Pair your accounts.

Export articles to Mendeley

Get article recommendations from ACS based on references in your Mendeley library.

Pair your accounts.

Export articles to Mendeley

Get article recommendations from ACS based on references in your Mendeley library.

You’ve supercharged your research process with ACS and Mendeley!

STEP 1:
Click to create an ACS ID

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

MENDELEY PAIRING EXPIRED
Your Mendeley pairing has expired. Please reconnect
ACS Publications. Most Trusted. Most Cited. Most Read
Determination of Advantages and Limitations of qPCR Duplexing in a Single Fluorescent Channel
More

OR SEARCH CITATIONS

My Activity
Publications

Figure 1Loading Img
Download Hi-Res ImageDownload to MS-PowerPointCite This:ACS Omega 2021, 6, 34, 22292-22300
  • Open Access
Article

Determination of Advantages and Limitations of qPCR Duplexing in a Single Fluorescent Channel
Click to copy article linkArticle link copied!

  • Haoqing Zhang
    Haoqing Zhang
    School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    More by Haoqing Zhang
  • Zhiqiang Yan
    Zhiqiang Yan
    School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    More by Zhiqiang Yan
  • Xinlu Wang
    Xinlu Wang
    School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    More by Xinlu Wang
  • Martina Gaňová
    Martina Gaňová
    Central European Institute of Technology, Brno University of Technology, Purkyňova 123, 612 00 Brno, Czech Republic
    More by Martina Gaňová
  • Honglong Chang
    Honglong Chang
    School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    More by Honglong Chang
    Orcidhttps://orcid.org/0000-0003-0400-3658
  • Soňa Laššáková
    Soňa Laššáková
    Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University and General University Hospital in Prague, Albertov 4, 128 00 Prague, Czech Republic
    More by Soňa Laššáková
  • Marie Korabecna
    Marie Korabecna
    Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University and General University Hospital in Prague, Albertov 4, 128 00 Prague, Czech Republic
    More by Marie Korabecna
  • Pavel Neuzil*
    Pavel Neuzil
    School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    Central European Institute of Technology, Brno University of Technology, Purkyňova 123, 612 00 Brno, Czech Republic
    School of Electrical Engineering and Computer Technology, Brno University of Technology, Technická 10, 612 00 Brno, Czech Republic
    *Email: [email protected]
    More by Pavel Neuzil
    Orcidhttps://orcid.org/0000-0001-9040-281X
Open PDFSupporting Information (1)

ACS Omega

Cite this: ACS Omega 2021, 6, 34, 22292–22300
Click to copy citationCitation copied!
https://doi.org/10.1021/acsomega.1c02971
Published August 19, 2021

Copyright © 2021 The Authors. Published by American Chemical Society. This publication is licensed under

CC-BY-NC-ND 4.0 .

Abstract

Click to copy section linkSection link copied!
High Resolution Image
Download MS PowerPoint Slide

Real-time (quantitative) polymerase chain reaction (qPCR) has been widely applied in molecular diagnostics due to its immense sensitivity and specificity. qPCR multiplexing, based either on fluorescent probes or intercalating dyes, greatly expanded PCR capability due to the concurrent amplification of several deoxyribonucleic acid sequences. However, probe-based multiplexing requires multiple fluorescent channels, while intercalating dye-based multiplexing needs primers to be designed for amplicons having different melting temperatures. Here, we report a single fluorescent channel-based qPCR duplexing method on a model containing the sequence of chromosomes 21 (Chr21) and 18 (Chr18). We combined nonspecific intercalating dye EvaGreen with a 6-carboxyfluorescein (FAM) probe specific to either Chr21 or Chr18. The copy number (cn) of the target linked to the FAM probe could be determined in the entire tested range from the denaturation curve, while the cn of the other one was determined from the difference between the denaturation and elongation curves. We recorded the amplitude of fluorescence at the end of denaturation and elongation steps, thus getting statistical data set to determine the limit of the proposed method in detail in terms of detectable concentration ratios of both targets. The proposed method eliminated the fluorescence overspilling that happened in probe-based qPCR multiplexing and determined the specificity of the PCR product via melting curve analysis. Additionally, we performed and verified our method using a commercial thermal cycler instead of a self-developed system, making it more generally applicable for researchers. This quantitative single-channel duplexing method is an economical substitute for a conventional rather expensive probe-based qPCR requiring different color probes and hardware capable of processing these fluorescent signals.

This publication is licensed under

CC-BY-NC-ND 4.0 .
  • cc licence
  • by licence
  • nc licence
  • nd licence
Copyright © 2021 The Authors. Published by American Chemical Society

Subjects

what are subjects

1. Introduction

Click to copy section linkSection link copied!
Polymerase chain reaction (PCR) is a powerful technique to amplify a small number of specific sequences of deoxyribonucleic acid (DNA) molecules up to a detectable level. (1) Since its invention in 1986, variants of PCR-based methods have been developed, (2) such as standard PCR (end-point PCR), (3) real-time/quantitative PCR (qPCR), (4) and digital PCR (dPCR). (5) qPCR is capable of monitoring the PCR progress in real-time and determining the initial concentration of the target genes. It is currently a gold standard for nucleic acid (NA) detection, especially during the coronavirus disease 2019 (COVID-19) pandemic. (6) It is performed using either nonspecific intercalating fluorescent dyes, such as SYBR Green I or EvaGreen, (7) or specific oligonucleotides (probes) with fluorophores, (8) such as 6-carboxyfluorescein (FAM) (9) and 2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein (VIC). (10)
Multiplexing of any PCR expands its detection capability as more than one target gene is simultaneously amplified and detected. (11−14) qPCR multiplexing is often used for the detection of a DNA component with minor content with a background of another more abundant DNA, such as gene mutations with wild types in oncological research and diagnostics. (15,16) The infectious agents in the background of human sequences are often determined in microbiology and virology. (17) The genes of genetically modified organisms are searched in food control. (18) Paternally inherited disease-associated sequences of DNA are investigated in the background of cell-free DNA in the plasma of pregnant females, and they are used in noninvasive prenatal diagnostics. (19,20) The correct quantification of both mixture components by qPCR is complicated once there are large differences in their representation in the mixture.
Probe-based qPCR multiplexing utilizes probes attached to fluorophores with different emission wavelengths. The fluorescent signals are then split and detected using different optical channels. The number of target genes for the concurrent detection is theoretically unlimited as long as there is no emission wavelength overlap between the different probes. However, it is limited by the optical detection system as the increasing number of detectable colors makes the system complicated and costly. Additionally, the design of the probes and primers for each target gene should also be done carefully otherwise the interaction between them inhibits the PCR multiplexing efficiency. Expression analysis using qPCR highly depends on the quantification of all of the simultaneously analyzed targets. It is assumed that qPCR multiplexed amplification does not alter each other’s efficiency. (21,22) The prerequisites for the successful interpretation of duplexed qPCR experiments were extensively studied, which resulted in a generally accepted methodology of 2–ΔΔCt, which is considered as the gold standard for the relative quantification of mixtures. (23)
An intercalating dye-based qPCR multiplexing method simplifies the optical detection system as only one fluorescent channel is required, and there is no need to design different probes. The genes are typically distinguished based on different melting temperatures (TM) during the melting curve analysis (MCA) after temperature cycling. (24,25) However, it is an end-point detection, and primers specific to each target gene must be designed to have a different TM. Alternatively, it can be performed using the continuous fluorescence monitoring (CFM) method allowing monitoring the PCR progress and optimizing it. (26) It also enables to perform dynamic MCA during the transition from the elongation to denaturation step and to construct the PCR amplification curves of two (27) or three genes, (28) or perhaps more. Another CFM-based method was proposed combining the FAM probe with the EvaGreen dye for simultaneous detection as both FAM and EvaGreen share the same emission wavelength, (29) which effectively doubles the PCR throughput. Unfortunately, both of these CFM-based methods are restricted from being further applied as they only allow one experiment at a time and require a customized setup. Recently, a novel single fluorescent channel-based multiplexing method was proposed using intercalating dyes, and the result was processed based on multidimensional standard curves. (30−32) Moreover, the data set was achieved by commercial qPCR instruments, and the absolute quantification was determined, thus extending the use of these devices.
In this work, we performed a comprehensive study of single-channel multiplexing based on the combination of EvaGreen and a FAM probe. We used a commercial qPCR instrument with 96 wells, which allowed us to study multiplexing using robust, statistically significant data sets. We showed the strengths and weaknesses of the proposed method and also compared it with the dual-channel multiplexing method, thereby making this PCR duplexing universal. Although the proposed work is based on the same principle as our previous one, (29) we performed a quantitative study of the method, having statistically significant data set using a commercial thermocycler instead of a home-made system to determine the limit of this method in detail in terms of detectable concentration ratios of both targets. The proposed methodology was more generally applicable for system optimization compared with the previous one, as researchers could perform it using any commercial qPCR instruments. We show fully quantitative duplexing capable to be performed by a conventional thermocycler and thus available to anyone.

