODEN: BEJOFV; ISSN:1369-703X. (Elsevier B.V.)Growing interest surrounds isothermal PCR techniques which have great potential for miniaturization for mobile diagnostics. Particularly promising, Recombinase Polymerase Amplification (RPA), combines this advantage of isothermal PCR with simplicity and rapid amplification. A math. model is presented of Recombinase Polymerase Amplification (RPA) and compared to exptl. data. This model identifies the rate limiting steps in the chem. process, the effects of stirring, and insights in to using RPA for quant. measurement of initial DNA concn. Expts. are shown in which DNA amplification occurs under conditions of Couette flow and conditions of rotational turbulent flow. Hand mixing has been shown to dramatically shorten amplification times but introduces unpredictable variability. In some cases, this variability manifests itself as human error induced false negatives, a serious problem for all potential applications. Mech. stirring demonstrates similarly short delay times while retaining high repeatability and reduces the potential for human error.
- 11Abd El Wahed, A.; Patel, P.; Faye, O.; Thaloengsok, S.; Heidenreich, D.; Matangkasombut, P.; Manopwisedjaroen, K.; Sakuntabhai, A.; Sall, A. A.; Hufert, F. T.; Weidmann, M. Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection. PLoS One 2015, 10, e0129682 DOI: 10.1371/journal.pone.0129682Google Scholar11https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xns1Cqsbo%253D&md5=add5ae19a241d7249c1215c2bab5c644Recombinase polymerase amplification assay for rapid diagnostics of dengue infectionAbd El Wahed, Ahmed; Patel, Pranav; Faye, Oumar; Thaloengsok, Sasikanya; Heidenreich, Doris; Matangkasombut, Ponpan; Manopwisedjaroen, Khajohnpong; Sakuntabhai, Anavaj; Sall, Amadou A.; Hufert, Frank T.; Weidmann, ManfredPLoS One (2015), 10 (6), e0129682/1-e0129682/17CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Background Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF). Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR) are the std. method for mol. detection of the dengue virus (DENV). Real-time RT-PCR anal. is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA) assays were developed to detect DENV1-4. Methodol./Principal Findings Using two quant. RNA mol. stds., the anal. sensitivity of a RT-RPA targeting the 3' non-translated region of DENV1-4 was found to range from 14 (DENV4) to 241 (DENV1-3) RNA mols. detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile lab. combining magnetic-bead based total nucleic acid extn. and a portable detection device in Kedougou (Senegal) and in Bangkok (Thailand). In Kedougou, the RT-RPA was operated at an ambient temp. of 38°C with auxiliary electricity tapped from a motor vehicle and yielded a clin. sensitivity and specificity of 98% (n = 31) and 100% (n = 23), resp. While in the field trial in Bangkok, the clin. sensitivity and specificity were 72% (n = 90) and 100% (n = 41), resp. Conclusions/Significance During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.
- 12Faye, O.; Faye, O.; Soropogui, B.; Patel, P.; El Wahed, A. A.; Loucoubar, C.; Fall, G.; Kiory, D.; Magassouba, N.; Keita, S.; Konde, M. K.; Diallo, A. A.; Koivogui, L.; Karlberg, H.; Mirazimi, A.; Nentwich, O.; Piepenburg, O.; Niedrig, M.; Weidmann, M.; Sall, A. A. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015. Eurosurveillance 2015, 20, 30053 DOI: 10.2807/1560-7917.ES.2015.20.44.30053.Google ScholarThere is no corresponding record for this reference.
- 13Frimpong, M.; Ahor, H. S.; Wahed, A. A. E.; Agbavor, B.; Sarpong, F. N.; Laing, K.; Wansbrough-Jones, M.; Phillips, R. O. Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assay. PLoS Neglected Trop. Dis. 2019, 13, e0007155 DOI: 10.1371/journal.pntd.0007155Google Scholar13https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlentLvP&md5=cf719caa66efdc695d68d494ebd10de4Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assayFrimpong, Michael; Ahor, Hubert Senanu; El Wahed, Ahmed Abd; Agbavor, Bernadette; Sarpong, Francisca Naana; Laing, Kenneth; Wansbrough-Jones, Mark; Phillips, Richard OdamePLoS Neglected Tropical Diseases (2019), 13 (2), e0007155CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Access to an accurate diagnostic test for Buruli ulcer (BU) is a research priority according to the World Health Organization. Nucleic acid amplification of insertion sequence IS2404 by polymerase chain reaction (PCR) is the most sensitive and specific method to detect Mycobacterium ulcerans (M. ulcerans), the causative agent of BU. However, PCR is not always available in endemic communities in Africa due to its cost and technol. sophistication. Isothermal DNA amplification systems such as the recombinase polymerase amplification (RPA) have emerged as a mol. diagnostic tool with similar accuracy to PCR but having the advantage of amplifying a template DNA at a const. lower temp. in a shorter time. The aim of this study was to develop RPA for the detection of M. ulcerans and evaluate its use in Buruli ulcer disease. Methodol. and principal findings A specific fragment of IS2404 of M. ulcerans was amplified within 15 min at a const. 42°C using RPA method. The detection limit was 45 copies of IS2404 mol. DNA std. per reaction. The assay was highly specific as all 7 strains of M. ulcerans tested were detected, and no cross reactivity was obsd. to other mycobacteria or clin. relevant bacteria species. The clin. performance of the M. ulcerans (Mu-RPA) assay was evaluated using DNA extd. from fine needle aspirates or swabs taken from 67 patients in whom BU was suspected and 12 patients with clin. confirmed non-BU lesions. All results were compared to a highly sensitive real-time PCR. The clin. specificity of the Mu-RPA assay was 100% (95% CI, 84-100), whiles the sensitivity was 88% (95% CI, 77-95). Conclusion The Mu-RPA assay represents an alternative to PCR, esp. in areas with limited infrastructure.
- 14Kissenkötter, J.; Hansen, S.; Bohlken-Fascher, S.; Ademowo, O. G.; Oyinloye, O. E.; Bakarey, A. S.; Dobler, G.; Tappe, D.; Patel, P.; Czerny, C. P.; Abd El Wahed, A. Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assay. Anal. Biochem. 2018, 544, 29– 33, DOI: 10.1016/j.ab.2017.12.018Google Scholar14https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1Mzjt12nsA%253D%253D&md5=1cd3a9b814ce7ee17745bb3594bda224Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assayKissenkotter Jonas; Hansen Soren; Bohlken-Fascher Susanne; Czerny Claus-Peter; Ademowo Olusegun George; Oyinloye Oladapo Elijah; Bakarey Adeleye Solomon; Dobler Gerhard; Tappe Dennis; Patel Pranav; Abd El Wahed AhmedAnalytical biochemistry (2018), 544 (), 29-33 ISSN:.Rickettsioses are zoonotic vector-transmitted bacterial infections leading to flu-like symptoms and can progress to severe illness in humans. The gold standard for diagnosis of rickettsial infections is the indirect immunofluorescence assay, a serological method which is not suitable for pathogen identification during the acute phase of the disease. Therefore, several real-time PCR assays were developed. These assays are very sensitive, but require high-equipped laboratories and well-trained personnel. Hence, in this study, a rapid point-of-need detection method was developed to detect all Rickettsia species. The 23S and 16S rRNA genes were targeted to develop a recombinase polymerase amplification (RPA) assay. Both 23S and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/reaction, respectively. The 16S_RPA assay detected all tested species, whereas the 23S_RPA assay identified only species of the spotted fever and transitional rickettsial groups. All results were compared with real-time PCR assays directed against the same rickettsial genes. The RPA assays are easy to handle and produced quicker results in comparison to real-time PCRs. Both RPA assays were implemented in a mobile suitcase laboratory to ease the use in rural areas. This method can help to provide rapid management of rickettsial infections.
- 15Patel, P.; Abd El Wahed, A.; Faye, O.; Pruger, P.; Kaiser, M.; Thaloengsok, S.; Ubol, S.; Sakuntabhai, A.; Leparc-Goffart, I.; Hufert, F. T.; Sall, A. A.; Weidmann, M.; Niedrig, M. Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of the Chikungunya Virus. PLoS Neglected Trop. Dis. 2016, 10, e0004953 DOI: 10.1371/journal.pntd.0004953Google Scholar15https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXps1Wgsr4%253D&md5=0a32dac06d81874ab0c2aca86af9f7a3A field-deployable reverse transcription recombinase polymerase amplification assay for rapid detection of the Chikungunya virusPatel, Pranav; Abd El Wahed, Ahmed; Faye, Oumar; Prueger, Pauline; Kaiser, Marco; Thaloengsok, Sasikanya; Ubol, Sukathida; Sakuntabhai, Anavaj; Leparc-Goffart, Isabelle; Hufert, Frank T.; Sall, Amadou A.; Weidmann, Manfred; Niedrig, MatthiasPLoS Neglected Tropical Diseases (2016), 10 (9), e0004953/1-e0004953/15CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Chikungunya virus (CHIKV) is a mosquito-borne virus currently transmitted in about 60 countries. CHIKV causes acute flu-like symptoms and in many cases prolonged musculoskeletal and joint pain. Detection of the infection is mostly done using RT-RCR or ELISA, which are not suitable for point-of-care diagnosis. Methodol./Principal Findings In this study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of the CHIKV was developed. The assay sensitivity, specificity, and crossreactivity were tested. CHIKV RT-RPA assay detected down to 80 genome copies/reaction in a max. of 15 min. It successfully identified 18 isolates representing the three CHIKV genotypes. No cross-reactivity was detected to other alphaviruses and arboviruses except O'nyong'nyong virus, which could be differentiated by a modified RPA primer pair. Seventy-eight samples were screened both by RT-RPA and real-time RT-PCR. The diagnostic sensitivity and specificity of the CHIKV RT-RPA assay were detd. at 100%. Conclusions/Significance The developed RT-RPA assay represents a promising method for the mol. detection of CHIKV at point of need.
- 16Weidmann, M.; Faye, O.; Faye, O.; Abd El Wahed, A.; Patel, P.; Batejat, C.; Manugerra, J. C.; Adjami, A.; Niedrig, M.; Hufert, F. T.; Sall, A. A. Development of Mobile Laboratory for Viral Hemorrhagic Fever Detection in Africa. J. Infect. Dis. 2018, 218, 1622– 1630, DOI: 10.1093/infdis/jiy362Google Scholar16https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MboslOqtg%253D%253D&md5=25b29ecc4ce599d99a3e2e826c725f20Development of Mobile Laboratory for Viral Hemorrhagic Fever Detection in AfricaWeidmann Manfred; Faye Ousmane; Faye Oumar; Sall Amadou A; Abd El Wahed Ahmed; Abd El Wahed Ahmed; Patel Pranav; Batejat Christophe; Manugerra Jean Claude; Adjami Aimee; Niedrig Matthias; Hufert Frank TThe Journal of infectious diseases (2018), 218 (10), 1622-1630 ISSN:.Background: A mobile laboratory transportable on commercial flights was developed to enable local response to viral hemorrhagic fever outbreaks. Methods: The development progressed from use of mobile real-time reverse-transcription polymerase chain reaction to mobile real-time recombinase polymerase amplification. In this study, we describe various stages of the mobile laboratory development. Results: A brief overview of mobile laboratory deployments, which culminated in the first on-site detection of Ebola virus disease (EVD) in March 2014, and their successful use in a campaign to roll back EVD cases in Conakry in the West Africa Ebola virus outbreak are described. Conclusions: The developed mobile laboratory successfully enabled local teams to perform rapid disgnostic testing for viral hemorrhagic fever.
- 17Abd El Wahed, A.; Patel, P.; Heidenreich, D.; Hufert, F. T.; Weidmann, M. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus. PLoS Curr. 2013, 5 DOI: 10.1371/currents.outbreaks.62df1c7c75ffc96cd59034531e2e8364Google ScholarThere is no corresponding record for this reference.
- 18Mondal, D.; Ghosh, P.; Khan, M. A.; Hossain, F.; Bohlken-Fascher, S.; Matlashewski, G.; Kroeger, A.; Olliaro, P.; Abd El Wahed, A. Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay. Parasites Vectors 2016, 9, 281 DOI: 10.1186/s13071-016-1572-8Google Scholar18https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXnvFSnt7g%253D&md5=b3658e21ae02fd06fff5eadd1f694834Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assayMondal, Dinesh; Ghosh, Prakash; Khan, Md. Anik Ashfaq; Hossain, Faria; Bohlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, AhmedParasites & Vectors (2016), 9 (), 281/1-281/8CODEN: PVAEAK; ISSN:1756-3305. (BioMed Central Ltd.)Background: Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clin. symptoms. Mol. diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. Methods: A genomic DNA sample was applied to det. the assay anal. sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clin. performance of the assay was evaluated on LD pos. and neg. samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase lab. (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. Results: The LD RPA assay detected equiv. to one LD genomic DNA. The assay was performed at const. temp. (42°C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected pos. and 48 LD-neg. samples were neg. by both LD RPA and real-time PCR assays, which indicates 100% agreement. The suitcase lab. was successfully operated at the local hospital by using a solar-powered battery. DNA extn. was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. Conclusions: The mobile suitcase lab. using RPA is ideal for rapid sensitive and specific detection of LD esp. at low resource settings and could contribute to VL control and elimination programs.
- 19Abd El Wahed, A.; Weidmann, M.; Hufert, F. T. Diagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. J. Clin. Virol. 2015, 69, 16– 21, DOI: 10.1016/j.jcv.2015.05.004Google Scholar19https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXpt1Ojsr0%253D&md5=ddb861ec74790aa812bb8a314eca7adcDiagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virusAbd El Wahed, Ahmed; Weidmann, Manfred; Hufert, Frank T.Journal of Clinical Virology (2015), 69 (), 16-21CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)In developing countries, equipment necessary for diagnosis is only available in few central labs., which are less accessible and of limited capacity to test large nos. of incoming samples. Moreover, the transport conditions of samples are inadequate, therefore leading to unreliable results. The development of a rapid, inexpensive, and simple test would allow mobile detection of viruses. A suitcase lab. "Diagnostics-in-a-Suitcase" (56 cm × 45.5 cm × 26.5 cm) contg. all reagents and devices necessary for performing a reverse transcription recombinase polymerase amplification (RT-RPA) assay was developed. As an example, two RT-RPA assays were established for the detection of hemagglutinin (H) and neuraminidase (N) genes of the novel avian influenza (H7N9) virus. The sensitivities of the H7 and the N9 RT-RPA assays were 10 and 100 RNA mols., resp. The assays were performed at a single temp. (42 °C). The results were obtained within 2-7 min. The H7N9 RT-RPA assays did not show a cross-detection either of any other respiratory viruses affecting humans and/or birds or of the human or chicken genomes. All reagents were used, stored, and transported at ambient temp., i.e., cold chain independent. In addn., the Diagnostics-in-a-Suitcase was operated by a solar-powered battery. The developed assay protocol and mobile setup performed well. Moreover, it can be easily implemented to perform diagnoses at airports, quarantine stations, or farms for rapid on-site viral nucleic acid detection.
- 20Behrmann, O.; Bachmann, I.; Spiegel, M.; Schramm, M.; El Wahed, A. A.; Dobler, G.; Dame, G.; Hufert, F. T. Rapid detection of SARS-CoV-2 by low volume real-time single tube reverse transcription recombinase polymerase amplification using an exo probe with an internally linked quencher (exo-IQ). Clin Chem. 2020, hvaa116 DOI: 10.1093/clinchem/hvaa116Google ScholarThere is no corresponding record for this reference.
- 21Altman, D. G.; Bland, J. M. Diagnostic tests 2: Predictive values. BMJ 1994, 309, 102 DOI: 10.1136/bmj.309.6947.102Google Scholar21https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADyaK2czht12htQ%253D%253D&md5=c7424bdf402258856c332e2252f94fd4Diagnostic tests 2: Predictive valuesAltman D G; Bland J MBMJ (Clinical research ed.) (1994), 309 (6947), 102 ISSN:0959-8138.There is no expanded citation for this reference.
- 22Tang, Y. W.; Schmitz, J. E.; Persing, D. H.; Stratton, C. W. Laboratory Diagnosis of COVID-19: Current Issues and Challenges. J. Clin. Microbiol. 2020, 58, e00512-20 DOI: 10.1128/JCM.00512-20Google ScholarThere is no corresponding record for this reference.
- 23Xu, R.; Cui, B.; Duan, X.; Zhang, P.; Zhou, X.; Yuan, Q. Saliva: potential diagnostic value and transmission of 2019-nCoV. Int. J. Oral Sci. 2020, 12, 11 DOI: 10.1038/s41368-020-0080-zGoogle Scholar23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXntleit78%253D&md5=1c56e9c5489e23b375942490dc733ce6Saliva: potential diagnostic value and transmission of 2019-nCoVXu, Ruoshi; Cui, Bomiao; Duan, Xiaobo; Zhang, Ping; Zhou, Xuedong; Yuan, QuanInternational Journal of Oral Science (2020), 12 (1), 11CODEN: IJOSFA; ISSN:2049-3169. (Nature Research)A review. Abstr.: 2019-nCoV epidemic was firstly reported at late Dec. of 2019 and has caused a global outbreak of COVID-19 now. Saliva, a biofluid largely generated from salivary glands in oral cavity, has been reported 2019-nCoV nucleic acid pos. Besides lungs, salivary glands and tongue are possibly another hosts of 2019-nCoV due to expression of ACE2. Close contact or short-range transmission of infectious saliva droplets is a primary mode for 2019-nCoV to disseminate as claimed by WHO, while long-distance saliva aerosol transmission is highly environment dependent within indoor space with aerosol-generating procedures such as dental practice. So far, no direct evidence has been found that 2019-nCoV is vital in air flow for long time. Therefore, to prevent formation of infectious saliva droplets, to thoroughly disinfect indoor air and to block acquisition of saliva droplets could slow down 2019-nCoV dissemination. This review summarizes diagnostic value of saliva for 2019-nCoV, possibly direct invasion into oral tissues, and close contact transmission of 2019-nCoV by saliva droplets, expecting to contribute to 2019-nCoV epidemic control.