2. Principle of the Proposed Multiplexing Method

Click to copy section linkSection link copied!
We assumed that we prepared PCR master mix using a fragment of chromosome 21 (Chr21) specific to a FAM probe with a fixed number of copies (cn21) and a fragment of chromosome 18 (Chr18) with a fixed number of copies (cn18) as the parameter (Figure 1A). We then performed the PCR in the presence of EvaGreen while collecting the fluorescent amplitude (F) at the end of the denaturation as well as the elongation in each PCR cycle (Figure 1B), followed by an MCA (Figure 1C). We split the collected data and formed two amplification curves, the denaturation and elongation curves (Figure 1D). The denaturation curve only consists of the FAM probe as all of the double-stranded DNA molecules melted into single-stranded DNAs, and EvaGreen’s contribution to F is negligible. Changing cn18 has no influence on the denaturation curve. The elongation curves represent EvaGreen intercalated with both Chr21 and Chr18 amplicons in combination with the FAM probe linked to Chr21. Changing cn18 causes the PCR curve shift. The MCA extracted at the end of the PCR proved the presence of both amplicons in the PCR product (Figure 1E).

Figure 1

Figure 1. Principle of the proposed qPCR multiplexing method. (A) We prepared the PCR master mix containing two DNA templates, two sets of relevant forward and reverse primers, a FAM probe specific to one DNA template, and EvaGreen intercalating dye. (B) We performed the PCR and captured the F (green curve) during each cycle at the end of the denaturation and elongation steps, while the red curve represents the heater temperature. Contributions to the F at the denaturation step are only from the FAM probe (inset B1). F at the elongation step consists of both the FAM probe linked to Chr21 as well as the EvaGreen intercalating dye with both targets (inset B2). (C) All of the collected data during the PCR followed by the MCA were split (D) into two sets and plotted separately, which represents the denaturation amplification curve (red) and the elongation amplification curves in gradient colors from dark to light green for different cn18. (E) We also plotted an MCA as well as the negative derivation of F showing the presence of two different amplicons in the PCR master mix.

High Resolution Image
Download MS PowerPoint Slide
The threshold of the denaturation curve (CtD) of the mixture is only determined by the value of cn21 as the only FAM probe presence, and its concentration contributes to the F value at TD (Figure 2A, black line with squares)
(1)
where AD is an offset and BD is a PCR curve slope determined by the reaction efficiency of Chr21.

Figure 2

Figure 2. Determination of the copy numbers of both targets based on calculation. (A) Values of CtD and CtE as a function of cn21 with cn18 as the parameter. The black lines with squares are three denaturation curves overlapping each other that have been calculated using eq 1. The blue curve with downward triangles, the green with upward triangles, and the red with circles are elongation curves calculated by eq 2. Each of them represents different values of cn18. (B) ΔCt values as a function of RSET with cn18 as the parameter that has been extracted from Figure 2A. All three curves overlap, which shows that it is the RSET value determining the ΔCt instead of an absolute value of cn18.

High Resolution Image
Download MS PowerPoint Slide
The threshold of the elongation curve (CtE) is affected by both cn18 and cn21, and we can create a plot of CtE as a function of cn21 with cn18 as the parameter
(2)
where AE is an offset and BE is the overall PCR efficiency (Figure 2A, blue, red, and green lines). Equation 2 can be split into two limiting situations, cn18≫ cn21
(3)
and cn18 ≪ cn21
(4)
where A1 and A2 are the offsets and B1 and B2 are the individual PCR efficiencies of Chr18 and Chr21 amplifications, respectively.
We then extracted the differences from the corresponding Ct values between the elongation and denaturation curves (ΔCt) and plotted them as a function of the ratio between the cn of the amplicon with and without a link to FAM (RSET) with log cn18 as the parameter. Here, it would be RSET = cn18/cn21. It shows that the ΔCt value is a function of RSET independent of the cn absolute values (Figure 2B). The ΔCt can be expressed as
(5)
where A is intercept with the Y-axis and B is a slope, respectively. We can then, with eq 4, simplify the relationship as
(6)
to show its independence on an absolute value of cn21 and cn18 (Figure 2B). Parameter B defines the precision of RSET and thus cn18 determination.
Thus, once we form the PCR standard curve, as shown in Figure 2A, we can determine the cn21 of an unknown sample from the denaturation curve (marked by a black arrow). Then, we calculate the ΔCt value and determine the cn18 based on the extracted RSET values from Figure 2B. Note that the cn18 can only be determined from the left part of the graph starting at the point where both amplicons’ contribution is equal; otherwise, cn21 dominates the change of CtE.

3. Results and Discussion

Click to copy section linkSection link copied!

3.1. Preliminary Experiments

We first performed the PCR and extracted elongation and denaturation standard curves of Chr21 with cn21 from 9.5 × 101 to 9.5 × 106 with and without a FAM probe to determine the Ct shift from the elongation to the denaturation as well as the PCR efficiency for both curves. Each experiment was repeated four times to suppress any random error. Then, the same experiment was conducted using Chr18 from cn18 between 9.26 × 102 and 9.26 × 106 with a VIC probe (Supporting Information, Section S1). We used a VIC specific to Chr18 as a reference to the single-channel multiplexing method. We found that the PCR efficiency was very similar for all combinations, and its value is (−3.46 ± 0.03) N ×(log cn)−1 (mean ± fitting error from four measurements), which demonstrated the correct experiment setting as well as the minimal pipetting error (Supporting Information, Section S1).

3.2. Multiplexing Using the Target cn18 Constant and the cn21 Variable with FAM Specific to Chr21

We then mixed Chr21 with a FAM probe and Chr18 with the ratio RSET with three different cn18 values of 9.26 × 104, 9.26 × 105, and 9.26 × 106 and a cn21 variable (Supporting Information, Section S2). We performed the PCR and extracted the denaturation and elongation standard curves (Figure 3A). The denaturation curves (black, red, and blue line with the squares) were solely determined by cn21, but they were nevertheless influenced by the abundance of Chr18, as exhibited by the curve deviation from the straight line.