- 24Wang, W.; Xu, Y.; Gao, R.; Lu, R.; Han, K.; Wu, G.; Tan, W. Detection of SARS-CoV-2 in Different Types of Clinical Specimens. JAMA 2020, 323, 1843– 1844, DOI: 10.1001/jama.2020.3786Google Scholar24https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXps1Srurs%253D&md5=a81f303ff3bb23c0d9b23dca48fd1315Detection of SARS-CoV-2 in different types of clinical specimensWang, Wenling; Xu, Yanli; Gao, Ruqin; Lu, Roujian; Han, Kai; Wu, Guizhen; Tan, WenjieJAMA, the Journal of the American Medical Association (2020), 323 (18), 1843-1844CODEN: JAMAAP; ISSN:1538-3598. (American Medical Association)The present article describes about detection of SARS-CoV-2 in different types of clin. specimens.
- 25Gandhi, M.; Yokoe, D. S.; Havlir, D. V. Asymptomatic Transmission, the Achilles’ Heel of Current Strategies to Control Covid-19. N. Engl. J. Med. 2020, 382, 2158– 2160, DOI: 10.1056/NEJMe2009758Google Scholar25https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVGqsrfF&md5=9758bf5634365e6044e42b6c8b57b5b3Asymptomatic transmission, the Achilles' heel of current strategies to control Covid-19Gandhi, Monica; Yokoe, Deborah S.; Havlir, Diane V.New England Journal of Medicine (2020), 382 (22), 2158-2160CODEN: NEJMAG; ISSN:1533-4406. (Massachusetts Medical Society)A review. A brief editorial discussing the role of asymptomatic transmission in the spread and severity of the current SARS-CoV-2 pandemic. The authors contrast the differences between the current SARS-CoV-2 pandemic and the SARS-CoV-1 epidemic of 2003. High levels of SARS-CoV-2 virus are shed from the upper respiratory tract of patients, even before symptoms are obsd. In contrast, replication of SARS-CoV-1 occurs mainly in the lower respiratory tract, and viral shedding occurs later, when patients are symptomatic. Asymptomatic transmission of SARS-CoV-2 is the Achilles' heel of COVID-19 pandemic control through the public health strategies we have currently deployed. Because of this, testing of asymptomatic individuals, social distancing, and the general use of face masks in public spaces are the main tools to deal with this pandemic.
- 26FIND WHO Find Evaluation Update: SARSCOV-2 Molecular Diagnostics. https://www.finddx.org/covid-19/sarscov2-eval-molecular/ (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 27FIND-WHO FIND Evaluation Update: SARSCOV-2 Immunoassays. https://www.finddx.org/covid-19/sarscov2-eval-immuno/ (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 28FDA Coronavirus (COVID-19) Update: FDA AuthorizesFirst Antigen Test to Help in the Rapid Detection of the Virus thatCauses COVID-19 in Patients. https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-authorizes-first-antigen-test-help-rapid-detection-virus-causes (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 29FIND-WHO SARS-COV-2 Diagnostic Pipeline. https://www.finddx.org/covid-19/pipeline/?avance=all&type=Manual+NAT&test_target=RNA&status=all§ion=molecular-assays&action=default#diag_tab (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 30Huang, W. E.; Lim, B.; Hsu, C. C.; Xiong, D.; Wu, W.; Yu, Y.; Jia, H.; Wang, Y.; Zeng, Y.; Ji, M.; Chang, H.; Zhang, X.; Wang, H.; Cui, Z. RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2. Microb. Biotechnol. 2020, 13, 950– 961, DOI: 10.1111/1751-7915.13586Google Scholar30https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtFaiurjP&md5=dbad600a2f4c7565871114ce09b72b6fRT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2Huang, Wei E.; Lim, Boon; Hsu, Chia-Chen; Xiong, Dan; Wu, Wei; Yu, Yejiong; Jia, Huidong; Wang, Yun; Zeng, Yida; Ji, Mengmeng; Chang, Hong; Zhang, Xiuming; Wang, Hui; Cui, ZhanfengMicrobial Biotechnology (2020), 13 (4), 950-961CODEN: MBIIB2; ISSN:1751-7915. (Wiley-Blackwell)Summary : The pandemic coronavirus SARS-CoV-2 in the world has caused a large infected population suffering from COVID-19. To curb the spreading of the virus, WHO urgently demanded an extension of screening and testing; thus, a rapid and simple diagnostic method is needed. We applied a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) to achieve the detection of SARS-CoV-2 in 30 min. We designed four sets of LAMP primers (6 primers in each set), targeting the viral RNA of SARS-CoV-2 in the regions of orf1ab, S gene and N gene. A colorimetric change was used to report the results, which enables the outcome of viral RNA amplification to be read by the naked eye without the need of expensive or dedicated instrument. The sensitivity can be 80 copies of viral RNA per mL in a sample. We validated the RT-LAMP method in a hospital in China, employing 16 clinic samples with 8 positives and 8 negatives. The testing results are consistent with the conventional RT-qPCR. In addn., we also show that one-step process without RNA extn. is feasible to achieve RNA amplification directly from a sample. This rapid, simple and sensitive RT-LAMP method paves a way for a large screening at public domain and hospitals, particularly regional hospitals and medical centers in rural areas.
- 31Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826 DOI: 10.3390/ijms21082826Google Scholar31https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVCnsrvJ&md5=f6b267272b5bb8b6ca09e7eb158c69d8A novel reverse transcription loop-mediated isothermal amplification method for rapid detection of SARS-CoV-2Lu, Renfei; Wu, Xiuming; Wan, Zhenzhou; Li, Yingxue; Jin, Xia; Zhang, ChiyuInternational Journal of Molecular Sciences (2020), 21 (8), 2826CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)COVID-19 has become a major global public health burden, currently causing a rapidly growing no. of infections and significant morbidity and mortality around the world. Early detection with fast and sensitive assays and timely intervention are crucial for interrupting the spread of the COVID-19 virus (SARS-CoV-2). Using a mismatch-tolerant amplification technique, we developed a simple, rapid, sensitive and visual reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for SARS-CoV-2 detection based on its N gene. The assay has a high specificity and sensitivity, and robust reproducibility, and its results can be monitored using a real-time PCR machine or visualized via colorimetric change from red to yellow. The limit of detection (LOD) of the assay is 118.6 copies of SARS-CoV-2 RNA per 25μL reaction. The reaction can be completed within 30 min for real-time fluorescence monitoring, or 40 min for visual detection when the template input is more than 200 copies per 25μL reaction. To evaluate the viability of the assay, a comparison between the RT-LAMP and a com. RT-qPCR assay was made using 56 clin. samples. The SARS-CoV-2 RT-LAMP assay showed perfect agreement in detection with the RT-qPCR assay. The newly-developed SARS-CoV-2 RT-LAMP assay is a simple and rapid method for COVID-19 surveillance.
- 32Hin, S.; Lopez-Jimena, B.; Bakheit, M.; Klein, V.; Stack, S.; Fall, C.; Sall, A. A.; Enan, K.; Mustafa, M.; Gillies, L.; Rusu, V.; Goethel, S.; Paust, N.; Zengerle, R.; Frischmann, S.; Weidmann, M. Fully automated point-of-care differential diagnosis of acute febrile illness. Submitted 2020.Google ScholarThere is no corresponding record for this reference.
- 33van Kasteren, P. B.; van der Veer, B.; van den Brink, S.; Wijsman, L.; de Jonge, J.; van den Brandt, A.; Molenkamp, R.; Reusken, C.; Meijer, A. Comparison of seven commercial RT-PCR diagnostic kits for COVID-19. J. Clin. Virol. 2020, 128, 104412 DOI: 10.1016/j.jcv.2020.104412Google Scholar33https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpsVOlsLw%253D&md5=dd81dd0488b264997d12426048264553Comparison of seven commercial RT-PCR diagnostic kits for COVID-19van Kasteren, Puck B.; van der Veer, Bas; van den Brink, Sharon; Wijsman, Lisa; de Jonge, Joergen; van den Brandt, Annemarie; Molenkamp, Richard; Reusken, Chantal B. E. M.; Meijer, AdamJournal of Clinical Virology (2020), 128 (), 104412CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)The final months of 2019 witnessed the emergence of a novel coronavirus in the human population. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has since spread across the globe and is posing a major burden on society. Measures taken to reduce its spread critically depend on timely and accurate identification of virus-infected individuals by the most sensitive and specific method available, i.e. real-time reverse transcriptase PCR (RT-PCR). Many com. kits have recently become available, but their performance has not yet been independently assessed. The aim of this study was to compare basic anal. and clin. performance of selected RT-PCR kits from 7 different manufacturers (Altona Diagnostics, BGI, CerTest Biotec, KH Medical, PrimerDesign, R-Biopharm AG, and Seegene). We used serial dilns. of viral RNA to establish PCR efficiency and est. the 95% limit of detection (LOD95). Furthermore, we ran a panel of SARS-CoV-2-pos. clin. samples (n = 13) for a preliminary evaluation of clin. sensitivity. Finally, we used clin. samples pos. for non-coronavirus respiratory viral infections (n = 6) and a panel of RNA from related human coronaviruses to evaluate assay specificity. PCR efficiency was ≥96% for all assays and the estd. LOD95 varied within a 6-fold range. Using clin. samples, we obsd. some variations in detection rate between kits. Importantly, none of the assays showed cross-reactivity with other respiratory (corona)viruses, except as expected for the SARS-CoV-1 E-gene. We conclude that all RT-PCR kits assessed may be used for routine diagnostics of COVID-19 in patients by experienced mol. diagnostic labs.
- 34Wu, T.; Ge, Y.; Zhao, K.; Zhu, X.; Chen, Y.; Wu, B.; Zhu, F.; Zhu, B.; Cui, L. A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2). Virology 2020, 549, 1– 4, DOI: 10.1016/j.virol.2020.07.006Google Scholar34https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsFersLfP&md5=e73a612fac6de12675e92442464cc3c7A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)Wu, Tao; Ge, Yiyue; Zhao, Kangchen; Zhu, Xiaojuan; Chen, Yin; Wu, Bin; Zhu, Fengcai; Zhu, Baoli; Cui, LunbiaoVirology (2020), 549 (), 1-4CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)The current outbreak of coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was reported in China firstly. A rapid, highly sensitive, specific, and simple operational method was needed for the detection of SARS-CoV-2. Here, we established a real-time reverse-transcription recombinase-aided amplification assay (RT-RAA) to detect SARS-CoV-2 rapidly. The primers and probe were designed based on the nucleocapsid protein gene (N gene) sequence of SARS-CoV-2. The detection limit was 10 copies per reaction in this assay, which could be conducted within 15 min at a const. temp. (39°), without any cross-reactions with other respiratory tract pathogens, such as other coronaviruses. Furthermore, compared with com. real-time RT-PCR assay, it showed a kappa value of 0.959 from 150 clin. specimens. These results indicated that this real-time RT-RAA assay may be a valuable tool for detecting SARS-CoV-2.
- 35Cohen, A. N.; Kessel, B. False positives in reverse transcription PCR testing for SARS-CoV-2. medRxiv 2020, 20080911 DOI: 10.1101/2020.04.26.20080911Google ScholarThere is no corresponding record for this reference.
- 36Bustin, S. A.; Nolan, T. RT-qPCR Testing of SARS-CoV-2: A Primer. Int. J. Mol. Sci. 2020, 21, 3004 DOI: 10.3390/ijms21083004Google Scholar36https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVCnsr%252FM&md5=23eaceb715052b1866587d26c1421129RT-qPCR testing of SARS-CoV-2: a primerBustin, Stephen A.; Nolan, TaniaInternational Journal of Molecular Sciences (2020), 21 (8), 3004CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)A review and commentary regarding testing for the presence of coronavirus which is an essential diagnostic tool for monitoring and managing the current COVID-19 pandemic. The only reliable test in current use for testing acute infection targets the genome of SARS-CoV-2, and the most widely used method is quant. fluorescence-based reverse transcription polymerase chain reaction (RT-qPCR). Despite its ubiquity, there is a significant amt. of uncertainty about how this test works, potential throughput and reliability. This has resulted in widespread misrepresentation of the problems faced using this test during the current COVID-19 epidemic. This primer provides simple, straightforward and impartial information about RT-qPCR.
- 37Falasca, F.; Sciandra, I.; Di Carlo, D.; Gentile, M.; Deales, A.; Antonelli, G.; Turriziani, O. Detection of SARS-COV N2 Gene: Very low amounts of viral RNA or false positive?. J. Clin. Virol. 2020, 133, 104660 DOI: 10.1016/j.jcv.2020.104660Google Scholar37https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitFCku7fN&md5=e2cad1c00486e013d7f21a58564ce14fDetection of SARS-COV N2 Gene: Very low amounts of viral RNA or false positive?Falasca, Francesca; Sciandra, Ilaria; Di Carlo, Daniele; Gentile, Massimo; Deales, Alberto; Antonelli, Guido; Turriziani, OmbrettaJournal of Clinical Virology (2020), 133 (), 104660CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)The detection of a low amt. of viral RNA is crucial to identify a SARS-CoV-2 pos. individual harboring a low level of virus, esp. during the convalescent period. However, the detection of one gene at high Cycle threshold (Ct) has to be interpreted with caution. In this study the authors address this specific issue and report the authors' real-life experience. A total of 1639 nasopharyngeal swabs (NPS) were analyzed with Xpert Xpress SARS-CoV-2. Pos. samples showing high Ct values (Ct>35) were concd. by centrifugation and re-tested with Cepheid or other methods (RealStar SARS-CoV2 RT-PCR, Altona Diagnostics; GeneFinder COVID-19 Plus RealAmp Kit, Elitech).1599 (97.5%) neg. samples, 36 (2.3%) pos. samples and 4 (0.2%) presumptive pos. samples were detected. In 17 out of 36 pos. patients, very low viral RNA copies were suspected since positivity was detected at high Ct. The authors confirmed positivity for patients who showed both E and N genes detected and for patients with only N detected but with Ct <39. On the contrary, samples with only gene N detected with Ct values >39 were found neg. NPS taken 24 h after the first collection confirmed the negativity of the 12 samples. Clin. data sustained these results since only 2 of these 12 patients showed COVID-19-like symptoms. These data support the authors' consideration that detection of the N2 gene at high Ct needs to be interpreted with caution, suggesting that collaboration between virologists and clinicians is important for better understanding of results.
- 38Wang, J.; Cai, K.; He, X.; Shen, X.; Wang, J.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Cui, L.; Ge, Y.; Wu, T.; Zhang, Y.; Yan, H.; Chen, Y.; Yu, J.; Ma, X.; Shi, H.; Zhang, R.; Li, X.; Gao, Y.; Niu, P.; Tan, W.; Wu, G.; Jiang, Y.; Xu, W.; Ma, X. Multiple-centre clinical evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNA. Clin. Microbiol. Infect. 2020, 26, 1076– 1081, DOI: 10.1016/j.cmi.2020.05.007Google Scholar38https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVGms73N&md5=72f9832fa5635fa39e90886b9fcba585Multiple-centre clinical evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNAWang, J.; Cai, K.; He, X.; Shen, X.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Cui, L.; Ge, Y.; Wu, T.; Zhang, Y.; Yan, H.; Chen, Y.; Yu, J.; Ma, X.; Shi, H.; Zhang, R.; Li, X.; Gao, Y.; Niu, P.; Tan, W.; Wu, G.; Jiang, Y.; Xu, W.Clinical Microbiology and Infection (2020), 26 (8), 1076-1081CODEN: CMINFM; ISSN:1198-743X. (Elsevier Ltd.)To evaluate the performance of an ultrafast single-tube nucleic acid isothermal amplification detection assay for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA using clin. samples from multiple centers.A reverse transcription recombinase-aided amplification (RT-RAA) assay for SARS-CoV-2 was conducted within 15 min at 39°C with portable instruments after addn. of extd. RNA. The clin. performance of RT-RAA assay was evaluated using 947 clin. samples from five institutions in four regions of China; approved com. fluorescence quant. real-time PCR (qRT-PCR) kits were used for parallel detection. The sensitivity and specificity of RT-RAA were compared and analyzed.The RT-RAA test results of 926 samples were consistent with those of qRT-PCR (330 were pos., 596 neg.); 21 results were inconsistent. The sensitivity and specificity of RT-RAA was 97.63% (330/338, 95% confidence interval (CI) 95.21 to 98.90) and 97.87% (596/609, 95% CI 96.28 to 98.81) resp. The pos. and neg. predictive values were 96.21% (330/343, 95% CI 93.45 to 97.88) and 98.68% (596/604, 95% CI 97.30 to 99.38) resp. The total coincidence rate was 97.78% (926/947, 95% CI 96.80 to 98.70), and the kappa was 0.952 (p < 0.05).With comparable sensitivity and specificity to the com. qRT-PCR kits, RT-RAA assay for SARS-CoV-2 exhibited the distinctive advantages of simplicity and rapidity in terms of operation and turnaround time.
- 39Kanwar, N.; Michael, J.; Doran, K.; Montgomery, E.; Selvarangan, R. Comparison of the ID Now Influenza A & B 2, Cobas Influenza A/B, and Xpert Xpress Flu Point-of-Care Nucleic Acid Amplification Tests for Influenza A/B Virus Detection in Children. J. Clin. Microbiol. 2020, 58, e01611-19 DOI: 10.1128/JCM.01611-19Google ScholarThere is no corresponding record for this reference.
- 40Zhen, W.; Smith, E.; Manji, R.; Schron, D.; Berry, G. J. Clinical Evaluation of Three Sample-To-Answer Platforms for the Detection of SARS-CoV-2. J. Clin. Microbiol. 2020, 58, 1– 7, DOI: 10.1128/JCM.00783-20Google ScholarThere is no corresponding record for this reference.
- 41FDA Coronavirus (COVID-19) Update: FDA Informs Public About Possible Accuracy Concerns with Abbott ID NOW Point-of-Care Test. https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-informs-public-about-possible-accuracy-concerns-abbott-id-now-point (accessed June 25, 2020).Google ScholarThere is no corresponding record for this reference.
- 42Barratt, K.; Mackay, J. F. Improving real-time PCR genotyping assays by asymmetric amplification. J. Clin. Microbiol. 2002, 40, 1571– 1572, DOI: 10.1128/JCM.40.4.1571-1572.2002Google Scholar42https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XjtlCmsbo%253D&md5=a096c1ed38431fdcce0af0b256789e1eImproving real-time PCR genotyping assays by asymmetric amplificationBarratt, Kevin; Mackay, John F.Journal of Clinical Microbiology (2002), 40 (4), 1571-1572CODEN: JCMIDW; ISSN:0095-1137. (American Society for Microbiology)The commonly used protocol for real-time PCR using the LightCycler system for herpes simplex virus genotyping was found to provide poor results when specific reagent concns. are used. The PCR resulted in the "hook effect" phenomenon, which suggests that in the later cycles of the PCR, the amplified strands reanneal before the probes can bind to generate fluorescence. To overcome this problem, the use of asym. primer concns. is recommended, whereby a higher concn. of the reverse primer is used in the reaction. This results in more of the strand complementary to the probes being amplified and allows more signal to be generated. The use of asym. primer concns. should be considered when new LightCycler genotyping assays that result in the hook effect on the quantitation screen are being optimized.
- 43Mackay, I. M.; Jacob, K. C.; Woolhouse, D.; Waller, K.; Syrmis, M. W.; Whiley, D. M.; Siebert, D. J.; Nissen, M.; Sloots, T. P. Molecular assays for detection of human metapneumovirus. J. Clin. Microbiol. 2003, 41, 100– 105, DOI: 10.1128/JCM.41.1.100-105.2003Google Scholar43https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXhtFGmtbk%253D&md5=e255278e680b6a6050b314703cbd9f8eMolecular assays for detection of human metapneumovirusMackay, Ian M.; Jacob, Kevin C.; Woolhouse, Daniel; Waller, Katharine; Syrmis, Melanie W.; Whiley, David M.; Siebert, David J.; Nissen, Michael; Sloots, Theo P.Journal of Clinical Microbiology (2003), 41 (1), 100-105CODEN: JCMIDW; ISSN:0095-1137. (American Society for Microbiology)The recent description of the respiratory pathogen human metapneumovirus (hMPV) has highlighted a deficiency in current diagnostic techniques for viral agents assocd. with acute lower respiratory tract infections. We describe two novel approaches to the detection of viral RNA by use of reverse transcriptase PCR (RT-PCR). The PCR products were identified after capture onto a solid-phase medium by hybridization with a sequence-specific, biotinylated oligonucleotide probe. The assay was applied to the screening of 329 nasopharyngeal aspirates sampled from patients suffering from respiratory tract disease. These samples were neg. for other common microbial causes of respiratory tract disease. We were able to detect hMPV sequences in 32 (9.7%) samples collected from Australian patients during 2001. To further reduce result turnaround times we designed a fluorogenic TaqMan oligoprobe and combined it with the existing primers for use on the LightCycler platform. The real-time RT-PCR proved to be highly reproducible and detected hMPV in an addnl. 6 out of 62 samples (9.6%) tested during the comparison of the two diagnostic approaches. We found the real-time RT-PCR to be the test of choice for future investigation of samples for hMPV due to its speed, reproducibility, specificity, and sensitivity.
- 44Pillonel, T.; Scherz, V.; Jaton, K.; Greub, G.; Bertelli, C. Letter to the editor: SARS-CoV-2 detection by real-time RT-PCR. Eurosurveillance 2020, 25, 2000880 DOI: 10.2807/1560-7917.ES.2020.25.21.2000880Google Scholar44https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtV2ntrrF&md5=4b0ffe196e99aed8a50369e930f27e8cLetter to the editor: SARS-CoV-2 detection by real-time RT-PCRPillonel, Trestan; Scherz, Valentin; Jaton, Katia; Greub, Gilbert; Bertelli, ClaireEurosurveillance (2020), 25 (21), 2000880CODEN: EUROGD; ISSN:1560-7917. (European Centre for Disease Prevention and Control)There is no expanded citation for this reference.
- 45Skerra, A. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. 1992, 20, 3551– 3554, DOI: 10.1093/nar/20.14.3551Google Scholar45https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK38Xmt1OhsL4%253D&md5=b90ace39c184d564b19dc29115c56f48Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activitySkerra, ArneNucleic Acids Research (1992), 20 (14), 3551-4CODEN: NARHAD; ISSN:0305-1048.Two thermostable DNA polymerases with proofreading activity-Vent DNA polymerase and Pfu DNA polymerase-have attracted recent attention, mainly because of their enhanced fidelities during amplification of DNA sequences by the polymerase chain reaction. A severe disadvantage of their practical application, however, results from the observation that due to their 3' to 5' exonuclease activities these enzymes degrade the oligodeoxynucleotides serving as primers for the DNA synthesis. It is demonstrated that this exonucleolytic attack on the primer mols. can be efficiently prevented by the introduction of single phosphorothioate bonds at their 3' termini. This strategy, which can be easily accomplished using routine DNA synthesis methodol., may open the way to a widespread use of these novel enzymes in the polymerase chain reaction.
- 46(BAuA), B. f. A. u. A. Empfehlungen zu Arbeitsschutzmaßnahmen bei der Point-Of-Care-SARS-CoV-2 Diagnostik. (accessed Nov 8, 2020).Google ScholarThere is no corresponding record for this reference.
- 47Fomsgaard, A. S.; Rosenstierne, M. W. An alternative workflow for molecular detection of SARS-CoV-2 - escape from the NA extraction kit-shortage, Copenhagen, Denmark, March 2020. Eurosurveillance 2020, 25, 2000398 DOI: 10.2807/1560-7917.es.2020.25.14.2000398Google ScholarThere is no corresponding record for this reference.
- 48Lista, mJ.; Page, R.; Sertkaya, H.; Matos, P.; Ortiz-Zapater, E.; Maguire, T. J. A.; Poulton, K.; O’Byrne, A.; Bouton, C.; Dickenson, R. E.; Ficarelli, M.; Howard, M.; Betancor, G.; Galao, R. P.; Pickering, S.; Signell, A. W.; Wilson, H.; Cliff, P.; Ik, M. T. K.; Patel, A.; MacMahon, E.; Cunningham, E.; Doores, K.; Agromayor, M.; Martin-Serrano, J. M.; Perucha, E.; Mischo, H. E.; Shankar-Hari, M.; Batra, R.; Edgeworth, J.; Malim, M. H.; Neil, S.; Martinez-Nunez, R. T. Resilient SARS-CoV-2 diagnostics workflows including viral heat inactivation medRxiv 2020, DOI: 10.1101/2020.04.22.20074351 .Google ScholarThere is no corresponding record for this reference.
- 49Kuiper, J. W. P.; Baade, T.; Kremer, M.; Kranaster, R.; Irmisch, L.; Schuchmann, M.; Zander, J.; Marx, A.; Hauck, C. R. Detection of SARS-CoV-2 from raw patient samples by coupled high temperature reverse transcription and amplification. PLoS One 2020, 15, e0241740 DOI: 10.1371/journal.pone.0241740Google Scholar49https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXit1ylu7%252FJ&md5=2115bcf1eb0b96dadbcf24f6901ac25cDetection of SARS-CoV-2 from raw patient samples by coupled high temperature reverse transcription and amplificationKuiper, Johannes W. P.; Baade, Timo; Kremer, Marcel; Kranaster, Ramon; Irmisch, Linda; Schuchmann, Marcus; Zander, Johannes; Marx, Andreas; Hauck, Christof R.PLoS One (2020), 15 (11), e0241740CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)SARS-CoV-2 is spreading globally with unprecedented consequences for modern societies. The early detection of infected individuals is a pre-requisite to contain the virus. Currently, purifn. of RNA from patient samples followed by RT-PCR is the gold std. to assess the presence of this single-strand RNA virus. However, these procedures are time consuming, require continuous supply of specialized reagents, and are prohibitively expensive in resource-poor settings. Here, we report an improved nucleic-acid-based approach to detect SARS-CoV-2 with the ability to detect as little as five viral genome equiv. The approach delivers results without the need to purify RNA, reduces handling steps, minimizes costs, and allows evaluation by non-specialized equipment. The use of unprocessed swab samples is enabled by employing a heat-stable RNA- and DNA-dependent DNA polymerase, which performs the double task of stringent reverse transcription of RNA at elevated temps. as well as PCR amplification of a SARS-CoV-2 specific target gene. As results are obtained within 2 h and can be read-out by a hand-held LED-screen, this novel protocol will be of particular importance for large-scale virus surveillance in economically constrained settings.
- 50Bonney, L. C.; Watson, R. J.; Afrough, B.; Mullojonova, M.; Dzhuraeva, V.; Tishkova, F.; Hewson, R. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection. PLoS Neglected Trop. Dis. 2017, 11, e0006013 DOI: 10.1371/journal.pntd.0006013Google Scholar50https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVKgu73M&md5=9c90b245efccd49410a012ccd1984ce4A recombinase polymerase amplification assay for rapid detection of Crimean-Congo haemorrhagic fever virus infectionBonney, Laura C.; Watson, Robert J.; Afrough, Babak; Mullojonova, Manija; Dzhuraeva, Viktoriya; Tishkova, Farida; Hewson, RogerPLoS Neglected Tropical Diseases (2017), 11 (10), e0006013/1-e0006013/16CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Crimean-Congo Haemorrhagic fever Virus (CCHFV) is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia. Methodol./principle findings An isothermal recombinase polymerase amplification (RPA) assay was successfully developed for mol. detection of CCHFV. The assay showed rapid (under 10 min) detection of viral exts./synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude prepns. of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample prepn. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clin. samples from Tajikistan. Conclusions/significance The assay is a rapid, isothermal, simple-to-perform mol. diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource labs., for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.
- 51Daher, R. K.; Stewart, G.; Boissinot, M.; Bergeron, M. G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947– 58, DOI: 10.1373/clinchem.2015.245829Google Scholar51https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsFOhsLbE&md5=37fd60617f2bf006e015e1dcc2d9fe5cRecombinase polymerase amplification for diagnostic applicationsDaher, Rana K.; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G.Clinical Chemistry (Washington, DC, United States) (2016), 62 (7), 947-958CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)A review. BACKGROUND: First introduced in 2006, recombinase polymerase amplification (RPA) has stirred great interest, as evidenced by 75 publications as of Oct. 2015, with 56 of them just in the last 2 years. The widespread adoption of this isothermal mol. tool in many diagnostic fields represents an affordable (approx. 4.3 USD per test), simple (few and easy hands-on steps), fast (results within 5-20 min), and sensitive (single target copy no. detected) method for the identification of pathogens and the detection of single nucleotide polymorphisms in human cancers and genetically modified organisms. CONTENT: This review summarizes the current knowledge on RPA. The mol. diagnostics of various RNA/DNA pathogens is discussed while highlighting recent applications in clin. settings with focus on point-of-care (POC) bioassays and on automated fluidic platforms. The strengths and limitations of this isothermal method are also addressed. SUMMARY: RPA is becoming a mol. tool of choice for the rapid, specific, and cost-effective identification of pathogens. Owing to minimal sample-prepn. requirements, low operation temp. (25-42 °C), and com. availability of freeze-dried reagents, this method has been applied outside lab. settings, in remote areas, and interestingly, onboard automated sample-to-answer microfluidic devices. RPA is undoubtedly a promising isothermal mol. technique for clin. microbiol. labs. and emergence response in clin. settings.
- 52Daher, R. K.; Stewart, G.; Boissinot, M.; Bergeron, M. G. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples. Clin. Chem. 2014, 60, 660– 666, DOI: 10.1373/clinchem.2013.213504Google Scholar52https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmt1ClurY%253D&md5=420a93fb3bad2420bee745edc6cc3453Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samplesDaher, Rana K.; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G.Clinical Chemistry (Washington, DC, United States) (2014), 60 (4), 660-666CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)Group B streptococcal infections are the leading cause of sepsis and meningitis in newborns. A rapid and reliable method for the detection of this pathogen at the time of delivery is needed for the early treatment of neonates. Isothermal amplification techniques such as recombinase polymerase amplification have advantages relative to PCR in terms of the speed of reaction and simplicity. We studied the clin. performance of recombinase polymerase amplification for the screening of group B streptococci in vaginal/anal samples from 50 pregnant women. We also compared the limit of detection and the anal. specificity of this isothermal assay to real-time PCR (RT-PCR). Compared to RT-PCR, the recombinase polymerase amplification assay showed a clin. sensitivity of 96% and a clin. specificity of 100%. The limit of detection was 98 genome copies and the anal. specificity was 100% for a panel of 15 bacterial and/or fungal strains naturally found in the vaginal/anal flora. Time-to-result for the recombinase polymerase amplification assay was <20 min compared to 45 min for the RT-PCR assay; a pos. sample could be detected as early as 8 min. We demonstrate the potential of isothermal recombinase polymerase amplification assay as a clin. useful mol. diagnostic tool that is simple and faster than PCR/RT-PCR. Recombinase polymerase amplification offers great potential for nucleic acid-based diagnostics at the point of care.
Cited By
Click to copy section linkSection link copied!
This article is cited by 86 publications.