Figure 3

Figure 3. Ct values extracted from the PCR with EvaGreen intercalating dye and the FAM probe. (A) PCR standard curves of the variable cn21 values with three different cn18 values as the parameter with the denaturation curves marked with circles and the elongation with squares. The cn21 values could be determined in an entire range from the denaturation standard curves. The arrow pointed to the curved region where minor Chr21 clearly influences Chr18 amplification. The green line marked with triangles was formed by the curve fitting of an average value from all three denaturation curves. (B) Values of ΔCt plotted as a function of RSET showing the importance of the RSET value and not the individual cn21 or cn18. (C) Equivalent of (A) with cn18 as the variable and cn21 as the parameter with elongation curves marked by squares and the denaturation by circles. (D) Equivalent of (B) with cn18 as the variable and cn21 as a parameter.

High Resolution Image
Download MS PowerPoint Slide
The elongation curves (black, blue, and red with circles) show two distinguished regions, one determined by cn18 and the other by cn21, as predicted by eqs 2–6, and their graphical representation is shown in Figure 2A. We performed the curve fitting (green line in Figure 3A) of the average of all three denaturation curves using eq 1 and obtained AD and BD as (36.03 ± 0.56) N and (−2.74 ± 0.11) N ×(log cn21)−1 (both mean ± fitting error), respectively.
The saturation at the elongation curve determined by the cn18 value exhibited a curved shape instead of a flat line parallel to the X-axis (pointed by an arrow in Figure 3A), a clear sign of cn21 influence. With a lower value of cn21, the CtE was also lowered, demonstrating that the influence of Chr21 was diminishing. All of the PCR experiments were accompanied with MCAs, and there was a trend showing the transition from the region dominated by Chr21 to a region dominated by Chr18 with an increased number of amplicons of Chr18, while the product of Chr21 dominated regardless of cn21 (Supporting Information, Section S3).
We then calculated the values of ΔCt and plotted them as a function of RSET (Figure 3B). We found that each amplicon had different contributions to the CtE value as the point of the equal contribution of both the amplicons was not for RSET = 1. We then modified the original elongation curves per eq 2 as
(7)
where the critical ratio (RC) was a coefficient reflecting the different contributions of each amplicon to the CtE value. Then, eq 6 would convert to
(8)
We extracted the slope B from the curves as (−2.40 ± 0.03) N × (log RSET)−1 (mean ± fitting error), thereby defining the sensitivity of RSET determination as well as the RC value of ≈0.07 RSET. The low RC value in comparison with RSET showed strong dominance of Chr21 contribution to the CtE values. As predicted by eq 7, the ΔCt was a function of RSET instead of an absolute number of either cn21 or cn18.
We determined the absolute value of cn21 in the entire range from the denaturation curve (curves in Figure 3A marked with circles) with a precision of (−2.74 ± 0.11) N × (log cn21)−1 (mean ± fitting error). The cn18 value was identified by extracting the RSET value from Figure 3B and multiplying it with cn21.
We found that the precision of the cn18 determination is (−2.40 ± 0.03) N × (log RSET)−1 (mean ± fitting error) for RSET values smaller than RC ≈ 0.07. The lower values of cn18 deviated from the described behavior because the presence of Chr21 probably inhibited the PCR of Chr18, as shown by the MCAs (Supporting Information, Section S3).

3.3. Multiplexing Using a Target cn21 Constant and a cn18 Variable with FAM Specific to Chr18

We repeated the same measurement with a FAM probe specific to Chr18 and Chr21 with cn21 fixed at the three different values with the cn18 variable and plotted the results into Figure 3C (Supporting Information, Section S4). Here, the RSET was cn21/cn18. We performed the curve fitting as it was done in the previous section and found that the transition RC changed from 0.07 to 2.26, which showed the dominance of the Chr21 regardless of the FAM probe specificity. We also calculated the ΔCt and plotted it as a function of RSET (Figure 3D). The results verified our original hypothesis that ΔCt was determined by the value of RSET instead of the absolute values of cn18 and cn21.
The absolute value of cn18 couldbe determined in an entire range from the denaturation curve (curves in Figure 3C marked with squares) with a precision of (−3.38 ± 0.03) N × (log cn21)−1 (mean ± fitting error). The cn21 value could be extracted from Figure 3D using the RSET values and a value of cn18 with a precision of (−3.48 ± 0.26) N × (log RSET)−1 (mean ± fitting error) for the RSET values smaller than RC ≈ 2.26.

3.4. Multiplexing with Target cn21 Having a Chr21-Specific FAM Probe and cn18 with a Chr18-Specific VIC Probe

We performed a PCR using Chr21 and Chr18 specific to FAM and VIC probes, respectively, with either a cn18 constant and a cn21 variable or vice versa (Supporting Information, Section S5).
Each experiment was conducted five times. We then extracted the Ct values using eq 11 and plotted Ct as a function of cn21 from the FAM and VIC channels, as shown in Figure 4A,B, respectively.

Figure 4

Figure 4. Ct values extracted from the PCR with FAM and VIC probes. (A) FAM channel with a cn21 variable with cn18 as the parameter showing the problems with the dual-channel amplification as the standard curves with different values of cn18 should be collinear and form a single line regardless of the cn18 value. (B) Same PCR mixtures using a VIC channel also showed the influence of cn21 on cn18 as the results should be independent of cn21 since it was Chr18 with the VIC probe. (C) Implementation of the 2–ΔΔCt method showing its shortcoming with the noncompensated data for fluorescence spillover. (D–F) Similar results for a mixture with the cn18 value variable and the cn21 as the parameter.

High Resolution Image
Download MS PowerPoint Slide
We calculated the average errors in Ct determination (Table 1), and they were rather small—between 2.4 and 1.5% for the lowest and highest cn18. The determination of the individual Ct values varied much more, especially for the lowest value of cn18 (black line in Figure 4B). We used the 2–ΔΔCt method (23) with the mixture having RSET = 1 as the calibrator. We plotted the extracted 2–ΔΔCt values as a function of RSET (Figure 4C). The results showed that even the widely accepted method of 2–ΔΔCt had a problem with determining R precisely when applied to the data without any compensation for fluorescence spillover. (33)
Table 1. Results from Two Fluorescence Channels Showing Ct Determination Errors
 cnintercept (N)slope (log cn)mean value (N)
cn21 variable
FAM channel 38.60 ± 0.43–3.05 ± 0.08 
VIC channel3.7 × 103  29.03 ± 0.70
 3.7 × 104  26.13 ± 0.33
 3.7 × 105  22.92 ± 0.35
 3.7 × 106  19.55 ± 0.30
cn18 variable
FAM channel3.8 × 103  26.89 ± 0.37
 3.8 × 104  24.16 ± 0.35
 3.8 × 105  20.99 ± 0.42
 3.8 × 106  17.22 ± 0.16
VIC channel 39.59 ± 0.39–3.07 ± 0.07 
We repeated the same experiment with the cn18 variable and cn21 as the parameter and extracted the results in the same fashion as for the first experiment (Figure 4D–F), and the extracted data and errors were shown in Table 1.

3.5. Comparison of the Single-Channel Duplexing Method with the Method Employing Two Probes with Different Fluorophores

We performed the single-channel duplexing qPCR method using Chr21 with a FAM-specific probe and Chr18 both in the presence of EvaGreen intercalating dye. We also alternated the mixture composition having a FAM-specific probe to the Chr18 sequence instead of Chr21. We found that we could determine the value of the cn of the amplicon with the FAM probe in the entire range of the values. The second amplicon, cn, could only be determined once the RSET value was smaller than the RC, which could vary for each individual pair of targets. In comparison, we performed standard multiplexing using FAM and VIC probes. The multichannel technique exhibited large error especially for the lower values of cns, where the Ct value varied in a range between 27 and 30 (black line in Figure 4B). We then processed the extracted data using the 2–ΔΔCt method (23) without performing channel overspilling compensation. It showed that even these widely accepted methods did not produce precise data (Figure 4C,F). Single-channel multiplexing produced more precise data, but it could determine both amplicons only for RSET < RC in half of the total range of cn.