- Jaeyoung K. Jung, Kathleen S. Dreyer, Kate E. Dray, Joseph J. Muldoon, Jithin George, Sasha Shirman, Maria D. Cabezas, Anne E. d’Aquino, Matthew S. Verosloff, Kosuke Seki, Grant A. Rybnicky, Khalid K. Alam, Neda Bagheri, Michael C. Jewett, Joshua N. Leonard, Niall M. Mangan, Julius B. Lucks. Developing, Characterizing, and Modeling CRISPR-Based Point-of-Use Pathogen Diagnostics. ACS Synthetic Biology 2025, 14
(1)
, 129-147. https://doi.org/10.1021/acssynbio.4c00469
- Juhee Lee, Taegu Lee, Ha Neul Lee, Hyoungsoo Kim, Yoo Kyung Kang, Seunghwa Ryu, Hyun Jung Chung. Simple and Multiplexed Detection of Nucleic Acid Targets Based on Fluorescent Ring Patterns and Deep Learning Analysis. ACS Applied Materials & Interfaces 2023, 15
(47)
, 54335-54345. https://doi.org/10.1021/acsami.3c14112
- Ou Hu, Zeyu Li, Jinghao Wu, Yaoju Tan, Zuanguang Chen, Yanli Tong. A Multicomponent Nucleic Acid Enzyme-Cleavable Quantum Dot Nanobeacon for Highly Sensitive Diagnosis of Tuberculosis with the Naked Eye. ACS Sensors 2023, 8
(1)
, 254-262. https://doi.org/10.1021/acssensors.2c02114
- Rongxin Fu, Wenli Du, Xiangyu Jin, Ruliang Wang, Xue Lin, Ya Su, Han Yang, Xiaohui Shan, Wenqi Lv, Zhi Zheng, Guoliang Huang. Microfluidic Biosensor for Rapid Nucleic Acid Quantitation Based on Hyperspectral Interferometric Amplicon-Complex Analysis. ACS Sensors 2021, 6
(11)
, 4057-4066. https://doi.org/10.1021/acssensors.1c01491
- Carlos Manzanas, Md. Mahbubul Alam, Julia C. Loeb, John A. Lednicky, Chang-Yu Wu, Z. Hugh Fan. A Valve-Enabled Sample Preparation Device with Isothermal Amplification for Multiplexed Virus Detection at the Point-of-Care. ACS Sensors 2021, 6
(11)
, 4176-4184. https://doi.org/10.1021/acssensors.1c01718
- Ji-Ho Park, Kihyeun Kim, Bobin Lee, Hyungjun Jang, Min-Gon Kim. A portable, rapid isothermal amplification kit enabling naked eye detection of SARS-CoV-2 RNAs. Talanta 2025, 285 , 127327. https://doi.org/10.1016/j.talanta.2024.127327
- Dayong Li, Yanheng Yao, Wenting Cheng, Feifan Yin, Miao He, Yang Xiang. Amplification-free detection method for pathogen nucleic acid based on manganese ion enhanced CRISPR system and magnetic enrichment. Sensors and Actuators B: Chemical 2025, 426 , 137154. https://doi.org/10.1016/j.snb.2024.137154
- Md. Safiul Alam Bhuiyan, Suman Das Gupta, Juplikely James Silip, Saranika Talukder, Md. Hakimul Haque, Jade K. Forwood, Subir Sarker. Current trends and future potential in the detection of avian coronaviruses: An emphasis on sensors-based technologies.. Virology 2025, 12 , 110399. https://doi.org/10.1016/j.virol.2025.110399
- Hooman Hanifehpour, Fatemeh Ashrafi, Elham Siasi, Shirzad Fallahi. Evaluation and comparison of one-step real-time PCR and one-step RT-LAMP methods for detection of SARS-CoV-2. BMC Infectious Diseases 2024, 24
(1)
https://doi.org/10.1186/s12879-024-09574-9
- José Guadalupe Ávila-Hernández, Alejandro Coreño-Alonso, Mario Alberto Pantoja-Alonso, Francisco Javier Córdoba-Andrade, Rogelio González-González, Corina E. Díaz-Quezada, Alberto Camas-Reyes, Agustino Martínez-Antonio. Step-by-Step Development of a Recombinase Polymerase Amplification (RPA) Assay for Sex Identification in Papaya. Applied Biosciences 2024, 3
(4)
, 426-437. https://doi.org/10.3390/applbiosci3040027
- Jingwei Chen, Tingting Liu, Yule Zhang, Mengnan Duan, Zhijin Yang, Mengya Chen, Yiran Wang, Lulu Zheng, Songlin Zhuang, Dawei Zhang. One-step time-resolved cascade logic gate microfluidic chip for home testing of SARS-CoV-2 and flu B. Biosensors and Bioelectronics 2024, 263 , 116564. https://doi.org/10.1016/j.bios.2024.116564
- João M. Vindeirinho, Eva Pinho, Licínia Gomes, Raquel Guiomar, Rea Maja Kobialka, Ahmed Abd El Wahed, Nuno F. Azevedo, Carina Almeida. RT-RAA with a lateral flow assay readout based on ssDNA hybridization for detection of RNA viruses – the case of SARS-CoV-2. Sensors and Actuators B: Chemical 2024, 9 , 136864. https://doi.org/10.1016/j.snb.2024.136864
- Yiwan Song, Yiqi Fang, Shuaiqi Zhu, Weijun Wang, Lianxiang Wang, Wenxian Chen, Yintao He, Lin Yi, Hongxing Ding, Mingqiu Zhao, Shuangqi Fan, Zhaoyao Li, Jinding Chen. A rapid and visual detection assay for Senecavirus A based on recombinase-aided amplification and lateral flow dipstick. Frontiers in Cellular and Infection Microbiology 2024, 14 https://doi.org/10.3389/fcimb.2024.1474676
- Jingsong Xu, Li Cao, Shuang Yang, Ying Jian, Yu Liu, Zhen Shen, Qian Liu, Xiang Chen, Min Li, Shun Li, Xiaolei Zuo, Min Li, Hua Wang. Droplets Cas13a‐RPA measurement delineates potential role for plasma circWDR37 in colorectal cancer. Aggregate 2024, 8 https://doi.org/10.1002/agt2.663
- Shuai Sun, Yuanyuan Zhao, Yuxuan Hao, Pan Xue, Xiaoyang Guo, Wei Zhang, Chunxiang Zhang, Qiongdi Zhang, Wenhua Zhou, Hock Chun Ong, Xuefeng Yu, Zeren Li, Jia Li, Jianquan Yao. Rapid, sensitive and multiplexed detection of SARS-CoV-2 viral nucleic acids enabled by phase-based surface plasmon resonance of metallic gratings. Biomedical Optics Express 2024, 15
(9)
, 5215. https://doi.org/10.1364/BOE.535051
- Weidong Qian, Xuefei Wang, Ting Wang, Jie Huang, Qian Zhang, Yongdong Li, Si Chen. Development of
RPA‐Cas12a
‐fluorescence assay for rapid and reliable detection of human bocavirus 1. Animal Models and Experimental Medicine 2024, 7
(2)
, 179-188. https://doi.org/10.1002/ame2.12298
- Sahil Syed, Alisha Rahaman, Abhijit Mondal, Shraddha Shaligram, Shrikant P. Pawar. Diagnosis of infectious diseases: complexity to convenience. Sensors & Diagnostics 2024, 3
(3)
, 354-380. https://doi.org/10.1039/D3SD00236E
- Juan R. Tejedor, Annalisa Roberti, Cristina Mangas, Marta E. Álvarez-Argüelles, Susana Rojo-Alba, José A. Boga, Agustín F. Fernández, Santiago Melón, Mercedes Rodríguez, Mario F. Fraga. A FokI-driven signal amplification platform for the simultaneous detection of multiple viral RNA pathogens. Sensors & Diagnostics 2024, 3
(3)
, 468-478. https://doi.org/10.1039/D3SD00316G
- Xiaojuan Nie, Dandan Wang, Ye Pan, Ye Hua, Peng Lü, Yanhua Yang. Discovery, classification and application of the CPISPR-Cas13 system. Technology and Health Care 2024, 32
(2)
, 525-544. https://doi.org/10.3233/THC-230258
- Ya-Nan Tang, Dingding Jiang, Xuejun Wang, Yunqi Liu, Dacheng Wei. Recent progress on rapid diagnosis of COVID-19 by point-of-care testing platforms. Chinese Chemical Letters 2024, 35
(3)
, 108688. https://doi.org/10.1016/j.cclet.2023.108688
- 娟 卢. Research Progress in the Point-of-Care Testing of Five Infectious Diseases. Journal of Sensor Technology and Application 2024, 12
(04)
, 579-590. https://doi.org/10.12677/jsta.2024.124063
- Liying Jiang, Xianghao Lan, Linjiao Ren, Zhiyuan Jin, Xuchen Shan, Mingzhu Yang, Lingqian Chang. Single-molecule RNA capture-assisted droplet digital loop-mediated isothermal amplification for ultrasensitive and rapid detection of infectious pathogens. Microsystems & Nanoengineering 2023, 9
(1)
https://doi.org/10.1038/s41378-023-00576-2
- Wisarut Khamcharoen, Weena Siangproh, Charles S. Henry, Nattapong Sreamsukcharoenchai, Panan Ratthawongjirakul, Orawon Chailapakul. Capillary-driven microfluidic device integrating recombinase polymerase amplification for human papillomavirus detection. Sensors and Actuators B: Chemical 2023, 11 , 135016. https://doi.org/10.1016/j.snb.2023.135016
- Yuhao Cao, Haitao Weng, Shaofei Rao, Junmin Li, Fei Yan, Xuemei Song. Rapid and visual field diagnosis of tomato brown rugose fruit virus using reverse transcription recombinase aided amplification (RT RAA) combined with lateral flow strips (LFS). Crop Protection 2023, 173 , 106355. https://doi.org/10.1016/j.cropro.2023.106355
- Rochelle H Holm, Ruth Nyirenda, Ted Smith, Petros Chigwechokha. Addressing the challenges of establishing quality wastewater or non-sewered sanitation-based surveillance, including laboratory and epidemiological considerations, in Malawi. BMJ Global Health 2023, 8
(11)
, e013307. https://doi.org/10.1136/bmjgh-2023-013307
- Islam Seder, Rodrigo Coronel-Tellez, Seyed Hossein Helalat, Yi Sun. Fully integrated sample-in-answer-out platform for viral detection using digital reverse transcription recombinase polymerase amplification (dRT-RPA). Biosensors and Bioelectronics 2023, 237 , 115487. https://doi.org/10.1016/j.bios.2023.115487
- Eunhye Park, So Young Choi, Jieun Kim, Niko Hildebrandt, Jin Seok Lee, Jwa‐Min Nam. Nanotechnologies for the Diagnosis and Treatment of SARS‐CoV‐2 and Its Variants. Small Methods 2023, 7
(7)
https://doi.org/10.1002/smtd.202300034
- Tao Dong, Mingyang Wang, Junchong Liu, Pengxin Ma, Shuang Pang, Wanjian Liu, Aihua Liu. Diagnostics and analysis of SARS-CoV-2: current status, recent advances, challenges and perspectives. Chemical Science 2023, 14
(23)
, 6149-6206. https://doi.org/10.1039/D2SC06665C
- Kenji O. Mfuh, Ngu Njei Abanda, Boghuma K. Titanji, . Strengthening diagnostic capacity in Africa as a key pillar of public health and pandemic preparedness. PLOS Global Public Health 2023, 3
(6)
, e0001998. https://doi.org/10.1371/journal.pgph.0001998
- Wanqiu Huang, Zhaoqi Zhang, Dachuan Lin, Yuliang Deng, Xinchun Chen, Jian Huang. RT-nestRPA is a new technology for the rapid and sensitive detection of nucleic acid detection of pathogens used for a variety of medical application scenarios. Analytica Chimica Acta 2023, 1262 , 341263. https://doi.org/10.1016/j.aca.2023.341263
- Jose L. Malaga, Monica J. Pajuelo, Michiko Okamoto, Emmanuel Kagning Tsinda, Kanako Otani, Pablo Tsukayama, Lucero Mascaro, Diego Cuicapuza, Masamichi Katsumi, Kazuhisa Kawamura, Hidekazu Nishimura, Akie Sakagami, Yo Ueki, Suguru Omiya, Satoshi Okamoto, Asami Nakayama, Shin-ichi Fujimaki, Chuyao Yu, Sikandar Azam, Eiichi Kodama, Clyde Dapat, Hitoshi Oshitani, Mayuko Saito. Rapid Detection of SARS-CoV-2 RNA Using Reverse Transcription Recombinase Polymerase Amplification (RT-RPA) with Lateral Flow for N-Protein Gene and Variant-Specific Deletion–Insertion Mutation in S-Protein Gene. Viruses 2023, 15
(6)
, 1254. https://doi.org/10.3390/v15061254
- Beibei Yu, Changping Xu, Shiwang Huang, Jun Ni, Jiancang Zhou, Yuting Zhang, Maomao Wu, Jun Zhang, Lei Fang. Development of a universal real-time RT-PCR assay for detection of pan-SARS-coronaviruses with an RNA-based internal control. Frontiers in Microbiology 2023, 14 https://doi.org/10.3389/fmicb.2023.1181097
- Sumon Pratihar, Mohamed Nabeel Mattath, Thimmaiah Govindaraju. Coronavirus genomic cDNA derived G-quadruplex as a selective target for fluorometric detection. Chemical Communications 2023, 59
(38)
, 5717-5720. https://doi.org/10.1039/D3CC00740E
- Razieh Salahandish, Jae Eun Hyun, Fatemeh Haghayegh, Hamed Osouli Tabrizi, Shirin Moossavi, Sultan Khetani, Giancarlo Ayala‐Charca, Byron M. Berenger, Yan Dong Niu, Ebrahim Ghafar‐Zadeh, Amir Sanati Nezhad. CoVSense: Ultrasensitive Nucleocapsid Antigen Immunosensor for Rapid Clinical Detection of Wildtype and Variant SARS‐CoV‐2. Advanced Science 2023, 10
(15)
https://doi.org/10.1002/advs.202206615
- Mengya He, Xican Xu, Hongyu Wang, Qingyuan Wu, Linghao Zhang, Dongsheng Zhou, Yigang Tong, Xin Su, Huiyu Liu. Nanozyme‐Based Colorimetric SARS‐CoV‐2 Nucleic Acid Detection by Naked Eye. Small 2023, 19
(20)
https://doi.org/10.1002/smll.202208167
- Yiting Zhang, Setrice Patricia Clarke, Huanwu Wu, Wenli Li, Chang Zhou, Kang Lin, Jiawen Wang, Jinzhi Wang, Ying Liang, Xin Wang, Linding Wang. A comprehensive overview on the transmission, pathogenesis, diagnosis, treatment, and prevention of SARS‐CoV‐2. Journal of Medical Virology 2023, 95
(5)
https://doi.org/10.1002/jmv.28776
- Arianna Ceruti, Ndongo Dia, Adeleye Solomon Bakarey, Judah Ssekitoleko, Soa Fy Andriamandimby, Padra Malwengo-Kasongo, Rasheeda H.A. Ahmed, Rea Maja Kobialka, Jean Michel Heraud, Moussa Moise Diagne, Marie Henriette Dior Dione, Idrissa Dieng, Martin Faye, Ousmane Faye, Jean Théophile Rafisandratantsoa, Jean-Pierre Ravalohery, Claudio Raharinandrasana, Tsiry H. Randriambolamanantsoa, Norosoa Razanajatovo, Iony Razanatovo, Joelinotahina H. Rabarison, Phillipe Dussart, Louis Kyei-Tuffuor, Abigail Agbanyo, Olubusuyi Moses Adewumi, Adeola Fowotade, Muideen Kolawole Raifu, Patient Okitale-Talunda, Gracia Kashitu-Mujinga, Christelle Mbelu-Kabongo, Steve Ahuka-Mundeke, Anguy Makaka-Mutondo, Enas M. Abdalla, Sanaa M. Idris, Wisal A. Elmagzoub, Rahma H. Ali, Eman O.M. Nour, Rasha S.M. Ebraheem, Huda H.H. Ahmed, Hamadelniel E. Abdalla, Musab Elnegoumi, Izdihar Mukhtar, Muatsim A.M. Adam, Nuha Y.I. Mohamed, Shahinaz A. Bedri, Hamdan Mustafa Hamdan, Magid Kisekka, Monica Mpumwiire, Sharley Melissa Aloyo, Joanita Nabwire Wandera, Andrew Agaba, Rogers Kamulegeya, Hosea Kiprotich, David Patrick Kateete, Paul Kadetz, Uwe Truyen, Kamal H. Eltom, Anavaj Sakuntabhai, Julius Boniface Okuni, Sheila Makiala-Mandanda, Vincent Lacoste, George Olusegun Ademowo, Michael Frimpong, Amadou Alpha Sall, Manfred Weidmann, Ahmed Abd El Wahed. A multi-country phase 2 study to evaluate the suitcase lab for rapid detection of SARS-CoV-2 in seven Sub-Saharan African countries: Lessons from the field. Journal of Clinical Virology 2023, 162 , 105422. https://doi.org/10.1016/j.jcv.2023.105422
- Ralf Junker, Peter B. Luppa. Congress report: 5th Munich POCT Symposium, September 27–29, 2022, Klinikum rechts der Isar der TU München. Journal of Laboratory Medicine 2023, 47
(2)
, 87-95. https://doi.org/10.1515/labmed-2023-0025
- Chunying Jiang, Xihui Mu, Shuai Liu, Zhiwei Liu, Bing Liu, Bin Du, Zhaoyang Tong. A Study of the Detection of SARS-CoV-2 by the Use of Electrochemiluminescent Biosensor Based on Asymmetric Polymerase Chain Reaction Amplification Strategy. IEEE Sensors Journal 2023, 23
(8)
, 8094-8100. https://doi.org/10.1109/JSEN.2022.3201507
- Sarah Schurig, Rea Kobialka, Andy Wende, Md Anik Ashfaq Khan, Phillip Lübcke, Elias Eger, Katharina Schaufler, Arwid Daugschies, Uwe Truyen, Ahmed Abd El Wahed. Rapid Reverse Purification DNA Extraction Approaches to Identify Microbial Pathogens in Wastewater. Microorganisms 2023, 11
(3)
, 813. https://doi.org/10.3390/microorganisms11030813
- Ruoxu Li, Ning Su, Xiaodong Ren, Xiange Sun, Wenman Li, Yuwei Li, Jin Li, Chen Chen, Hong Wang, Weiping Lu, Shaoli Deng, Qing Huang. Centrifugal microfluidic-based multiplex recombinase polymerase amplification assay for rapid detection of SARS-CoV-2. iScience 2023, 26
(3)
, 106245. https://doi.org/10.1016/j.isci.2023.106245
- Yuanshou Zhu, Meng Zhang, Zhijun Jie, Shengce Tao. Nucleic acid testing of SARS-CoV-2: A review of current methods, challenges, and prospects. Frontiers in Microbiology 2022, 13 https://doi.org/10.3389/fmicb.2022.1074289
- Josephine Wambani, Patrick Okoth. SARS-CoV-2 origin, myths and diagnostic technology developments. Egyptian Journal of Medical Human Genetics 2022, 23
(1)
https://doi.org/10.1186/s43042-022-00255-3
- Cen Chen, Zhen Huang. Tellurium-Modified Nucleosides, Nucleotides, and Nucleic Acids with Potential Applications. Molecules 2022, 27
(23)
, 8379. https://doi.org/10.3390/molecules27238379
- Meiying Tan, Chuan Liao, Lina Liang, Xueli Yi, Zihan Zhou, Guijiang Wei. Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Frontiers in Cellular and Infection Microbiology 2022, 12 https://doi.org/10.3389/fcimb.2022.1019071
- Silvia Gonçalves Mesquita, Elena Birgitta Lugli, Giovanni Matera, Cristina Toscano Fonseca, Roberta Lima Caldeira, Bonnie Webster. Development of real-time and lateral flow recombinase polymerase amplification assays for rapid detection of Schistosoma mansoni. Frontiers in Microbiology 2022, 13 https://doi.org/10.3389/fmicb.2022.1043596
- Matthew Higgins, Oliver W. Stringer, Daniel Ward, Jennifer M. Andrews, Matthew S. Forrest, Susana Campino, Taane G. Clark. Characterizing the Impact of Primer-Template Mismatches on Recombinase Polymerase Amplification. The Journal of Molecular Diagnostics 2022, 24
(11)
, 1207-1216. https://doi.org/10.1016/j.jmoldx.2022.08.005
- Apoorva Saxena, Pawankumar Rai, Srishti Mehrotra, Samiya Baby, Suman Singh, Vikas Srivastava, Smriti Priya, Sandeep K. Sharma. Development and Clinical Validation of RT-LAMP-Based Lateral-Flow Devices and Electrochemical Sensor for Detecting Multigene Targets in SARS-CoV-2. International Journal of Molecular Sciences 2022, 23
(21)
, 13105. https://doi.org/10.3390/ijms232113105
- Catherine T. Chia, Andrew T. Bender, Lorraine Lillis, Benjamin P. Sullivan, Coleman D. Martin, Wynn Burke, Charles Landis, David S. Boyle, Jonathan D. Posner, . Rapid detection of hepatitis C virus using recombinase polymerase amplification. PLOS ONE 2022, 17
(10)
, e0276582. https://doi.org/10.1371/journal.pone.0276582
- Xiaowei Ma, Jingsong Xu, Fei Zhou, Jing Ye, Donglei Yang, Hua Wang, Pengfei Wang, Min Li. Recent advances in PCR-free nucleic acid detection for SARS-COV-2. Frontiers in Bioengineering and Biotechnology 2022, 10 https://doi.org/10.3389/fbioe.2022.999358
- Xin Peng, Jiao Yang, Wenbin Liang, Yudong Sun, Xuecui Mei, Guanghui Zhang, Ruo Yuan, Yingchun Li. Double loop-stem hairpins mediated hybridization chain reaction: A multifunctional DNA molecular tool to produce the intact aptamer for label-free biosensing. Sensors and Actuators B: Chemical 2022, 369 , 132327. https://doi.org/10.1016/j.snb.2022.132327
- Michelle Melgarejo da Rosa, Michelly Cristiny Pereira, Vanessa Mylenna Florêncio de Carvalho, Ana Paula da Fonseca Arcoverde Cabral de Mello, Crislaine Xavier da Silva, Bárbara de Oliveira Silva, Anderson Félix dos Santos, Rayssa Evelyn Valentim de Moraes Souza, Maira Galdino da Rocha Pitta. Unveiling Distinguished Methodologies for the Diagnosis of COVID-19. 2022, 99-120. https://doi.org/10.2174/9789815050509122010008
- Xingyu Ye, Haiwei Zhou, Xiang Guo, Donglai Liu, Zhonglei Li, Junwei Sun, Jun Huang, Tao Liu, Pengshu Zhao, Heshan Xu, Kai Li, Hanming Wang, Jihua Wang, Li Wang, Weili Zhao, Qian Liu, Sihong Xu, Yan Feng. Argonaute-integrated isothermal amplification for rapid, portable, multiplex detection of SARS-CoV-2 and influenza viruses. Biosensors and Bioelectronics 2022, 207 , 114169. https://doi.org/10.1016/j.bios.2022.114169
- Olena Filchakova, Dina Dossym, Aisha Ilyas, Tamila Kuanysheva, Altynay Abdizhamil, Rostislav Bukasov. Review of COVID-19 testing and diagnostic methods. Talanta 2022, 244 , 123409. https://doi.org/10.1016/j.talanta.2022.123409
- Mariarita De Felice, Mariarosaria De Falco, Daniele Zappi, Amina Antonacci, Viviana Scognamiglio. Isothermal amplification-assisted diagnostics for COVID-19. Biosensors and Bioelectronics 2022, 205 , 114101. https://doi.org/10.1016/j.bios.2022.114101
- D.S. Mota, J.M. Guimarães, A.M.D. Gandarilla, J.C.B.S. Filho, W.R. Brito, L.A.M. Mariúba. Recombinase polymerase amplification in the molecular diagnosis of microbiological targets and its applications. Canadian Journal of Microbiology 2022, 68
(6)
, 383-402. https://doi.org/10.1139/cjm-2021-0329
- Moon Hyeok Choi, Jaehyeon Lee, Young Jun Seo. Dual-site ligation-assisted loop-mediated isothermal amplification (dLig-LAMP) for colorimetric and point-of-care determination of real SARS-CoV-2. Microchimica Acta 2022, 189
(5)
https://doi.org/10.1007/s00604-022-05293-7
- Md Mamunul Islam, Dipak Koirala. Toward a next-generation diagnostic tool: A review on emerging isothermal nucleic acid amplification techniques for the detection of SARS-CoV-2 and other infectious viruses. Analytica Chimica Acta 2022, 1209 , 339338. https://doi.org/10.1016/j.aca.2021.339338
- Dounia Cherkaoui, Judith Heaney, Da Huang, Matthew Byott, Benjamin S. Miller, Eleni Nastouli, Rachel A. McKendry. Clinical Validation of a Rapid Variant-Proof RT-RPA Assay for the Detection of SARS-CoV-2. Diagnostics 2022, 12
(5)
, 1263. https://doi.org/10.3390/diagnostics12051263
- Dayong Li, Chengjie Duan, Wenting Cheng, Youjing gong, Yanheng Yao, Xiaoping Wang, Zhongyun Wang, Yang Xiang. A simple and rapid method to assay SARS-CoV-2 RNA based on a primer exchange reaction. Chemical Communications 2022, 58
(28)
, 4484-4487. https://doi.org/10.1039/D2CC00488G
- Tingting Jiang, Yacui Wang, Weiwei Jiao, Yiqin Song, Qing Zhao, Tianyi Wang, Jing Bi, Adong Shen. Recombinase Polymerase Amplification Combined with Real-Time Fluorescent Probe for Mycoplasma pneumoniae Detection. Journal of Clinical Medicine 2022, 11
(7)
, 1780. https://doi.org/10.3390/jcm11071780
- Oliver W. Stringer, Yanwen Li, Janine T. Bossé, Matthew S. Forrest, Juan Hernandez-Garcia, Alexander W. Tucker, Tiago Nunes, Francisco Costa, Preben Mortensen, Eduardo Velazquez, Paul Penny, Jesus Rodriguez-Manzano, Pantelis Georgiou, Paul R. Langford. Rapid Detection of Actinobacillus pleuropneumoniae From Clinical Samples Using Recombinase Polymerase Amplification. Frontiers in Veterinary Science 2022, 9 https://doi.org/10.3389/fvets.2022.805382
- Manfred Weidmann, Elena Graf, Daniel Lichterfeld, Ahmed Abd El Wahed, Michaël Bekaert. Efficient Screening of Long Oligonucleotides Against Hundred Thousands of SARS-CoV-2 Genome Sequences. Frontiers in Virology 2022, 2 https://doi.org/10.3389/fviro.2022.835707
- João M. Vindeirinho, Eva Pinho, Nuno F. Azevedo, Carina Almeida. SARS-CoV-2 Diagnostics Based on Nucleic Acids Amplification: From Fundamental Concepts to Applications and Beyond. Frontiers in Cellular and Infection Microbiology 2022, 12 https://doi.org/10.3389/fcimb.2022.799678
- Feng Chen, Guodong Li, Chun Wu, Wanhe Wang, Dik-Lung Ma, Chung-Hang Leung. A rapid and label-free DNA-based interference reduction nucleic acid amplification strategy for viral RNA detection. Biosensors and Bioelectronics 2022, 198 , 113829. https://doi.org/10.1016/j.bios.2021.113829
- Xiaowu Jiang, Lexin Zhu, Dongbo Zhan. Development of a recombinase polymerase amplification assay for rapid detection of Streptococcus suis type 2 in nasopharyngeal swab samples. Diagnostic Microbiology and Infectious Disease 2022, 102
(2)
, 115594. https://doi.org/10.1016/j.diagmicrobio.2021.115594
- Ruichen Lv, Nianhong Lu, Junhu Wang, Yuexi Li, Yong Qi. Recombinase Polymerase Amplification for Rapid Detection of Zoonotic Pathogens: An Overview. Zoonoses 2022, 2
(1)
https://doi.org/10.15212/ZOONOSES-2022-0002
- Jin Li, Qiu Zhong, Mei-Yun Shang, Min Li, Yuan-Su Jiang, Jia-Jun Zou, Shan-Shan Ma, Qing Huang, Wei-Ping Lu. Preliminary Evaluation of Rapid Visual Identification of Burkholderia pseudomallei Using a Newly Developed Lateral Flow Strip-Based Recombinase Polymerase Amplification (LF-RPA) System. Frontiers in Cellular and Infection Microbiology 2022, 11 https://doi.org/10.3389/fcimb.2021.804737
- Zhaowei Zhang, Peng Ma, Rajib Ahmed, Jie Wang, Demir Akin, Fernando Soto, Bi‐Feng Liu, Peiwu Li, Utkan Demirci. Advanced Point‐of‐Care Testing Technologies for Human Acute Respiratory Virus Detection. Advanced Materials 2022, 34
(1)
https://doi.org/10.1002/adma.202103646
- Xi Chen, Simin Xia. Sensitive methods for detection of SARS-CoV-2 RNA. 2022, 1-26. https://doi.org/10.1016/bs.mim.2021.06.001
- Emmanuel Edwar Siddig, Annelies Verbon, Sahar Bakhiet, Ahmed Hassan Fahal, Wendy W.J. van de Sande. The developed molecular biological identification tools for mycetoma causative agents: An update. Acta Tropica 2022, 225 , 106205. https://doi.org/10.1016/j.actatropica.2021.106205
- Prakash Ghosh, Rajashree Chowdhury, Mohammad Enayet Hossain, Faria Hossain, Mojnu Miah, Md. Utba Rashid, James Baker, Mohammed Ziaur Rahman, Mustafizur Rahman, Xuejun Ma, Malcolm S. Duthie, Ahmed Abd El Wahed, Dinesh Mondal. Evaluation of recombinase-based isothermal amplification assays for point-of-need detection of SARS-CoV-2 in resource-limited settings. International Journal of Infectious Diseases 2022, 114 , 105-111. https://doi.org/10.1016/j.ijid.2021.11.007
- Xin Peng, Jiao Yang, Wenbin Liang, Yudong Sun, Xuecui Mei, Guanghui Zhang, Ruo Yuan, Yingchun Li. Double Loop-Stem Hairpins Mediated Hybridization Chain Reaction:A Multifunctional DNA Molecular Tool to Produce the Intact Aptamer for Label-Free Biosensing. SSRN Electronic Journal 2022, 60 https://doi.org/10.2139/ssrn.4117474
- Maryia Drobysh, Almira Ramanaviciene, Roman Viter, Chien-Fu Chen, Urte Samukaite-Bubniene, Vilma Ratautaite, Arunas Ramanavicius. Biosensors for the Determination of SARS-CoV-2 Virus and Diagnosis of COVID-19 Infection. International Journal of Molecular Sciences 2022, 23
(2)
, 666. https://doi.org/10.3390/ijms23020666
- Yuyue Xu, Tao Wang, Zhu Chen, Lian Jin, Zuozhong Wu, Jinqu Yan, Xiaoni Zhao, Lei Cai, Yan Deng, Yuan Guo, Song Li, Nongyue He. The point-of-care-testing of nucleic acids by chip, cartridge and paper sensors. Chinese Chemical Letters 2021, 32
(12)
, 3675-3686. https://doi.org/10.1016/j.cclet.2021.06.025
- Lukman Yusuf, Mark Appeaning, Taiwo Gboluwaga Amole, Baba Maiyaki Musa, Hadiza Shehu Galadanci, Peter Kojo Quashie, Isah Abubakar Aliyu. Rapid, Cheap, and Effective COVID-19 Diagnostics for Africa. Diagnostics 2021, 11
(11)
, 2105. https://doi.org/10.3390/diagnostics11112105
- Dounia Cherkaoui, Da Huang, Benjamin S. Miller, Valérian Turbé, Rachel A. McKendry. Harnessing recombinase polymerase amplification for rapid multi-gene detection of SARS-CoV-2 in resource-limited settings. Biosensors and Bioelectronics 2021, 189 , 113328. https://doi.org/10.1016/j.bios.2021.113328
- Rea Maja Kobialka, Arianna Ceruti, Michelle Bergmann, Katrin Hartmann, Uwe Truyen, Ahmed Abd El Wahed. Molecular Detection of Feline Coronavirus Based on Recombinase Polymerase Amplification Assay. Pathogens 2021, 10
(10)
, 1237. https://doi.org/10.3390/pathogens10101237
- Yida Zhai, Runqi Li, Fuguo Liu, Chunyun Zhang, Yuanyuan Wang, Guofu Chen. Recombinase polymerase amplification combined with lateral flow dipstick for the rapid detection of
Prorocentrum donghaiense. Marine Biology Research 2021, 17
(7-8)
, 646-657. https://doi.org/10.1080/17451000.2021.2010279
- Arianna Ceruti, Rea Maja Kobialka, Judah Ssekitoleko, Julius Boniface Okuni, Sandra Blome, Ahmed Abd El Wahed, Uwe Truyen. Rapid Extraction and Detection of African Swine Fever Virus DNA Based on Isothermal Recombinase Polymerase Amplification Assay. Viruses 2021, 13
(9)
, 1731. https://doi.org/10.3390/v13091731
- Zhi Xiong Chong, Winnie Pui Pui Liew, Hui Kian Ong, Chean Yeah Yong, Chong Seng Shit, Wan Yong Ho, Stephanie Y.L. Ng, Swee Keong Yeap. Current diagnostic approaches to detect two important betacoronaviruses: Middle East respiratory syndrome coronavirus (MERS-CoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Pathology - Research and Practice 2021, 225 , 153565. https://doi.org/10.1016/j.prp.2021.153565
- Nahed Yehia, Fatma Eldemery, Abdel-Satar Arafa, Ahmed Abd El Wahed, Ahmed El Sanousi, Manfred Weidmann, Mohamed Shalaby. Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Avian Influenza Virus H9N2 HA Gene. Veterinary Sciences 2021, 8
(7)
, 134. https://doi.org/10.3390/vetsci8070134
- Jafar Ali, Saira Elahi, Asghar Ali, Hassan Waseem, Rameesha Abid, Mohamed Mohamed. Unveiling the Potential Role of Nanozymes in Combating the COVID-19 Outbreak. Nanomaterials 2021, 11
(5)
, 1328. https://doi.org/10.3390/nano11051328
- Eliza Leusmann. Tests auf Coronaviren und andere Plagegeister. Nachrichten aus der Chemie 2021, 69
(4)
, 78-78. https://doi.org/10.1002/nadc.20214106939
- Prakash Ghosh, Abhijit Sharma, Narayan Raj Bhattarai, Kumar Abhishek, Thilini Nisansala, Amresh Kumar, Susanne Böhlken-Fascher, Rajashree Chowdhury, Md Anik Ashfaq Khan, Khaledul Faisal, Faria Hossain, Md. Rasel Uddin, Md. Utba Rashid, Shomik Maruf, Keshav Rai, Monica Sooriyaarachchi, Withanage Lakma Kumari Abhayarathna, Prahlad Karki, Shiril Kumar, Shalindra Ranasinghe, Basudha Khanal, Satyabrata Routray, Pradeep Das, Dinesh Mondal, Ahmed Abd El Wahed. A Multi-Country, Single-Blinded, Phase 2 Study to Evaluate a Point-of-Need System for Rapid Detection of Leishmaniasis and Its Implementation in Endemic Settings. Microorganisms 2021, 9
(3)
, 588. https://doi.org/10.3390/microorganisms9030588
- Susanne Modrow, Uwe Truyen, Hermann Schätzl. Labormethoden zum Nachweis von Virusinfektionen. 2021, 145-159. https://doi.org/10.1007/978-3-662-61781-6_13
Learn about these metrics
Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.
Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.
The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.
Recommended Articles
Abstract
Figure 1
Figure 1. Probit regression analysis for RdRP, E, and N RT-RPA assays. The limit of detection in 95% of cases is two RNA molecules/reaction for the RdRP RT-RPA assay (red) and 15 RNA molecules per reaction each for E and N RT-RPA assays (black).
Figure 2
Figure 2. Results of 36 clinical samples analyzed with real-time RT-PCR for the E gene and RT-RPA assays for the RdRP, E, and N genes. CT is the cycle threshold, and TT is the threshold time. The red dot represents the real-time RT-PCR sample not detected by the RdRP RT-RPA, and the horizontal red lines indicate the median of TT or CT values.
References
This article references 52 other publications.
- 1Coronaviridae Study Group of the International Committee on Taxonomy of, V. The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536– 544, DOI: 10.1038/s41564-020-0695-z1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktFemu7Y%253D&md5=3e43e7781469c6d748726b24b3a60361The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2Coronaviridae Study Group of the International Committee on Taxonomy of VirusesNature Microbiology (2020), 5 (4), 536-544CODEN: NMAICH; ISSN:2058-5276. (Nature Research)A review. The present outbreak of a coronavirus-assocd. acute respiratory disease called coronavirus disease 19 (COVID-19) is the third documented spillover of an animal coronavirus to humans in only two decades that has resulted in a major epidemic. The Coronaviridae Study Group (CSG) of the International Committee on Taxonomy of Viruses, which is responsible for developing the classification of viruses and taxon nomenclature of the family Coronaviridae, has assessed the placement of the human pathogen, tentatively named 2019-nCoV, within the Coronaviridae. Based on phylogeny, taxonomy and established practice, the CSG recognizes this virus as forming a sister clade to the prototype human and bat severe acute respiratory syndrome coronaviruses (SARS-CoVs) of the species Severe acute respiratory syndrome-related coronavirus, and designates it as SARS-CoV-2. In order to facilitate communication, the CSG proposes to use the following naming convention for individual isolates: SARS-CoV-2/host/location/isolate/date. While the full spectrum of clin. manifestations assocd. with SARS-CoV-2 infections in humans remains to be detd., the independent zoonotic transmission of SARS-CoV and SARS-CoV-2 highlights the need for studying viruses at the species level to complement research focused on individual pathogenic viruses of immediate significance. This will improve our understanding of virus-host interactions in an ever-changing environment and enhance our preparedness for future outbreaks.
- 2WHO. WHO announces COVID-19 outbreak apandemic. https://www.euro.who.int/en/health-topics/health-emergencies/coronavirus-covid-19/news/news/2020/3/who-announces-covid-19-outbreak-a-pandemic (accessed June 25, 2020).There is no corresponding record for this reference.
- 3Li, R.; Pei, S.; Chen, B.; Song, Y.; Zhang, T.; Yang, W.; Shaman, J. Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2). Science 2020, 368, 489– 493, DOI: 10.1126/science.abb32213https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXosVSjur0%253D&md5=26e8c17708ba96946dbe89d942ef9190Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2)Li, Ruiyun; Pei, Sen; Chen, Bin; Song, Yimeng; Zhang, Tao; Yang, Wan; Shaman, JeffreyScience (Washington, DC, United States) (2020), 368 (6490), 489-493CODEN: SCIEAS; ISSN:1095-9203. (American Association for the Advancement of Science)Estn. of the prevalence and contagiousness of undocumented novel coronavirus [severe acute respiratory syndrome - coronavirus 2 (SARS-CoV-2)] infections is crit. for understanding the overall prevalence and pandemic potential of this disease. Here, we use observations of reported infection within China, in conjunction with mobility data, a networked dynamic metapopulation model, and Bayesian inference, to infer crit. epidemiol. characteristics assocd. with SARS-CoV-2, including the fraction of undocumented infections and their contagiousness. We est. that 86% of all infections were undocumented [95% credible interval (CI): 82-90%] before the 23 Jan. 2020 travel restrictions. The transmission rate of undocumented infections per person was 55% the transmission rate of documented infections (95% CI: 46-62%), yet, because of their greater nos., undocumented infections were the source of 79% of the documented cases. These findings explain the rapid geog. spread of SARS-CoV-2 and indicate that containment of this virus will be particularly challenging.
- 4Leung, C. C.; Cheng, K. K.; Lam, T. H.; Migliori, G. B. Mask wearing to complement social distancing and save lives during COVID-19. Int. J. Tuberc. Lung Dis. 2020, 24, 556– 558, DOI: 10.5588/ijtld.20.02444https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38nhtlGisg%253D%253D&md5=908516e413860ba4532e01b949d1d94dMask wearing to complement social distancing and save lives during COVID-19Leung C C; Cheng K K; Lam T H; Migliori G BThe international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease (2020), 24 (6), 556-558 ISSN:.There is no expanded citation for this reference.