4. Conclusions

Click to copy section linkSection link copied!
We proposed and verified a method of quantitative polymerase chain reaction (qPCR) duplexing using a single fluorescein isothiocyanate (FITC) fluorescent channel with a commercially available qPCR system with a 96-well platform. We amplified the following two sequences: one from chromosome 21 (Chr21) and one from chromosome 18 (Chr18) in the presence of the EvaGreen intercalating dye. We added a 6-carboxyfluorescein (FAM) probe specific to either Chr21 or to Chr18 and extracted the PCR curves after the denaturation and elongation steps, and then, we plotted the PCR standard curves, one for denaturation and the second one for elongation. We were able to determine the copy number (cn) of an amplicon with a FAM-specific probe in the entire range of the cn values from the denaturation standard curve with precision values of (−2.74 ± 0.11) N × (log cn21)−1 and (−3.38 ± 0.03) N × (log cn18)−1 (both mean ± fitting error) for Chr21 and Chr18, respectively.
The cn value of the other amplicon was extracted from the difference of the critical thresholds between the denaturation and elongation curves with precision values of (−2.40 ± 0.03) N × (log RSET)−1 and (−3.48 ± 0.26) N × (log RSET)−1 (both mean ± fitting error) for Chr21 and Chr18, respectively.
This proposed method has better precision than the standard technique of working with differently labeled probes, which eliminates the problem of overspilling between fluorescent channels. However, this method is not capable of operating in the entire range of possible ratios of mixture components as the RSET value has to be greater than the RC to determine the cn of the target without the FAM probe. Nevertheless, if the determination of the value with RSET < RC is required, it is possible to change the system and use a FAM probe that is specific to the second target. The combination of the probe-based and intercalating dye-based methods brings the potential drawbacks of both such as the high cost for probe-based qPCR and the low specificity for intercalating dye-based qPCR. However, it is not necessary to have two expensive probes and a complex fluorescence system; thus, the proposed method can lower the cost as only one probe is applied. Additionally, it eliminates the fluorescence overspilling, which exists in probe-based qPCR multiplexing. Moreover, the melting curve analysis conducted immediately once the thermal cycling is completed will determine the amplicon specificity.
This proposed duplexing method using a single FITC fluorescent channel can be implemented for a wide variety of examinations where mixture analysis is desired once either multifluorescence channel is not a viable option or to lower the test cost. This qPCR duplexing thus opens new horizons for practical applications, providing an original, easily applicable technical solution.

5. Material and Methods

Click to copy section linkSection link copied!

5.1. DNA Sequences and PCR Master Mix

We used the synthesized target fragments of Chr21 and Chr18 as well as primers and probes for both, as shown in Table 2. The chosen amplicons, designed primers, and the lock nucleic acids (LNA) probes were used beforehand for the noninvasive prenatal diagnostics using dPCR, and they were optimized to perform in multiplex reactions. (34) We then prepared different types of PCR master mixes based on the following designed experiments by adjusting the volume of probes for both targets (Supporting Information, Section S6). The final volume of the PCR master mix was ≈10 μL by adding sterilized deionized H2O.
Table 2. Information of Target Sequences and the Corresponding Primers and Probes
target genegene locationaprimer typeprimer sequence (5′–3′)amplicon size (bp)amplicon TM (°C)
Chr2114099141-14099218forwardctaggagactgtccctgagctt7883.5
 reverseagggggaacatagaggcttg
 LNA probeFAM-ccctgcctct-BHQ1
Chr181248496-1248575forwardccatctccataacccaaatacc8080.4
 reverseccttgcaaacctcatgttga
 LNA probeVIC-cccacctcca-BHQ1
FAM-cccacctcca-BHQ1
a

Gene location according to the human genome assembly version hg19/Genome Reference Consortium Human Build 37.

5.2. qPCR Protocol

We performed the qPCR with the protocol set in the following way: a hot start at 95 °C for 30 s to activate the polymerase followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 52 °C for 30 s, and elongation at 72 °C for 10 s using a commercial 96-well real-time PCR system collecting two F values during each PCR cycle at the end of the elongation and denaturation steps. We then conducted an MCA from 65 to 95 °C with a ramping rate set to 0.5 K•s–1.

5.3. Data Processing

The collected data were processed using a MATLAB script by first splitting them into two blocks. The first 80 points contained the PCR amplification curves, and the rest represented the MCA. During each cycle, we collected two data points corresponding to the two adjacent sample points, F values were collected at the end of the denaturation and elongation steps. Then, we split the amplification curve data according to their sequence. The data whose serial number was odd (even) were selected to form the denaturation (elongation) amplification curve. The elongation curve was the same as the conventional PCR amplification curve. The denaturation curve was different since the PCR cycle started with denaturation and ends with elongation. We skipped the first point of the denaturation curve as it had no meaning since no PCR amplification had occurred by that point in time. As a result, the denaturation curve had only 39 points, while the elongation had typical 40 points resulting from 40 cycles. After that, the amplification curves were processed independently.

5.4. Data Normalization

We normalized the amplification curves according to the following formula
(9)
where FN is the normalized F amplitude value and Fmax is the maximal amplitude value of the F data. Fmin is manually selected for each curve due to the unpredictable fluctuation in the F value of the first few data. If the variation range (Fmax – Fmin) of a curve is judged to be lower than 50 000 arbitrary units (a.u.), this curve is regarded as a nonamplification curve, and the FN value is set to 0 a.u.

5.5. Ct Value Extraction

We performed the curve fitting using a Boltzmann function similar to the methods published earlier (35,36)
(10)
where FN(i) is the normalized amplitude of the F value of cycle number i, i0 is an inflexion point of the Boltzmann curve, and dF determines the Boltzmann curve slope at F(i0) by . In previous work, (36) the author defined Ct as a value of N at a fluorescence inflection point. Here, we calculated the Ct value as an N value for a 10% increase of the F value above its baseline
(11)
This method is similar to the one conventionally used for calculating the Ct defining the Ct value as a cycle number for 10% of F increased above the baseline. The Boltzmann function-based Ct value determination was then implemented using the MATLAB script.

Supporting Information

Click to copy section linkSection link copied!

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.1c02971.

  • Standard curves of single genes, amplicon ratios of Chr21 and Chr18 with Chr21 variable, MCAs between Chr21 with the FAM probe and Chr18 having cn18 with three different values and cn21 variable, amplicon ratios of Chr21 and Chr18 with Chr18 variable and MCA after PCR, amplicon ratios of Chr21 and Chr18, and PCR master mix (PDF)

Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Author Information

Click to copy section linkSection link copied!
  • Corresponding Author
    • Pavel Neuzil - School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China;  Central European Institute of Technology, Brno University of Technology, Purkyňova 123, 612 00 Brno, Czech Republic;  School of Electrical Engineering and Computer Technology, Brno University of Technology, Technická 10, 612 00 Brno, Czech Republic;  Orcidhttps://orcid.org/0000-0001-9040-281X;  Email: [email protected]
  • Authors
    • Haoqing Zhang - School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    • Zhiqiang Yan - School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    • Xinlu Wang - School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China
    • Martina Gaňová - Central European Institute of Technology, Brno University of Technology, Purkyňova 123, 612 00 Brno, Czech Republic
    • Honglong Chang - School of Mechanical Engineering, Department of Microsystem Engineering, Northwestern Polytechnical University, 127 West Youyi Road, Xi’an, Shaanxi 710072, P. R. China;  Orcidhttps://orcid.org/0000-0003-0400-3658
    • Soňa Laššáková - Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University and General University Hospital in Prague, Albertov 4, 128 00 Prague, Czech Republic
    • Marie Korabecna - Institute of Biology and Medical Genetics, First Faculty of Medicine, Charles University and General University Hospital in Prague, Albertov 4, 128 00 Prague, Czech Republic
  • Notes
    The authors declare no competing financial interest.