- 5Corman, V. M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D. K.; Bleicker, T.; Brunink, S.; Schneider, J.; Schmidt, M. L.; Mulders, D. G.; Haagmans, B. L.; van der Veer, B.; van den Brink, S.; Wijsman, L.; Goderski, G.; Romette, J. L.; Ellis, J.; Zambon, M.; Peiris, M.; Goossens, H.; Reusken, C.; Koopmans, M. P.; Drosten, C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045 DOI: 10.2807/1560-7917.ES.2020.25.3.2000045There is no corresponding record for this reference.
- 6Sheridan, C. Coronavirus and the race to distribute reliable diagnostics. Nat. Biotechnol. 2020, 38, 382– 384, DOI: 10.1038/d41587-020-00002-26https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksFOjs78%253D&md5=d68bd337702677030b41e24e8a0c3f3fCoronavirus and the race to distribute reliable diagnosticsSheridan, CormacNature Biotechnology (2020), 38 (4), 382-384CODEN: NABIF9; ISSN:1087-0156. (Nature Research)A brief review. International teams worked at speed to make tests for the virus available in record time.
- 7Piepenburg, O.; Williams, C. H.; Stemple, D. L.; Armes, N. A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204 DOI: 10.1371/journal.pbio.00402047https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BD28npt12nsg%253D%253D&md5=267960cb82d153b8b72385c4f86e548bDNA detection using recombination proteinsPiepenburg Olaf; Williams Colin H; Stemple Derek L; Armes Niall APLoS biology (2006), 4 (7), e204 ISSN:.DNA amplification is essential to most nucleic acid testing strategies, but established techniques require sophisticated equipment or complex experimental procedures, and their uptake outside specialised laboratories has been limited. Our novel approach, recombinase polymerase amplification (RPA), couples isothermal recombinase-driven primer targeting of template material with strand-displacement DNA synthesis. It achieves exponential amplification with no need for pretreatment of sample DNA. Reactions are sensitive, specific, and rapid and operate at constant low temperature. We have also developed a probe-based detection system. Key aspects of the combined RPA amplification/detection process are illustrated by a test for the pathogen methicillin-resistant Staphylococcus aureus. The technology proves to be sensitive to fewer than ten copies of genomic DNA. Furthermore, products can be detected in a simple sandwich assay, thereby establishing an instrument-free DNA testing system. This unique combination of properties is a significant advance in the development of portable and widely accessible nucleic acid-based tests.
- 8Abd El Wahed, A.; El-Deeb, A.; El-Tholoth, M.; Abd El Kader, H.; Ahmed, A.; Hassan, S.; Hoffmann, B.; Haas, B.; Shalaby, M. A.; Hufert, F. T.; Weidmann, M. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus. PLoS One 2013, 8, e71642 DOI: 10.1371/journal.pone.00716428https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhtlKmurfN&md5=6636c29b398ecc9f2187d6bef3244ba3A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virusAbd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, ManfredPLoS One (2013), 8 (8), e71642CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt mol. RNA std. was used for assay validation. The RT-RPA assay was fast (4-10 min) and the anal. sensitivity was detd. at 1436 RNA mols. detected by probit regression anal. The FMDV RT-RPA assay detected RNA prepd. from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clin. samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, resp. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.
- 9Gordon, M. I.; Klemer, D. P.; Fuller, S. L.; Chang, J. H.; Klemer, D. R.; Putnam, M. L. Mathematical modeling of a real-time isothermal amplification assay for Erwinia amylovora. Eng. Rep. 2019, 1, e12047 DOI: 10.1002/eng2.120479https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmslaltbY%253D&md5=5b3f5bd6268ec1c41530c06e767e45eeMathematical modeling of a real-time isothermal amplification assay for Erwinia amylovoraGordon, Michael I.; Klemer, David P.; Fuller, Skylar L.; Chang, Jeff H.; Klemer, Daniel R.; Putnam, Melodie L.Engineering Reports (2019), 1 (3), e12047CODEN: ERNEHB; ISSN:2577-8196. (John Wiley & Sons, Inc.)A general math. model that describes the temporal behavior of a real-time isothermal process used for nucleic acid amplification is derived. A monotonically-increasing fluorescence signal s(t) generated and measured during the amplification reaction can be modeled in the form of a logistic function of time that is completely described by three parameters (k, t50, and Smax), which may be readily estd. from exptl. acquired s(t) data. Exptl. data obtained from a real-time loop-mediated isothermal amplification (LAMP) assay for the infectious pathogen Erwinia amylovora (E. amylovora) are used to illustrate and validate the math. model. Implementation of such a modeling approach can allow for the extn. of quant. information from real-time LAMP data through parameter estn. techniques; this is demonstrated exptl. using real-time amplification data acquired using the real-time E. amylovora assay.
- 10Moody, C.; Newell, H.; Viljoen, H. A mathematical model of recombinase polymerase amplification under continuously stirred conditions. Biochem. Eng. J. 2016, 112, 193– 201, DOI: 10.1016/j.bej.2016.04.01710https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XnsFWgtLg%253D&md5=bd7b12d644207c54f50d43fe0dfc8cecFA mathematical model of recombinase polymerase amplification under continuously stirred conditionsMoody, Clint; Newell, Heather; Viljoen, HendrikBiochemical Engineering Journal (2016), 112 (), 193-201CODEN: BEJOFV; ISSN:1369-703X. (Elsevier B.V.)Growing interest surrounds isothermal PCR techniques which have great potential for miniaturization for mobile diagnostics. Particularly promising, Recombinase Polymerase Amplification (RPA), combines this advantage of isothermal PCR with simplicity and rapid amplification. A math. model is presented of Recombinase Polymerase Amplification (RPA) and compared to exptl. data. This model identifies the rate limiting steps in the chem. process, the effects of stirring, and insights in to using RPA for quant. measurement of initial DNA concn. Expts. are shown in which DNA amplification occurs under conditions of Couette flow and conditions of rotational turbulent flow. Hand mixing has been shown to dramatically shorten amplification times but introduces unpredictable variability. In some cases, this variability manifests itself as human error induced false negatives, a serious problem for all potential applications. Mech. stirring demonstrates similarly short delay times while retaining high repeatability and reduces the potential for human error.
- 11Abd El Wahed, A.; Patel, P.; Faye, O.; Thaloengsok, S.; Heidenreich, D.; Matangkasombut, P.; Manopwisedjaroen, K.; Sakuntabhai, A.; Sall, A. A.; Hufert, F. T.; Weidmann, M. Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection. PLoS One 2015, 10, e0129682 DOI: 10.1371/journal.pone.012968211https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xns1Cqsbo%253D&md5=add5ae19a241d7249c1215c2bab5c644Recombinase polymerase amplification assay for rapid diagnostics of dengue infectionAbd El Wahed, Ahmed; Patel, Pranav; Faye, Oumar; Thaloengsok, Sasikanya; Heidenreich, Doris; Matangkasombut, Ponpan; Manopwisedjaroen, Khajohnpong; Sakuntabhai, Anavaj; Sall, Amadou A.; Hufert, Frank T.; Weidmann, ManfredPLoS One (2015), 10 (6), e0129682/1-e0129682/17CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Background Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF). Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR) are the std. method for mol. detection of the dengue virus (DENV). Real-time RT-PCR anal. is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA) assays were developed to detect DENV1-4. Methodol./Principal Findings Using two quant. RNA mol. stds., the anal. sensitivity of a RT-RPA targeting the 3' non-translated region of DENV1-4 was found to range from 14 (DENV4) to 241 (DENV1-3) RNA mols. detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile lab. combining magnetic-bead based total nucleic acid extn. and a portable detection device in Kedougou (Senegal) and in Bangkok (Thailand). In Kedougou, the RT-RPA was operated at an ambient temp. of 38°C with auxiliary electricity tapped from a motor vehicle and yielded a clin. sensitivity and specificity of 98% (n = 31) and 100% (n = 23), resp. While in the field trial in Bangkok, the clin. sensitivity and specificity were 72% (n = 90) and 100% (n = 41), resp. Conclusions/Significance During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.
- 12Faye, O.; Faye, O.; Soropogui, B.; Patel, P.; El Wahed, A. A.; Loucoubar, C.; Fall, G.; Kiory, D.; Magassouba, N.; Keita, S.; Konde, M. K.; Diallo, A. A.; Koivogui, L.; Karlberg, H.; Mirazimi, A.; Nentwich, O.; Piepenburg, O.; Niedrig, M.; Weidmann, M.; Sall, A. A. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015. Eurosurveillance 2015, 20, 30053 DOI: 10.2807/1560-7917.ES.2015.20.44.30053.There is no corresponding record for this reference.
- 13Frimpong, M.; Ahor, H. S.; Wahed, A. A. E.; Agbavor, B.; Sarpong, F. N.; Laing, K.; Wansbrough-Jones, M.; Phillips, R. O. Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assay. PLoS Neglected Trop. Dis. 2019, 13, e0007155 DOI: 10.1371/journal.pntd.000715513https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlentLvP&md5=cf719caa66efdc695d68d494ebd10de4Rapid detection of Mycobacterium ulcerans with isothermal recombinase polymerase amplification assayFrimpong, Michael; Ahor, Hubert Senanu; El Wahed, Ahmed Abd; Agbavor, Bernadette; Sarpong, Francisca Naana; Laing, Kenneth; Wansbrough-Jones, Mark; Phillips, Richard OdamePLoS Neglected Tropical Diseases (2019), 13 (2), e0007155CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Access to an accurate diagnostic test for Buruli ulcer (BU) is a research priority according to the World Health Organization. Nucleic acid amplification of insertion sequence IS2404 by polymerase chain reaction (PCR) is the most sensitive and specific method to detect Mycobacterium ulcerans (M. ulcerans), the causative agent of BU. However, PCR is not always available in endemic communities in Africa due to its cost and technol. sophistication. Isothermal DNA amplification systems such as the recombinase polymerase amplification (RPA) have emerged as a mol. diagnostic tool with similar accuracy to PCR but having the advantage of amplifying a template DNA at a const. lower temp. in a shorter time. The aim of this study was to develop RPA for the detection of M. ulcerans and evaluate its use in Buruli ulcer disease. Methodol. and principal findings A specific fragment of IS2404 of M. ulcerans was amplified within 15 min at a const. 42°C using RPA method. The detection limit was 45 copies of IS2404 mol. DNA std. per reaction. The assay was highly specific as all 7 strains of M. ulcerans tested were detected, and no cross reactivity was obsd. to other mycobacteria or clin. relevant bacteria species. The clin. performance of the M. ulcerans (Mu-RPA) assay was evaluated using DNA extd. from fine needle aspirates or swabs taken from 67 patients in whom BU was suspected and 12 patients with clin. confirmed non-BU lesions. All results were compared to a highly sensitive real-time PCR. The clin. specificity of the Mu-RPA assay was 100% (95% CI, 84-100), whiles the sensitivity was 88% (95% CI, 77-95). Conclusion The Mu-RPA assay represents an alternative to PCR, esp. in areas with limited infrastructure.
- 14Kissenkötter, J.; Hansen, S.; Bohlken-Fascher, S.; Ademowo, O. G.; Oyinloye, O. E.; Bakarey, A. S.; Dobler, G.; Tappe, D.; Patel, P.; Czerny, C. P.; Abd El Wahed, A. Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assay. Anal. Biochem. 2018, 544, 29– 33, DOI: 10.1016/j.ab.2017.12.01814https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1Mzjt12nsA%253D%253D&md5=1cd3a9b814ce7ee17745bb3594bda224Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assayKissenkotter Jonas; Hansen Soren; Bohlken-Fascher Susanne; Czerny Claus-Peter; Ademowo Olusegun George; Oyinloye Oladapo Elijah; Bakarey Adeleye Solomon; Dobler Gerhard; Tappe Dennis; Patel Pranav; Abd El Wahed AhmedAnalytical biochemistry (2018), 544 (), 29-33 ISSN:.Rickettsioses are zoonotic vector-transmitted bacterial infections leading to flu-like symptoms and can progress to severe illness in humans. The gold standard for diagnosis of rickettsial infections is the indirect immunofluorescence assay, a serological method which is not suitable for pathogen identification during the acute phase of the disease. Therefore, several real-time PCR assays were developed. These assays are very sensitive, but require high-equipped laboratories and well-trained personnel. Hence, in this study, a rapid point-of-need detection method was developed to detect all Rickettsia species. The 23S and 16S rRNA genes were targeted to develop a recombinase polymerase amplification (RPA) assay. Both 23S and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/reaction, respectively. The 16S_RPA assay detected all tested species, whereas the 23S_RPA assay identified only species of the spotted fever and transitional rickettsial groups. All results were compared with real-time PCR assays directed against the same rickettsial genes. The RPA assays are easy to handle and produced quicker results in comparison to real-time PCRs. Both RPA assays were implemented in a mobile suitcase laboratory to ease the use in rural areas. This method can help to provide rapid management of rickettsial infections.
- 15Patel, P.; Abd El Wahed, A.; Faye, O.; Pruger, P.; Kaiser, M.; Thaloengsok, S.; Ubol, S.; Sakuntabhai, A.; Leparc-Goffart, I.; Hufert, F. T.; Sall, A. A.; Weidmann, M.; Niedrig, M. Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of the Chikungunya Virus. PLoS Neglected Trop. Dis. 2016, 10, e0004953 DOI: 10.1371/journal.pntd.000495315https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXps1Wgsr4%253D&md5=0a32dac06d81874ab0c2aca86af9f7a3A field-deployable reverse transcription recombinase polymerase amplification assay for rapid detection of the Chikungunya virusPatel, Pranav; Abd El Wahed, Ahmed; Faye, Oumar; Prueger, Pauline; Kaiser, Marco; Thaloengsok, Sasikanya; Ubol, Sukathida; Sakuntabhai, Anavaj; Leparc-Goffart, Isabelle; Hufert, Frank T.; Sall, Amadou A.; Weidmann, Manfred; Niedrig, MatthiasPLoS Neglected Tropical Diseases (2016), 10 (9), e0004953/1-e0004953/15CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Chikungunya virus (CHIKV) is a mosquito-borne virus currently transmitted in about 60 countries. CHIKV causes acute flu-like symptoms and in many cases prolonged musculoskeletal and joint pain. Detection of the infection is mostly done using RT-RCR or ELISA, which are not suitable for point-of-care diagnosis. Methodol./Principal Findings In this study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of the CHIKV was developed. The assay sensitivity, specificity, and crossreactivity were tested. CHIKV RT-RPA assay detected down to 80 genome copies/reaction in a max. of 15 min. It successfully identified 18 isolates representing the three CHIKV genotypes. No cross-reactivity was detected to other alphaviruses and arboviruses except O'nyong'nyong virus, which could be differentiated by a modified RPA primer pair. Seventy-eight samples were screened both by RT-RPA and real-time RT-PCR. The diagnostic sensitivity and specificity of the CHIKV RT-RPA assay were detd. at 100%. Conclusions/Significance The developed RT-RPA assay represents a promising method for the mol. detection of CHIKV at point of need.
- 16Weidmann, M.; Faye, O.; Faye, O.; Abd El Wahed, A.; Patel, P.; Batejat, C.; Manugerra, J. C.; Adjami, A.; Niedrig, M.; Hufert, F. T.; Sall, A. A. Development of Mobile Laboratory for Viral Hemorrhagic Fever Detection in Africa. J. Infect. Dis. 2018, 218, 1622– 1630, DOI: 10.1093/infdis/jiy36216https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MboslOqtg%253D%253D&md5=25b29ecc4ce599d99a3e2e826c725f20Development of Mobile Laboratory for Viral Hemorrhagic Fever Detection in AfricaWeidmann Manfred; Faye Ousmane; Faye Oumar; Sall Amadou A; Abd El Wahed Ahmed; Abd El Wahed Ahmed; Patel Pranav; Batejat Christophe; Manugerra Jean Claude; Adjami Aimee; Niedrig Matthias; Hufert Frank TThe Journal of infectious diseases (2018), 218 (10), 1622-1630 ISSN:.Background: A mobile laboratory transportable on commercial flights was developed to enable local response to viral hemorrhagic fever outbreaks. Methods: The development progressed from use of mobile real-time reverse-transcription polymerase chain reaction to mobile real-time recombinase polymerase amplification. In this study, we describe various stages of the mobile laboratory development. Results: A brief overview of mobile laboratory deployments, which culminated in the first on-site detection of Ebola virus disease (EVD) in March 2014, and their successful use in a campaign to roll back EVD cases in Conakry in the West Africa Ebola virus outbreak are described. Conclusions: The developed mobile laboratory successfully enabled local teams to perform rapid disgnostic testing for viral hemorrhagic fever.
- 17Abd El Wahed, A.; Patel, P.; Heidenreich, D.; Hufert, F. T.; Weidmann, M. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus. PLoS Curr. 2013, 5 DOI: 10.1371/currents.outbreaks.62df1c7c75ffc96cd59034531e2e8364There is no corresponding record for this reference.
- 18Mondal, D.; Ghosh, P.; Khan, M. A.; Hossain, F.; Bohlken-Fascher, S.; Matlashewski, G.; Kroeger, A.; Olliaro, P.; Abd El Wahed, A. Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay. Parasites Vectors 2016, 9, 281 DOI: 10.1186/s13071-016-1572-818https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXnvFSnt7g%253D&md5=b3658e21ae02fd06fff5eadd1f694834Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assayMondal, Dinesh; Ghosh, Prakash; Khan, Md. Anik Ashfaq; Hossain, Faria; Bohlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, AhmedParasites & Vectors (2016), 9 (), 281/1-281/8CODEN: PVAEAK; ISSN:1756-3305. (BioMed Central Ltd.)Background: Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clin. symptoms. Mol. diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. Methods: A genomic DNA sample was applied to det. the assay anal. sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clin. performance of the assay was evaluated on LD pos. and neg. samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase lab. (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. Results: The LD RPA assay detected equiv. to one LD genomic DNA. The assay was performed at const. temp. (42°C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected pos. and 48 LD-neg. samples were neg. by both LD RPA and real-time PCR assays, which indicates 100% agreement. The suitcase lab. was successfully operated at the local hospital by using a solar-powered battery. DNA extn. was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. Conclusions: The mobile suitcase lab. using RPA is ideal for rapid sensitive and specific detection of LD esp. at low resource settings and could contribute to VL control and elimination programs.