Acknowledgments

Click to copy section linkSection link copied!

H.Z., Z.Y., X.W., and P.N. were supported by the Ministry of Science and Technology of the P.R. China [grant no. 2018YFE0109000]. M.K. and S.L. were supported by the Ministry of Education, Youth, and Sports of the Czech Republic [grant no. LTACH19005] and by a grant from the Ministry of Health of the Czech Republic [grant no. RVO-VFN 64165].

References

Click to copy section linkSection link copied!

This article references 36 other publications.

  1. 1
    Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 1986, 263– 273,  DOI: 10.1101/sqb.1986.051.01.032
    Google Scholar
    1
    Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction
    Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H.
    Cold Spring Harbor Symposia on Quantitative Biology (1986), 51 (Mol. Biol. Homo sapiens, Pt. 1), 263-73CODEN: CSHSAZ; ISSN:0091-7451.
    An in vitro method for prepn. of multiple copies of DNA from a single copy of DNA is described. The initial DNA mol. was sepd. into 2 single-stranded mols. by denaturation at 95°. After cooling to 30°, DNA polymerase and short primer DNA were added, resulting in the formation of 2 copies of the initial DNA mol. This process was repeated 20-27 times for the prodn. of large no. of copies of the initial DNA. Theor., each cycle of this process doubles the no. of copies. This process is termed polymerase chain reaction.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaL2sXkslajtb0%253D&md5=6e43c4cd0c2eac04871c405adb57c846
  2. 2
    Zhu, H.; Zhang, H.; Xu, Y.; Laššáková, S.; Korabečná, M.; Neužil, P. PCR past, present and future. BioTechniques 2020, 69, 317– 325,  DOI: 10.2144/btn-2020-0057
    Google Scholar
    2
    PCR past, present and future
    Zhu, Hanliang; Zhang, Haoqing; Xu, Ying; Lassakova, Sona; Korabecna, Marie; Neuzil, Pavel
    BioTechniques (2020), 69 (4), 317-325CODEN: BTNQDO; ISSN:1940-9818. (Future Science Ltd.)
    A review. PCR has become one of the most valuable techniques currently used in bioscience, diagnostics and forensic science. Here we review the history of PCR development and the technologies that have evolved from the original PCR method. Currently, there are two main areas of PCR utilization in bioscience: high-throughput PCR systems and microfluidics-based PCR devices for point-of-care (POC) applications. We also discuss the commercialization of these techniques and conclude with a look into their modifications and use in innovative areas of biomedicine. For example, real-time reverse transcription PCR is the gold std. for SARS-CoV-2 diagnoses. It could also be used for POC applications, being a key component of the sample-to-answer system.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitVynsb%252FK&md5=c61d65d43e851fb138b78a5433edff05
  3. 3
    Shu, B.; Zhang, C.; Xing, D. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection. Anal. Chim. Acta 2014, 826, 51– 60,  DOI: 10.1016/j.aca.2014.04.017
    Google Scholar
    3
    Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection
    Shu, Bowen; Zhang, Chunsun; Xing, Da
    Analytica Chimica Acta (2014), 826 (), 51-60CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixt. is driven to pass three temp. zones, thus providing a rapid anal. throughput of m × n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temps., flow rates, polymerase concn. and amt. of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19 min, and the limit of detection was low, down to 102 copies μL-1. As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4 × 3 with no detectable cross-contamination.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmslamsbo%253D&md5=ca76aa8f47cd18c866f8c1f6d30b772e
  4. 4
    Kubista, M.; Andrade, J. M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L.; Ståhlberg, A.; Zoric, N. The real-time polymerase chain reaction. Mol. Aspects Med. 2006, 27, 95– 125,  DOI: 10.1016/j.mam.2005.12.007
    Google Scholar
    4
    The real-time polymerase chain reaction
    Kubista, Mikael; Andrade, Jose Manuel; Bengtsson, Martin; Forootan, Amin; Jonak, Jiri; Lind, Kristina; Sindelka, Radek; Sjoeback, Robert; Sjoegreen, Bjoern; Stroembom, Linda; Stahlberg, Anders; Zoric, Neven
    Molecular Aspects of Medicine (2006), 27 (2-3), 95-125CODEN: MAMED5; ISSN:0098-2997. (Elsevier B.V.)
    A review. The scientific, medical, and diagnostic communities have been presented the most powerful tool for quant. nucleic acids anal.: real-time PCR [Bustin, S.A., 2004. A-Z of Quant. PCR. IUL Press, San Diego, CA]. This new technique is a refinement of the original Polymerase Chain Reaction (PCR) developed by Kary Mullis and coworkers in the mid-80s, for which Kary Mullis was awarded the 1993 Nobel prize in Chem. By PCR essentially any nucleic acid sequence present in a complex sample can be amplified in a cyclic process to generate a large no. of identical copies that can readily be analyzed. This made it possible, for example, to manipulate DNA for cloning purposes, genetic engineering, and sequencing. But as an anal. technique the original PCR method had some serious limitations. By first amplifying the DNA sequence and then analyzing the product, quantification was exceedingly difficult since the PCR gave rise to essentially the same amt. of product independently of the initial amt. of DNA template mols. that were present. This limitation was resolved in 1992 by the development of real-time PCR by Higuchi et al. In real-time PCR the amt. of product formed is monitored during the course of the reaction by monitoring the fluorescence of dyes or probes introduced into the reaction that is proportional to the amt. of product formed, and the no. of amplification cycles required to obtain a particular amt. of DNA mols. is registered. Assuming a certain amplification efficiency, which typically is close to a doubling of the no. of mols. per amplification cycle, it is possible to calc. the no. of DNA mols. of the amplified sequence that were initially present in the sample. With the highly efficient detection chemistries, sensitive instrumentation, and optimized assays that are available today the no. of DNA mols. of a particular sequence in a complex sample can be detd. with unprecedented accuracy and sensitivity sufficient to detect a single mol. Typical uses of real-time PCR include pathogen detection, gene expression anal., single nucleotide polymorphism (SNP) anal., anal. of chromosome aberrations, and most recently also protein detection by real-time immuno PCR.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XisF2gsL4%253D&md5=2d3f419baac9c7342f91f8c898f5f33a
  5. 5
    Vogelstein, B.; Kinzler, K. W. Digital PCR. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 9236– 9241,  DOI: 10.1073/pnas.96.16.9236
    Google Scholar
    5
    Digital PCR
    Vogelstein, Bert; Kinzler, Kenneth W.
    Proceedings of the National Academy of Sciences of the United States of America (1999), 96 (16), 9236-9241CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
    The identification of predefined mutations expected to be present in a minor fraction of a cell population is important for a variety of basic research and clin. applications. Here, we describe an approach for transforming the exponential, analog nature of the PCR into a linear, digital signal suitable for this purpose. Single mols. are isolated by diln. and individually amplified by PCR; each product is then analyzed sep. for the presence of mutations by using fluorescent probes. The feasibility of the approach is demonstrated through the detection of a mutant ras oncogene in the stool of patients with colorectal cancer. The process provides a reliable and quant. measure of the proportion of variant sequences within a DNA sample.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK1MXltVequrY%253D&md5=f6373991690687dc4d930389cba7cf05
  6. 6
    Zhu, H.; Fohlerová, Z.; Pekárek, J.; Basova, E.; Neužil, P. Recent advances in lab-on-a-chip technologies for viral diagnosis. Biosens. Bioelectron. 2020, 153, 112041  DOI: 10.1016/j.bios.2020.112041
    Google Scholar
    6
    Recent advances in lab-on-a-chip technologies for viral diagnosis
    Zhu, Hanliang; Fohlerova, Zdenka; Pekarek, Jan; Basova, Evgenia; Neuzil, Pavel
    Biosensors & Bioelectronics (2020), 153 (), 112041CODEN: BBIOE4; ISSN:0956-5663. (Elsevier B.V.)
    A review. The global risk of viral disease outbreaks emphasizes the need for rapid, accurate, and sensitive detection techniques to speed up diagnostics allowing early intervention. An emerging field of microfluidics also known as the lab-on-a-chip (LOC) or micro total anal. system includes a wide range of diagnostic devices. This review briefly covers both conventional and microfluidics-based techniques for rapid viral detection. We first describe conventional detection methods such as cell culturing, immunofluorescence or ELISA (ELISA), or reverse transcription polymerase chain reaction (RT-PCR). These methods often have limited speed, sensitivity, or specificity and are performed with typically bulky equipment. Here, we discuss some of the LOC technologies that can overcome these demerits, highlighting the latest advances in LOC devices for viral disease diagnosis. We also discuss the fabrication of LOC systems to produce devices for performing either individual steps or virus detection in samples with the sample to answer method. The complete system consists of sample prepn., and ELISA and RT-PCR for viral-antibody and nucleic acid detection, resp. Finally, we formulate our opinions on these areas for the future development of LOC systems for viral diagnostics.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitFeltLo%253D&md5=2a1c17dbb24f81c67ae80791ed3efa94
  7. 7
    Shoute, L. C.; Loppnow, G. R. Characterization of the binding interactions between EvaGreen dye and dsDNA. Phys. Chem. Chem. Phys. 2018, 20, 4772– 4780,  DOI: 10.1039/C7CP06058K
    Google Scholar
    7
    Characterization of the binding interactions between EvaGreen dye and dsDNA
    Shoute, L. C. T.; Loppnow, G. R.
    Physical Chemistry Chemical Physics (2018), 20 (7), 4772-4780CODEN: PPCPFQ; ISSN:1463-9076. (Royal Society of Chemistry)
    Understanding the double-stranded (ds)DNA·EvaGreen (EG) binding interaction is important because the EG dye is increasingly used in the real-time quant. polymerase chain reaction, high-resoln. melting anal., and routine quantification of DNA. Here, a binding isotherm for the interactions of EG with dsDNA (poly-dA17·poly-dT17) was detd. from the absorption and fluorescence spectra of EG and the dsDNA·EG complex. The isotherm had a sigmoidal shape and could be modeled with the Hill equation, indicating pos. cooperativity for the binding interaction. A Scatchard plot of the binding data yielded a concave-down curve in agreement with the Hill anal. of the binding isotherm for a pos. cooperative binding interaction. Anal. of the Scatchard plot with the modified McGhee and von Hippel model for a finite one-dimensional homogeneous lattice and nonspecific binding of ligands to dsDNA yielded the intrinsic binding const., the no. of lattice sites occluded by a bound ligand, and the cooperativity parameter of 3.6 × 105 M-1, 4.0, and 8.1, resp. The occluded site size of 4 indicated that moieties of the EG intercalated into the adjacent base pairs of the dsDNA with a gap of one intercalation site between EG binding sites, as expected for a bifunctional mol. Interestingly, at high [EG]/[base pair] values, the intercalation was disrupted. A model was proposed based on the fluorescence spectrum where the formation of anti-parallel stacked chains of EGs bound externally to the dsDNA occur at these high ratios.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhs1OlurY%253D&md5=b2652b6a7cf4d049ecf2bc8cc813b04b
  8. 8
    Lehmusvuori, A.; Karhunen, U.; Tapio, A.-H.; Lamminmäki, U.; Soukka, T. High-performance closed-tube PCR based on switchable luminescence probes. Anal. Chim. Acta 2012, 731, 88– 92,  DOI: 10.1016/j.aca.2012.04.027
    Google Scholar
    8
    High-performance closed-tube PCR based on switchable luminescence probes
    Lehmusvuori, Ari; Karhunen, Ulla; Tapio, Antti-Heikki; Lamminmaki, Urpo; Soukka, Tero
    Analytica Chimica Acta (2012), 731 (), 88-92CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
    We introduce a switchable lanthanide luminescence reporter technol. based closed-tube PCR for the detection of specific target DNA sequence. In the switchable lanthanide chelate complementation based reporter technol. hybridization of two nonfluorescent oligonucleotide probes to the adjacent positions of the complementary strand leads to the formation of a highly fluorescent lanthanide chelate complex. The complex is self-assembled from a nonfluorescent lanthanide chelate and a light-harvesting antenna ligand when the reporter mols. are brought into close proximity by the oligonucleotide probes. Outstanding signal-to-background discrimination in real-time PCR assay was achieved due to the very low background fluorescence level and high specific signal generation. High sensitivity of the reporter technol. allows the detection of a lower concn. of amplified DNA in the real-time PCR, resulting in detection of the target at the earlier amplification cycle compared to commonly used methods.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XntVSrsrc%253D&md5=30182c4b484c53cb6abdc9f288b0b36c
  9. 9
    Zimmermann, B.; Holzgreve, W.; Wenzel, F.; Hahn, S. Novel real-time quantitative PCR test for trisomy 21. Clin. Chem. 2002, 48, 362– 363,  DOI: 10.1093/clinchem/48.2.362
    Google Scholar
    9
    Novel real-time quantitative PCR test for trisomy 21
    Zimmermann, Bernhard; Holzgreve, Wolfgang; Wenzel, Friedel; Hahn, Sinuhe
    Clinical Chemistry (Washington, DC, United States) (2002), 48 (2), 362-363CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)
    A novel real-time polymerase chain reaction (PCR) assay was developed for the detection of trisomy 21 that is readily open to automation and high-throughput screening. A multiplex real-time PCR assay was utilized in which amplification of both loci was simultaneously monitored in the same reaction vessel. DNA extd. from amniocyte cultures obtained from 10 trisomy 21 fetuses was examd. The ratio of the two loci, as detd. by the difference in threshold cycle value, distinguished trisomy 21 from karyotypically normal tissue. The ploidy of 9 of 11 cases with normal karyotype was correctly detd. using the novel real-time PCR. This technol. could be easily applied to evaluate the most common fetal aneuploidies. Because real-time PCR allows the anal. of numerous samples in an automated manner, it could be more suited to do this task than current mol. or cellular cytogenic methods because these are significantly more time- and labor-intensive. The real-time PCR assay is also comparable with a fluorescent PCR-based approach or fluorescence in situ hybridization anal. regarding speed and price.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XhtVyhsrc%253D&md5=208b77197c6c035fef1552a037c575e5
  10. 10
    Farzan, V. M.; Kvach, M. V.; Aparin, I. O.; Kireev, D. E.; Prikazchikova, T. A.; Ustinov, A. V.; Shmanai, V. V.; Shipulin, G. A.; Korshun, V. A.; Zatsepin, T. S. Novel homo Yin-Yang probes improve sensitivity in RT-qPCR detection of low copy HIV RNA. Talanta 2019, 194, 226– 232,  DOI: 10.1016/j.talanta.2018.10.043
    Google Scholar
    10
    Novel homo Yin-Yang probes improve sensitivity in RT-qPCR detection of low copy HIV RNA