- 19Abd El Wahed, A.; Weidmann, M.; Hufert, F. T. Diagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. J. Clin. Virol. 2015, 69, 16– 21, DOI: 10.1016/j.jcv.2015.05.00419https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXpt1Ojsr0%253D&md5=ddb861ec74790aa812bb8a314eca7adcDiagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virusAbd El Wahed, Ahmed; Weidmann, Manfred; Hufert, Frank T.Journal of Clinical Virology (2015), 69 (), 16-21CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)In developing countries, equipment necessary for diagnosis is only available in few central labs., which are less accessible and of limited capacity to test large nos. of incoming samples. Moreover, the transport conditions of samples are inadequate, therefore leading to unreliable results. The development of a rapid, inexpensive, and simple test would allow mobile detection of viruses. A suitcase lab. "Diagnostics-in-a-Suitcase" (56 cm × 45.5 cm × 26.5 cm) contg. all reagents and devices necessary for performing a reverse transcription recombinase polymerase amplification (RT-RPA) assay was developed. As an example, two RT-RPA assays were established for the detection of hemagglutinin (H) and neuraminidase (N) genes of the novel avian influenza (H7N9) virus. The sensitivities of the H7 and the N9 RT-RPA assays were 10 and 100 RNA mols., resp. The assays were performed at a single temp. (42 °C). The results were obtained within 2-7 min. The H7N9 RT-RPA assays did not show a cross-detection either of any other respiratory viruses affecting humans and/or birds or of the human or chicken genomes. All reagents were used, stored, and transported at ambient temp., i.e., cold chain independent. In addn., the Diagnostics-in-a-Suitcase was operated by a solar-powered battery. The developed assay protocol and mobile setup performed well. Moreover, it can be easily implemented to perform diagnoses at airports, quarantine stations, or farms for rapid on-site viral nucleic acid detection.
- 20Behrmann, O.; Bachmann, I.; Spiegel, M.; Schramm, M.; El Wahed, A. A.; Dobler, G.; Dame, G.; Hufert, F. T. Rapid detection of SARS-CoV-2 by low volume real-time single tube reverse transcription recombinase polymerase amplification using an exo probe with an internally linked quencher (exo-IQ). Clin Chem. 2020, hvaa116 DOI: 10.1093/clinchem/hvaa116There is no corresponding record for this reference.
- 21Altman, D. G.; Bland, J. M. Diagnostic tests 2: Predictive values. BMJ 1994, 309, 102 DOI: 10.1136/bmj.309.6947.10221https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADyaK2czht12htQ%253D%253D&md5=c7424bdf402258856c332e2252f94fd4Diagnostic tests 2: Predictive valuesAltman D G; Bland J MBMJ (Clinical research ed.) (1994), 309 (6947), 102 ISSN:0959-8138.There is no expanded citation for this reference.
- 22Tang, Y. W.; Schmitz, J. E.; Persing, D. H.; Stratton, C. W. Laboratory Diagnosis of COVID-19: Current Issues and Challenges. J. Clin. Microbiol. 2020, 58, e00512-20 DOI: 10.1128/JCM.00512-20There is no corresponding record for this reference.
- 23Xu, R.; Cui, B.; Duan, X.; Zhang, P.; Zhou, X.; Yuan, Q. Saliva: potential diagnostic value and transmission of 2019-nCoV. Int. J. Oral Sci. 2020, 12, 11 DOI: 10.1038/s41368-020-0080-z23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXntleit78%253D&md5=1c56e9c5489e23b375942490dc733ce6Saliva: potential diagnostic value and transmission of 2019-nCoVXu, Ruoshi; Cui, Bomiao; Duan, Xiaobo; Zhang, Ping; Zhou, Xuedong; Yuan, QuanInternational Journal of Oral Science (2020), 12 (1), 11CODEN: IJOSFA; ISSN:2049-3169. (Nature Research)A review. Abstr.: 2019-nCoV epidemic was firstly reported at late Dec. of 2019 and has caused a global outbreak of COVID-19 now. Saliva, a biofluid largely generated from salivary glands in oral cavity, has been reported 2019-nCoV nucleic acid pos. Besides lungs, salivary glands and tongue are possibly another hosts of 2019-nCoV due to expression of ACE2. Close contact or short-range transmission of infectious saliva droplets is a primary mode for 2019-nCoV to disseminate as claimed by WHO, while long-distance saliva aerosol transmission is highly environment dependent within indoor space with aerosol-generating procedures such as dental practice. So far, no direct evidence has been found that 2019-nCoV is vital in air flow for long time. Therefore, to prevent formation of infectious saliva droplets, to thoroughly disinfect indoor air and to block acquisition of saliva droplets could slow down 2019-nCoV dissemination. This review summarizes diagnostic value of saliva for 2019-nCoV, possibly direct invasion into oral tissues, and close contact transmission of 2019-nCoV by saliva droplets, expecting to contribute to 2019-nCoV epidemic control.
- 24Wang, W.; Xu, Y.; Gao, R.; Lu, R.; Han, K.; Wu, G.; Tan, W. Detection of SARS-CoV-2 in Different Types of Clinical Specimens. JAMA 2020, 323, 1843– 1844, DOI: 10.1001/jama.2020.378624https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXps1Srurs%253D&md5=a81f303ff3bb23c0d9b23dca48fd1315Detection of SARS-CoV-2 in different types of clinical specimensWang, Wenling; Xu, Yanli; Gao, Ruqin; Lu, Roujian; Han, Kai; Wu, Guizhen; Tan, WenjieJAMA, the Journal of the American Medical Association (2020), 323 (18), 1843-1844CODEN: JAMAAP; ISSN:1538-3598. (American Medical Association)The present article describes about detection of SARS-CoV-2 in different types of clin. specimens.
- 25Gandhi, M.; Yokoe, D. S.; Havlir, D. V. Asymptomatic Transmission, the Achilles’ Heel of Current Strategies to Control Covid-19. N. Engl. J. Med. 2020, 382, 2158– 2160, DOI: 10.1056/NEJMe200975825https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVGqsrfF&md5=9758bf5634365e6044e42b6c8b57b5b3Asymptomatic transmission, the Achilles' heel of current strategies to control Covid-19Gandhi, Monica; Yokoe, Deborah S.; Havlir, Diane V.New England Journal of Medicine (2020), 382 (22), 2158-2160CODEN: NEJMAG; ISSN:1533-4406. (Massachusetts Medical Society)A review. A brief editorial discussing the role of asymptomatic transmission in the spread and severity of the current SARS-CoV-2 pandemic. The authors contrast the differences between the current SARS-CoV-2 pandemic and the SARS-CoV-1 epidemic of 2003. High levels of SARS-CoV-2 virus are shed from the upper respiratory tract of patients, even before symptoms are obsd. In contrast, replication of SARS-CoV-1 occurs mainly in the lower respiratory tract, and viral shedding occurs later, when patients are symptomatic. Asymptomatic transmission of SARS-CoV-2 is the Achilles' heel of COVID-19 pandemic control through the public health strategies we have currently deployed. Because of this, testing of asymptomatic individuals, social distancing, and the general use of face masks in public spaces are the main tools to deal with this pandemic.
- 26FIND WHO Find Evaluation Update: SARSCOV-2 Molecular Diagnostics. https://www.finddx.org/covid-19/sarscov2-eval-molecular/ (accessed June 25, 2020).There is no corresponding record for this reference.
- 27FIND-WHO FIND Evaluation Update: SARSCOV-2 Immunoassays. https://www.finddx.org/covid-19/sarscov2-eval-immuno/ (accessed June 25, 2020).There is no corresponding record for this reference.
- 28FDA Coronavirus (COVID-19) Update: FDA AuthorizesFirst Antigen Test to Help in the Rapid Detection of the Virus thatCauses COVID-19 in Patients. https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-authorizes-first-antigen-test-help-rapid-detection-virus-causes (accessed June 25, 2020).There is no corresponding record for this reference.
- 29FIND-WHO SARS-COV-2 Diagnostic Pipeline. https://www.finddx.org/covid-19/pipeline/?avance=all&type=Manual+NAT&test_target=RNA&status=all§ion=molecular-assays&action=default#diag_tab (accessed June 25, 2020).There is no corresponding record for this reference.
- 30Huang, W. E.; Lim, B.; Hsu, C. C.; Xiong, D.; Wu, W.; Yu, Y.; Jia, H.; Wang, Y.; Zeng, Y.; Ji, M.; Chang, H.; Zhang, X.; Wang, H.; Cui, Z. RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2. Microb. Biotechnol. 2020, 13, 950– 961, DOI: 10.1111/1751-7915.1358630https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtFaiurjP&md5=dbad600a2f4c7565871114ce09b72b6fRT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2Huang, Wei E.; Lim, Boon; Hsu, Chia-Chen; Xiong, Dan; Wu, Wei; Yu, Yejiong; Jia, Huidong; Wang, Yun; Zeng, Yida; Ji, Mengmeng; Chang, Hong; Zhang, Xiuming; Wang, Hui; Cui, ZhanfengMicrobial Biotechnology (2020), 13 (4), 950-961CODEN: MBIIB2; ISSN:1751-7915. (Wiley-Blackwell)Summary : The pandemic coronavirus SARS-CoV-2 in the world has caused a large infected population suffering from COVID-19. To curb the spreading of the virus, WHO urgently demanded an extension of screening and testing; thus, a rapid and simple diagnostic method is needed. We applied a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) to achieve the detection of SARS-CoV-2 in 30 min. We designed four sets of LAMP primers (6 primers in each set), targeting the viral RNA of SARS-CoV-2 in the regions of orf1ab, S gene and N gene. A colorimetric change was used to report the results, which enables the outcome of viral RNA amplification to be read by the naked eye without the need of expensive or dedicated instrument. The sensitivity can be 80 copies of viral RNA per mL in a sample. We validated the RT-LAMP method in a hospital in China, employing 16 clinic samples with 8 positives and 8 negatives. The testing results are consistent with the conventional RT-qPCR. In addn., we also show that one-step process without RNA extn. is feasible to achieve RNA amplification directly from a sample. This rapid, simple and sensitive RT-LAMP method paves a way for a large screening at public domain and hospitals, particularly regional hospitals and medical centers in rural areas.
- 31Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826 DOI: 10.3390/ijms2108282631https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVCnsrvJ&md5=f6b267272b5bb8b6ca09e7eb158c69d8A novel reverse transcription loop-mediated isothermal amplification method for rapid detection of SARS-CoV-2Lu, Renfei; Wu, Xiuming; Wan, Zhenzhou; Li, Yingxue; Jin, Xia; Zhang, ChiyuInternational Journal of Molecular Sciences (2020), 21 (8), 2826CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)COVID-19 has become a major global public health burden, currently causing a rapidly growing no. of infections and significant morbidity and mortality around the world. Early detection with fast and sensitive assays and timely intervention are crucial for interrupting the spread of the COVID-19 virus (SARS-CoV-2). Using a mismatch-tolerant amplification technique, we developed a simple, rapid, sensitive and visual reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for SARS-CoV-2 detection based on its N gene. The assay has a high specificity and sensitivity, and robust reproducibility, and its results can be monitored using a real-time PCR machine or visualized via colorimetric change from red to yellow. The limit of detection (LOD) of the assay is 118.6 copies of SARS-CoV-2 RNA per 25μL reaction. The reaction can be completed within 30 min for real-time fluorescence monitoring, or 40 min for visual detection when the template input is more than 200 copies per 25μL reaction. To evaluate the viability of the assay, a comparison between the RT-LAMP and a com. RT-qPCR assay was made using 56 clin. samples. The SARS-CoV-2 RT-LAMP assay showed perfect agreement in detection with the RT-qPCR assay. The newly-developed SARS-CoV-2 RT-LAMP assay is a simple and rapid method for COVID-19 surveillance.
- 32Hin, S.; Lopez-Jimena, B.; Bakheit, M.; Klein, V.; Stack, S.; Fall, C.; Sall, A. A.; Enan, K.; Mustafa, M.; Gillies, L.; Rusu, V.; Goethel, S.; Paust, N.; Zengerle, R.; Frischmann, S.; Weidmann, M. Fully automated point-of-care differential diagnosis of acute febrile illness. Submitted 2020.There is no corresponding record for this reference.
- 33van Kasteren, P. B.; van der Veer, B.; van den Brink, S.; Wijsman, L.; de Jonge, J.; van den Brandt, A.; Molenkamp, R.; Reusken, C.; Meijer, A. Comparison of seven commercial RT-PCR diagnostic kits for COVID-19. J. Clin. Virol. 2020, 128, 104412 DOI: 10.1016/j.jcv.2020.10441233https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpsVOlsLw%253D&md5=dd81dd0488b264997d12426048264553Comparison of seven commercial RT-PCR diagnostic kits for COVID-19van Kasteren, Puck B.; van der Veer, Bas; van den Brink, Sharon; Wijsman, Lisa; de Jonge, Joergen; van den Brandt, Annemarie; Molenkamp, Richard; Reusken, Chantal B. E. M.; Meijer, AdamJournal of Clinical Virology (2020), 128 (), 104412CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)The final months of 2019 witnessed the emergence of a novel coronavirus in the human population. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has since spread across the globe and is posing a major burden on society. Measures taken to reduce its spread critically depend on timely and accurate identification of virus-infected individuals by the most sensitive and specific method available, i.e. real-time reverse transcriptase PCR (RT-PCR). Many com. kits have recently become available, but their performance has not yet been independently assessed. The aim of this study was to compare basic anal. and clin. performance of selected RT-PCR kits from 7 different manufacturers (Altona Diagnostics, BGI, CerTest Biotec, KH Medical, PrimerDesign, R-Biopharm AG, and Seegene). We used serial dilns. of viral RNA to establish PCR efficiency and est. the 95% limit of detection (LOD95). Furthermore, we ran a panel of SARS-CoV-2-pos. clin. samples (n = 13) for a preliminary evaluation of clin. sensitivity. Finally, we used clin. samples pos. for non-coronavirus respiratory viral infections (n = 6) and a panel of RNA from related human coronaviruses to evaluate assay specificity. PCR efficiency was ≥96% for all assays and the estd. LOD95 varied within a 6-fold range. Using clin. samples, we obsd. some variations in detection rate between kits. Importantly, none of the assays showed cross-reactivity with other respiratory (corona)viruses, except as expected for the SARS-CoV-1 E-gene. We conclude that all RT-PCR kits assessed may be used for routine diagnostics of COVID-19 in patients by experienced mol. diagnostic labs.
- 34Wu, T.; Ge, Y.; Zhao, K.; Zhu, X.; Chen, Y.; Wu, B.; Zhu, F.; Zhu, B.; Cui, L. A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2). Virology 2020, 549, 1– 4, DOI: 10.1016/j.virol.2020.07.00634https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsFersLfP&md5=e73a612fac6de12675e92442464cc3c7A reverse-transcription recombinase-aided amplification assay for the rapid detection of N gene of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)Wu, Tao; Ge, Yiyue; Zhao, Kangchen; Zhu, Xiaojuan; Chen, Yin; Wu, Bin; Zhu, Fengcai; Zhu, Baoli; Cui, LunbiaoVirology (2020), 549 (), 1-4CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)The current outbreak of coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was reported in China firstly. A rapid, highly sensitive, specific, and simple operational method was needed for the detection of SARS-CoV-2. Here, we established a real-time reverse-transcription recombinase-aided amplification assay (RT-RAA) to detect SARS-CoV-2 rapidly. The primers and probe were designed based on the nucleocapsid protein gene (N gene) sequence of SARS-CoV-2. The detection limit was 10 copies per reaction in this assay, which could be conducted within 15 min at a const. temp. (39°), without any cross-reactions with other respiratory tract pathogens, such as other coronaviruses. Furthermore, compared with com. real-time RT-PCR assay, it showed a kappa value of 0.959 from 150 clin. specimens. These results indicated that this real-time RT-RAA assay may be a valuable tool for detecting SARS-CoV-2.
- 35Cohen, A. N.; Kessel, B. False positives in reverse transcription PCR testing for SARS-CoV-2. medRxiv 2020, 20080911 DOI: 10.1101/2020.04.26.20080911There is no corresponding record for this reference.
- 36Bustin, S. A.; Nolan, T. RT-qPCR Testing of SARS-CoV-2: A Primer. Int. J. Mol. Sci. 2020, 21, 3004 DOI: 10.3390/ijms2108300436https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVCnsr%252FM&md5=23eaceb715052b1866587d26c1421129RT-qPCR testing of SARS-CoV-2: a primerBustin, Stephen A.; Nolan, TaniaInternational Journal of Molecular Sciences (2020), 21 (8), 3004CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)A review and commentary regarding testing for the presence of coronavirus which is an essential diagnostic tool for monitoring and managing the current COVID-19 pandemic. The only reliable test in current use for testing acute infection targets the genome of SARS-CoV-2, and the most widely used method is quant. fluorescence-based reverse transcription polymerase chain reaction (RT-qPCR). Despite its ubiquity, there is a significant amt. of uncertainty about how this test works, potential throughput and reliability. This has resulted in widespread misrepresentation of the problems faced using this test during the current COVID-19 epidemic. This primer provides simple, straightforward and impartial information about RT-qPCR.