    Farzan, Valentina M.; Kvach, Maksim V.; Aparin, Ilya O.; Kireev, Dmitry E.; Prikazchikova, Tatiana A.; Ustinov, Alexey V.; Shmanai, Vadim V.; Shipulin, German A.; Korshun, Vladimir A.; Zatsepin, Timofei S.
    Talanta (2019), 194 (), 226-232CODEN: TLNTA2; ISSN:0039-9140. (Elsevier B.V.)
    Nucleic acids labeled with a fluorophore/quencher pair are widely used as probes in biomedical research and mol. diagnostics. Here we synthesized novel DNA mol. beacons double labeled with the identical dyes (R6G, ROX and Cy5) at 5'- and 3'-end and studied their photo phys. properties. We demonstrated that fluorescence quenching by formation of the homo dimer exciton in such mol. beacons allows using them in homogeneous assays. Further, we developed and evaluated homo Yin-Yang DNA probes labeled with identical dyes and used them for detection of low copy HIV RNA by RT-qPCR. They demonstrated improved sensitivity (LLQ: 10 vs 30 copies mL-1) in comparison to com. available Abbott RealTime HIV-1 kit based on VIC-BHQ dyes both for model mixts. (naive human plasma with added deactivated HIV-1 virus) and for preliminarily confirmed 36 clin. samples (4 vs 1 pos. ones for low-copy samples).
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVWqs7nM&md5=7a790bd59559476c2ff08a4142f024bd
  11. 11
    Chamberlain, J. S.; Gibbs, R. A.; Rainer, J. E.; Nguyen, P. N.; Thomas, C. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 1988, 16, 11141– 11156,  DOI: 10.1093/nar/16.23.11141
    Google Scholar
    11
    Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification
    Chamberlain, Jeffrey S.; Gibbs, Richard A.; Ranier, Joel E.; Nguyen Phi Nga; Caskey, C. Thomas
    Nucleic Acids Research (1988), 16 (23), 11141-56CODEN: NARHAD; ISSN:0305-1048.
    The isolation and DNA sequence of several deletion prone exons from the human Duchenne muscular dystrophy (DMD) gene are reported. A rapid method capable of detecting the majority of deletions in the DMD gene is also described. This procedure utilizes simultaneous genomic DNA amplification of multiple widely sepd. sequences and should permit deletion scanning at any hemizygous locus. The application of this multiplex reaction for prenatal and postnatal diagnosis of DMD is demonstrated.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaL1MXht12rt7Y%253D&md5=442224240f4de3f6f66fb902f371e862
  12. 12
    Gaňová, M.; Zhang, H.; Zhu, H.; Korabečná, M.; Neužil, P. Multiplexed digital polymerase chain reaction as a powerful diagnostic tool. Biosens. Bioelectron. 2021, 181, 113155  DOI: 10.1016/j.bios.2021.113155
    Google Scholar
    12
    Multiplexed digital polymerase chain reaction as a powerful diagnostic tool
    Ganova, Martina; Zhang, Haoqing; Zhu, Hanliang; Korabecna, Marie; Neuzil, Pavel
    Biosensors & Bioelectronics (2021), 181 (), 113155CODEN: BBIOE4; ISSN:0956-5663. (Elsevier B.V.)
    A review. The digital polymerase chain reaction (dPCR) multiplexing method can simultaneously detect and quantify closely related DNA sequences in complex mixts. The dPCR concept is continuously improved by the development of microfluidics and micro- and nanofabrication, and different complex techniques are introduced. In this review, we introduce dPCR techniques based on sample compartmentalization, droplet- and chip-based systems, and their combinations. We then discuss dPCR multiplexing methods in both lab. research settings and advanced or routine clin. applications. We focus on their strengths and weaknesses with regard to the character of biol. samples and to the required precision of such anal., as well as showing recently published work based on those methods. Finally, we envisage possible future achievements in this field.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3MXmvVOqsL0%253D&md5=8d5250cd91445c05bcaee99b3ba2ba47
  13. 13
    DuVall, J. A.; Le Roux, D.; Thompson, B. L.; Birch, C.; Nelson, D. A.; Li, J.; Mills, D. L.; Tsuei, A.-c.; Ensenberger, M. G.; Sprecher, C.; Storts, D. R.; Root, B. E.; Landers, J. P. Rapid multiplex DNA amplification on an inexpensive microdevice for human identification via short tandem repeat analysis. Anal. Chim. Acta 2017, 980, 41– 49,  DOI: 10.1016/j.aca.2017.04.051
    Google Scholar
    13
    Rapid multiplex DNA amplification on an inexpensive microdevice for human identification via short tandem repeat analysis
    DuVall, Jacquelyn A.; Le Roux, Delphine; Thompson, Brandon L.; Birch, Christopher; Nelson, Daniel A.; Li, Jingyi; Mills, Daniel L.; Tsuei, An-chi; Ensenberger, Martin G.; Sprecher, Cindy; Storts, Douglas R.; Root, Brian E.; Landers, James P.
    Analytica Chimica Acta (2017), 980 (), 41-49CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
    Forensic DNA anal. requires several steps, including DNA extn., PCR amplification, and sepn. of PCR fragments. Intuitively, there are numerous situations where it would be beneficial to speed up the overall DNA anal. process; the authors focus on the most time-consuming component in the anal. pipeline, namely the polymerase chain reaction (PCR). Primers were specially designed to target 10 human genomic loci, all yielding amplicons shorter than 350 bases, for ease of downstream integration with on-board microchip electrophoresis. Primer concns. were adjusted specifically for microdevice amplification, resulting in well-balanced short tandem repeat (STR) profiles. Furthermore, studies were performed to push the limits of the DNA polymerase to achieve rapid, multiplexed PCR on various substrates, including transparent and black polyethylene terephthalate (Pe), and with two distinct adhesives, toner and heat sensitive adhesive (HSA). Rapid STR-based multiplexed PCR amplification is demonstrated in 15 min on a Pe microdevice using a custom-built system for fluid flow control and thermocycling for the full 10-plex, and in 10 min for a smaller multiplex consisting of six core CODIS loci plus Amelogenin with amplicons shorter than 200bp. Lastly, preliminary studies indicate the capability of this PCR microdevice platform to be integrated with both upstream DNA extn., and downstream microchip electrophoresis. This, coupled to the use of reagents that are compatible with lyophilization (lyo-compatible) for PCR, represents the potential for a fully integrated rotationally-driven microdevice for complete forensic DNA anal.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXot1Wls7g%253D&md5=b90b889f96fd11679b3d2d88b343bb66
  14. 14
    Li, Y.; Li, Y.; Zheng, B.; Qu, L.; Li, C. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization. Anal. Chim. Acta 2009, 643, 100– 107,  DOI: 10.1016/j.aca.2009.04.006
    Google Scholar
    14
    Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization
    Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can
    Analytica Chimica Acta (2009), 643 (1-2), 100-107CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
    A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous anal. of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the sepn. conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 × 102 CFU mL-1 of Vibrio parahemolyticus, 2.9 × 102 CFU mL-1 of Salmonella, 8.7 × 101 CFU mL-1 of E. coli O157:H7 and 5.2 × 101 CFU mL-1 of Shigella, resp. The relative std. deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resoln. and less anal. time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmtVeksLY%253D&md5=cc1d4288a53db5ffcba2d964b0f5964e
  15. 15
    Arnold, L.; Alexiadis, V.; watanaskul, T.; Zarrabi, V.; Poole, J.; Singh, V. Clinical validation of qPCR Target Selector assays using highly specific switch-blockers for rare mutation detection. J. Clin. Pathol. 2020, 73, 648– 655,  DOI: 10.1136/jclinpath-2019-206381
    Google Scholar
    15
    Clinical validation of qPCR Target Selector assays using highly specific switch-blockers for rare mutation detection
    Arnold, Lyle; Alexiadis, Vassilios; watanaskul, Tim; Zarrabi, Vahid; Poole, Jason; Singh, Veena