- 37Falasca, F.; Sciandra, I.; Di Carlo, D.; Gentile, M.; Deales, A.; Antonelli, G.; Turriziani, O. Detection of SARS-COV N2 Gene: Very low amounts of viral RNA or false positive?. J. Clin. Virol. 2020, 133, 104660 DOI: 10.1016/j.jcv.2020.10466037https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitFCku7fN&md5=e2cad1c00486e013d7f21a58564ce14fDetection of SARS-COV N2 Gene: Very low amounts of viral RNA or false positive?Falasca, Francesca; Sciandra, Ilaria; Di Carlo, Daniele; Gentile, Massimo; Deales, Alberto; Antonelli, Guido; Turriziani, OmbrettaJournal of Clinical Virology (2020), 133 (), 104660CODEN: JCVIFB; ISSN:1386-6532. (Elsevier B.V.)The detection of a low amt. of viral RNA is crucial to identify a SARS-CoV-2 pos. individual harboring a low level of virus, esp. during the convalescent period. However, the detection of one gene at high Cycle threshold (Ct) has to be interpreted with caution. In this study the authors address this specific issue and report the authors' real-life experience. A total of 1639 nasopharyngeal swabs (NPS) were analyzed with Xpert Xpress SARS-CoV-2. Pos. samples showing high Ct values (Ct>35) were concd. by centrifugation and re-tested with Cepheid or other methods (RealStar SARS-CoV2 RT-PCR, Altona Diagnostics; GeneFinder COVID-19 Plus RealAmp Kit, Elitech).1599 (97.5%) neg. samples, 36 (2.3%) pos. samples and 4 (0.2%) presumptive pos. samples were detected. In 17 out of 36 pos. patients, very low viral RNA copies were suspected since positivity was detected at high Ct. The authors confirmed positivity for patients who showed both E and N genes detected and for patients with only N detected but with Ct <39. On the contrary, samples with only gene N detected with Ct values >39 were found neg. NPS taken 24 h after the first collection confirmed the negativity of the 12 samples. Clin. data sustained these results since only 2 of these 12 patients showed COVID-19-like symptoms. These data support the authors' consideration that detection of the N2 gene at high Ct needs to be interpreted with caution, suggesting that collaboration between virologists and clinicians is important for better understanding of results.
- 38Wang, J.; Cai, K.; He, X.; Shen, X.; Wang, J.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Cui, L.; Ge, Y.; Wu, T.; Zhang, Y.; Yan, H.; Chen, Y.; Yu, J.; Ma, X.; Shi, H.; Zhang, R.; Li, X.; Gao, Y.; Niu, P.; Tan, W.; Wu, G.; Jiang, Y.; Xu, W.; Ma, X. Multiple-centre clinical evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNA. Clin. Microbiol. Infect. 2020, 26, 1076– 1081, DOI: 10.1016/j.cmi.2020.05.00738https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVGms73N&md5=72f9832fa5635fa39e90886b9fcba585Multiple-centre clinical evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNAWang, J.; Cai, K.; He, X.; Shen, X.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Cui, L.; Ge, Y.; Wu, T.; Zhang, Y.; Yan, H.; Chen, Y.; Yu, J.; Ma, X.; Shi, H.; Zhang, R.; Li, X.; Gao, Y.; Niu, P.; Tan, W.; Wu, G.; Jiang, Y.; Xu, W.Clinical Microbiology and Infection (2020), 26 (8), 1076-1081CODEN: CMINFM; ISSN:1198-743X. (Elsevier Ltd.)To evaluate the performance of an ultrafast single-tube nucleic acid isothermal amplification detection assay for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA using clin. samples from multiple centers.A reverse transcription recombinase-aided amplification (RT-RAA) assay for SARS-CoV-2 was conducted within 15 min at 39°C with portable instruments after addn. of extd. RNA. The clin. performance of RT-RAA assay was evaluated using 947 clin. samples from five institutions in four regions of China; approved com. fluorescence quant. real-time PCR (qRT-PCR) kits were used for parallel detection. The sensitivity and specificity of RT-RAA were compared and analyzed.The RT-RAA test results of 926 samples were consistent with those of qRT-PCR (330 were pos., 596 neg.); 21 results were inconsistent. The sensitivity and specificity of RT-RAA was 97.63% (330/338, 95% confidence interval (CI) 95.21 to 98.90) and 97.87% (596/609, 95% CI 96.28 to 98.81) resp. The pos. and neg. predictive values were 96.21% (330/343, 95% CI 93.45 to 97.88) and 98.68% (596/604, 95% CI 97.30 to 99.38) resp. The total coincidence rate was 97.78% (926/947, 95% CI 96.80 to 98.70), and the kappa was 0.952 (p < 0.05).With comparable sensitivity and specificity to the com. qRT-PCR kits, RT-RAA assay for SARS-CoV-2 exhibited the distinctive advantages of simplicity and rapidity in terms of operation and turnaround time.
- 39Kanwar, N.; Michael, J.; Doran, K.; Montgomery, E.; Selvarangan, R. Comparison of the ID Now Influenza A & B 2, Cobas Influenza A/B, and Xpert Xpress Flu Point-of-Care Nucleic Acid Amplification Tests for Influenza A/B Virus Detection in Children. J. Clin. Microbiol. 2020, 58, e01611-19 DOI: 10.1128/JCM.01611-19There is no corresponding record for this reference.
- 40Zhen, W.; Smith, E.; Manji, R.; Schron, D.; Berry, G. J. Clinical Evaluation of Three Sample-To-Answer Platforms for the Detection of SARS-CoV-2. J. Clin. Microbiol. 2020, 58, 1– 7, DOI: 10.1128/JCM.00783-20There is no corresponding record for this reference.
- 41FDA Coronavirus (COVID-19) Update: FDA Informs Public About Possible Accuracy Concerns with Abbott ID NOW Point-of-Care Test. https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-informs-public-about-possible-accuracy-concerns-abbott-id-now-point (accessed June 25, 2020).There is no corresponding record for this reference.
- 42Barratt, K.; Mackay, J. F. Improving real-time PCR genotyping assays by asymmetric amplification. J. Clin. Microbiol. 2002, 40, 1571– 1572, DOI: 10.1128/JCM.40.4.1571-1572.200242https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XjtlCmsbo%253D&md5=a096c1ed38431fdcce0af0b256789e1eImproving real-time PCR genotyping assays by asymmetric amplificationBarratt, Kevin; Mackay, John F.Journal of Clinical Microbiology (2002), 40 (4), 1571-1572CODEN: JCMIDW; ISSN:0095-1137. (American Society for Microbiology)The commonly used protocol for real-time PCR using the LightCycler system for herpes simplex virus genotyping was found to provide poor results when specific reagent concns. are used. The PCR resulted in the "hook effect" phenomenon, which suggests that in the later cycles of the PCR, the amplified strands reanneal before the probes can bind to generate fluorescence. To overcome this problem, the use of asym. primer concns. is recommended, whereby a higher concn. of the reverse primer is used in the reaction. This results in more of the strand complementary to the probes being amplified and allows more signal to be generated. The use of asym. primer concns. should be considered when new LightCycler genotyping assays that result in the hook effect on the quantitation screen are being optimized.
- 43Mackay, I. M.; Jacob, K. C.; Woolhouse, D.; Waller, K.; Syrmis, M. W.; Whiley, D. M.; Siebert, D. J.; Nissen, M.; Sloots, T. P. Molecular assays for detection of human metapneumovirus. J. Clin. Microbiol. 2003, 41, 100– 105, DOI: 10.1128/JCM.41.1.100-105.200343https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXhtFGmtbk%253D&md5=e255278e680b6a6050b314703cbd9f8eMolecular assays for detection of human metapneumovirusMackay, Ian M.; Jacob, Kevin C.; Woolhouse, Daniel; Waller, Katharine; Syrmis, Melanie W.; Whiley, David M.; Siebert, David J.; Nissen, Michael; Sloots, Theo P.Journal of Clinical Microbiology (2003), 41 (1), 100-105CODEN: JCMIDW; ISSN:0095-1137. (American Society for Microbiology)The recent description of the respiratory pathogen human metapneumovirus (hMPV) has highlighted a deficiency in current diagnostic techniques for viral agents assocd. with acute lower respiratory tract infections. We describe two novel approaches to the detection of viral RNA by use of reverse transcriptase PCR (RT-PCR). The PCR products were identified after capture onto a solid-phase medium by hybridization with a sequence-specific, biotinylated oligonucleotide probe. The assay was applied to the screening of 329 nasopharyngeal aspirates sampled from patients suffering from respiratory tract disease. These samples were neg. for other common microbial causes of respiratory tract disease. We were able to detect hMPV sequences in 32 (9.7%) samples collected from Australian patients during 2001. To further reduce result turnaround times we designed a fluorogenic TaqMan oligoprobe and combined it with the existing primers for use on the LightCycler platform. The real-time RT-PCR proved to be highly reproducible and detected hMPV in an addnl. 6 out of 62 samples (9.6%) tested during the comparison of the two diagnostic approaches. We found the real-time RT-PCR to be the test of choice for future investigation of samples for hMPV due to its speed, reproducibility, specificity, and sensitivity.
- 44Pillonel, T.; Scherz, V.; Jaton, K.; Greub, G.; Bertelli, C. Letter to the editor: SARS-CoV-2 detection by real-time RT-PCR. Eurosurveillance 2020, 25, 2000880 DOI: 10.2807/1560-7917.ES.2020.25.21.200088044https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtV2ntrrF&md5=4b0ffe196e99aed8a50369e930f27e8cLetter to the editor: SARS-CoV-2 detection by real-time RT-PCRPillonel, Trestan; Scherz, Valentin; Jaton, Katia; Greub, Gilbert; Bertelli, ClaireEurosurveillance (2020), 25 (21), 2000880CODEN: EUROGD; ISSN:1560-7917. (European Centre for Disease Prevention and Control)There is no expanded citation for this reference.
- 45Skerra, A. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. 1992, 20, 3551– 3554, DOI: 10.1093/nar/20.14.355145https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK38Xmt1OhsL4%253D&md5=b90ace39c184d564b19dc29115c56f48Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activitySkerra, ArneNucleic Acids Research (1992), 20 (14), 3551-4CODEN: NARHAD; ISSN:0305-1048.Two thermostable DNA polymerases with proofreading activity-Vent DNA polymerase and Pfu DNA polymerase-have attracted recent attention, mainly because of their enhanced fidelities during amplification of DNA sequences by the polymerase chain reaction. A severe disadvantage of their practical application, however, results from the observation that due to their 3' to 5' exonuclease activities these enzymes degrade the oligodeoxynucleotides serving as primers for the DNA synthesis. It is demonstrated that this exonucleolytic attack on the primer mols. can be efficiently prevented by the introduction of single phosphorothioate bonds at their 3' termini. This strategy, which can be easily accomplished using routine DNA synthesis methodol., may open the way to a widespread use of these novel enzymes in the polymerase chain reaction.
- 46(BAuA), B. f. A. u. A. Empfehlungen zu Arbeitsschutzmaßnahmen bei der Point-Of-Care-SARS-CoV-2 Diagnostik. (accessed Nov 8, 2020).There is no corresponding record for this reference.
- 47Fomsgaard, A. S.; Rosenstierne, M. W. An alternative workflow for molecular detection of SARS-CoV-2 - escape from the NA extraction kit-shortage, Copenhagen, Denmark, March 2020. Eurosurveillance 2020, 25, 2000398 DOI: 10.2807/1560-7917.es.2020.25.14.2000398There is no corresponding record for this reference.
- 48Lista, mJ.; Page, R.; Sertkaya, H.; Matos, P.; Ortiz-Zapater, E.; Maguire, T. J. A.; Poulton, K.; O’Byrne, A.; Bouton, C.; Dickenson, R. E.; Ficarelli, M.; Howard, M.; Betancor, G.; Galao, R. P.; Pickering, S.; Signell, A. W.; Wilson, H.; Cliff, P.; Ik, M. T. K.; Patel, A.; MacMahon, E.; Cunningham, E.; Doores, K.; Agromayor, M.; Martin-Serrano, J. M.; Perucha, E.; Mischo, H. E.; Shankar-Hari, M.; Batra, R.; Edgeworth, J.; Malim, M. H.; Neil, S.; Martinez-Nunez, R. T. Resilient SARS-CoV-2 diagnostics workflows including viral heat inactivation medRxiv 2020, DOI: 10.1101/2020.04.22.20074351 .There is no corresponding record for this reference.
- 49Kuiper, J. W. P.; Baade, T.; Kremer, M.; Kranaster, R.; Irmisch, L.; Schuchmann, M.; Zander, J.; Marx, A.; Hauck, C. R. Detection of SARS-CoV-2 from raw patient samples by coupled high temperature reverse transcription and amplification. PLoS One 2020, 15, e0241740 DOI: 10.1371/journal.pone.024174049https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXit1ylu7%252FJ&md5=2115bcf1eb0b96dadbcf24f6901ac25cDetection of SARS-CoV-2 from raw patient samples by coupled high temperature reverse transcription and amplificationKuiper, Johannes W. P.; Baade, Timo; Kremer, Marcel; Kranaster, Ramon; Irmisch, Linda; Schuchmann, Marcus; Zander, Johannes; Marx, Andreas; Hauck, Christof R.PLoS One (2020), 15 (11), e0241740CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)SARS-CoV-2 is spreading globally with unprecedented consequences for modern societies. The early detection of infected individuals is a pre-requisite to contain the virus. Currently, purifn. of RNA from patient samples followed by RT-PCR is the gold std. to assess the presence of this single-strand RNA virus. However, these procedures are time consuming, require continuous supply of specialized reagents, and are prohibitively expensive in resource-poor settings. Here, we report an improved nucleic-acid-based approach to detect SARS-CoV-2 with the ability to detect as little as five viral genome equiv. The approach delivers results without the need to purify RNA, reduces handling steps, minimizes costs, and allows evaluation by non-specialized equipment. The use of unprocessed swab samples is enabled by employing a heat-stable RNA- and DNA-dependent DNA polymerase, which performs the double task of stringent reverse transcription of RNA at elevated temps. as well as PCR amplification of a SARS-CoV-2 specific target gene. As results are obtained within 2 h and can be read-out by a hand-held LED-screen, this novel protocol will be of particular importance for large-scale virus surveillance in economically constrained settings.
- 50Bonney, L. C.; Watson, R. J.; Afrough, B.; Mullojonova, M.; Dzhuraeva, V.; Tishkova, F.; Hewson, R. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection. PLoS Neglected Trop. Dis. 2017, 11, e0006013 DOI: 10.1371/journal.pntd.000601350https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVKgu73M&md5=9c90b245efccd49410a012ccd1984ce4A recombinase polymerase amplification assay for rapid detection of Crimean-Congo haemorrhagic fever virus infectionBonney, Laura C.; Watson, Robert J.; Afrough, Babak; Mullojonova, Manija; Dzhuraeva, Viktoriya; Tishkova, Farida; Hewson, RogerPLoS Neglected Tropical Diseases (2017), 11 (10), e0006013/1-e0006013/16CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background Crimean-Congo Haemorrhagic fever Virus (CCHFV) is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia. Methodol./principle findings An isothermal recombinase polymerase amplification (RPA) assay was successfully developed for mol. detection of CCHFV. The assay showed rapid (under 10 min) detection of viral exts./synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude prepns. of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample prepn. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clin. samples from Tajikistan. Conclusions/significance The assay is a rapid, isothermal, simple-to-perform mol. diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource labs., for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.
- 51Daher, R. K.; Stewart, G.; Boissinot, M.; Bergeron, M. G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947– 58, DOI: 10.1373/clinchem.2015.24582951https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsFOhsLbE&md5=37fd60617f2bf006e015e1dcc2d9fe5cRecombinase polymerase amplification for diagnostic applicationsDaher, Rana K.; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G.Clinical Chemistry (Washington, DC, United States) (2016), 62 (7), 947-958CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)A review. BACKGROUND: First introduced in 2006, recombinase polymerase amplification (RPA) has stirred great interest, as evidenced by 75 publications as of Oct. 2015, with 56 of them just in the last 2 years. The widespread adoption of this isothermal mol. tool in many diagnostic fields represents an affordable (approx. 4.3 USD per test), simple (few and easy hands-on steps), fast (results within 5-20 min), and sensitive (single target copy no. detected) method for the identification of pathogens and the detection of single nucleotide polymorphisms in human cancers and genetically modified organisms. CONTENT: This review summarizes the current knowledge on RPA. The mol. diagnostics of various RNA/DNA pathogens is discussed while highlighting recent applications in clin. settings with focus on point-of-care (POC) bioassays and on automated fluidic platforms. The strengths and limitations of this isothermal method are also addressed. SUMMARY: RPA is becoming a mol. tool of choice for the rapid, specific, and cost-effective identification of pathogens. Owing to minimal sample-prepn. requirements, low operation temp. (25-42 °C), and com. availability of freeze-dried reagents, this method has been applied outside lab. settings, in remote areas, and interestingly, onboard automated sample-to-answer microfluidic devices. RPA is undoubtedly a promising isothermal mol. technique for clin. microbiol. labs. and emergence response in clin. settings.
- 52Daher, R. K.; Stewart, G.; Boissinot, M.; Bergeron, M. G. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples. Clin. Chem. 2014, 60, 660– 666, DOI: 10.1373/clinchem.2013.21350452https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmt1ClurY%253D&md5=420a93fb3bad2420bee745edc6cc3453Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samplesDaher, Rana K.; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G.Clinical Chemistry (Washington, DC, United States) (2014), 60 (4), 660-666CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)Group B streptococcal infections are the leading cause of sepsis and meningitis in newborns. A rapid and reliable method for the detection of this pathogen at the time of delivery is needed for the early treatment of neonates. Isothermal amplification techniques such as recombinase polymerase amplification have advantages relative to PCR in terms of the speed of reaction and simplicity. We studied the clin. performance of recombinase polymerase amplification for the screening of group B streptococci in vaginal/anal samples from 50 pregnant women. We also compared the limit of detection and the anal. specificity of this isothermal assay to real-time PCR (RT-PCR). Compared to RT-PCR, the recombinase polymerase amplification assay showed a clin. sensitivity of 96% and a clin. specificity of 100%. The limit of detection was 98 genome copies and the anal. specificity was 100% for a panel of 15 bacterial and/or fungal strains naturally found in the vaginal/anal flora. Time-to-result for the recombinase polymerase amplification assay was <20 min compared to 45 min for the RT-PCR assay; a pos. sample could be detected as early as 8 min. We demonstrate the potential of isothermal recombinase polymerase amplification assay as a clin. useful mol. diagnostic tool that is simple and faster than PCR/RT-PCR. Recombinase polymerase amplification offers great potential for nucleic acid-based diagnostics at the point of care.
Supporting Information
Supporting Information
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acs.analchem.0c04779.
Mobile suitcase lab (Figure S1) and raw data of screening clinical samples in African settings (Table S1) (PDF)
Terms & Conditions
Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.