    Journal of Clinical Pathology (2020), 73 (10), 648-655CODEN: JCPAAK; ISSN:0021-9746. (BMJ)
    Aims The identification of actionable DNA mutations assocd. with a patient's tumor is crit. for devising a targeted, personalised cancer treatment strategy. However, these mol. analyses are typically performed using tissue obtained via biopsy, which involves substantial risk and is often not feasible. In addn., biopsied tissue does not always reflect tumor heterogeneity, and sequential biopsies to track disease progression (eg, emergence of drug resistance mutations) are not well tolerated. To overcome these and other biopsy-assocd. limitations, we have developed non-invasive 'liq. biopsy' technologies to enable the mol. characterization of a patient's cancer using peripheral blood samples. Methods The Target Selector ctDNA platform uses a real-time PCR-based approach, coupled with DNA sequencing, to identify cancer-assocd. genetic mutations within circulating tumor DNA. This is accomplished via a patented blocking approach suppressing wild-type DNA amplification, while allowing specific amplification of mutant alleles. Results To promote the clin. uptake of liq. biopsy technologies, it is first crit. to demonstrate concordance between results obtained via liq. and traditional biopsy procedures. Here, we focused on three genes frequently mutated in cancer: EGFR (Del19, L858, and T790), BRAF (V600) and KRAS (G12/G13). For each Target Selector assay, we demonstrated extremely high accuracy, sensitivity and specificity compared with results obtained from tissue biopsies. Overall, we found between 93% and 96% concordance to blinded tissue samples across 127 clin. assays. Conclusions The switch-blocker technol. reported here offers a highly effective method for non-invasively detg. the mol. signatures of patients with cancer.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitF2rur3N&md5=1ee406d8c2f7a96d3221c8eea1508fd0
  16. 16
    Emaus, M. N.; Anderson, J. L. Allelic discrimination between circulating tumor DNA fragments enabled by a multiplex-qPCR assay containing DNA-enriched magnetic ionic liquids. Anal. Chim. Acta 2020, 1124, 184– 193,  DOI: 10.1016/j.aca.2020.04.078
    Google Scholar
    16
    Allelic discrimination between circulating tumor DNA fragments enabled by a multiplex-qPCR assay containing DNA-enriched magnetic ionic liquids
    Emaus, Miranda N.; Anderson, Jared L.
    Analytica Chimica Acta (2020), 1124 (), 184-193CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
    Multiplex amplification of DNA can be highly valuable in circulating tumor DNA (ctDNA) anal. due to the sheer no. of potential mutations. However, com. ctDNA extn. methods struggle to preconc. low concns. of DNA and require multiple sample handling steps. Recently, magnetic ionic liqs. (MILs) have been used to ext. DNA and were integrated with a quant. polymerase chain reaction (qPCR). However, in previous studies, DNA could not be preconcd. from plasma and only one fragment could be amplified per reaction. MILs were used as DNA extn. solvents and directly integrated into a multiplex-qPCR buffer to simultaneously amplify wild-type KRAS, G12S KRAS, and wild-type BRAF, three clin.-relevant genes whose mutation status can affect the success of anti-EGFR therapy. DNA was desorbed from the MIL solvent during a multiplex-PCR without having a significant effect on the amplification efficiency, and allelic discrimination of single-nucleotide polymorphisms could still be achieved. Enrichment factors over 35 for all three sequences were achieved from Tris buffer using the [N8+,8,8,Bz][Ni(hfacac)-3] and [P6+,6,6,14][Ni(Phtfacac)-3] MILs. DNA could still be preconcd. from 2-fold dild. human plasma using the [N8+,8,8,Bz][Ni(hfacac)-3] MIL. Extns. from undiluted plasma were reproducible with the [P6+,6,6,14][Ni(Phtfacac)-3] MIL although DNA was not preconcd. with enrichment factors around 0.6 for all three fragments. Compared to com. DNA extn. methods (i.e., silica-based spin columns and magnetic beads), the MIL-based extn. achieved higher enrichment factors in Tris buffer and plasma. The ability of the MIL-based dispersive liq.-liq. microextn. (DLLME) direct-multiplex-qPCR method to simultaneously achieve high enrichment factors of multiple DNA fragments from human plasma is highly promising in the field of ctDNA detection.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpsl2jsb0%253D&md5=54000a1bde1f90aa7f49fab874152352
  17. 17
    Muenchhoff, M.; Mairhofer, H.; Nitschko, H.; Grzimek-Koschewa, N.; Hoffmann, D.; Berger, A.; Rabenau, H.; Widera, M.; Ackermann, N.; Konrad, R. Multicentre comparison of quantitative PCR-based assays to detect SARS-CoV-2, Germany, March 2020. Eurosurveillance 2020, 25, 2001057  DOI: 10.2807/1560-7917.ES.2020.25.24.2001057
    Google Scholar
    There is no corresponding record for this reference.
  18. 18
    Cottenet, G.; Blancpain, C.; Sonnard, V.; Chuah, P. F. Two FAST multiplex real-time PCR reactions to assess the presence of genetically modified organisms in food. Food Chem. 2019, 274, 760– 765,  DOI: 10.1016/j.foodchem.2018.09.050
    Google Scholar
    18
    Two FAST multiplex real-time PCR reactions to assess the presence of genetically modified organisms in food
    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Veronique; Chuah, Poh Fong
    Food Chemistry (2019), 274 (), 760-765CODEN: FOCHDJ; ISSN:0308-8146. (Elsevier Ltd.)
    Methods to detect the presence of genetically modified organisms (GMOs) are evolving constantly to comply with legislation and include new transgenic traits developed by biotechnol. companies. Since traditional screening methods target only a limited no. of markers, not all GM-events can be detected easily. To cover a broader range, a new GMO screening method was developed, based on two real-time PCR reactions, targeting. (i) six major GM-markers and. (ii) six GM-events that do not contain these markers. This method used the FAST PCR technol. and allowed a further redn. in time-to-result. Using a wide array of ref. materials and proficiency test samples, the method showed a broad screening capacity and the abs. limit of detection was consistently below 20 copies, thereby demonstrating the method is fit-for-purpose.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslahu73O&md5=90ff69bd6758b693895c53895ea86a56
  19. 19
    Pazourkova, E.; Zednikova, I.; Korabecna, M.; Kralova, J.; Pisacka, M.; Novotna, M.; Calda, P.; Horinek, A. Optimization of diagnostic strategy for non-invasive cell-free foetal RHD determination from maternal plasma Vox Sang. 2021, 13099. DOI: 10.1111/vox.13099
    Google Scholar
    There is no corresponding record for this reference.
  20. 20
    Suwannakhon, N.; Pangeson, T.; Seeratanachot, T.; Mahingsa, K.; Pingyod, A.; Bumrungpakdee, W.; Sanguansermsri, T. Noninvasive prenatal screening test for compound heterozygous beta thalassemia using an amplification refractory mutation system real-time polymerase chain reaction technique. Hematol. Rep. 2019, 11, 8124  DOI: 10.4081/hr.2019.8124
    Google Scholar
    20
    Noninvasive prenatal screening test for compound heterozygous beta thalassemia using an amplification refractory mutation system real-time polymerase chain reaction technique
    Suwannakhon Narutchala; Pangeson Tanapat; Seeratanachot Teerapat; Mahingsa Khwanruedee; Pingyod Arunee; Bumrungpakdee Wanwipa; Sanguansermsri Torpong
    Hematology reports (2019), 11 (3), 8124 ISSN:2038-8322.
    We propose using a modified amplification refractory mutation system real-time polymerase chain reaction (ARMS RTPCR) technique to exclude the invasive prenatal diagnosis for a non-paternally inherited beta thalassemia mutation in couples atrisk for having a baby with CHBT. The ARMS RT-PCR method was performed for 36 at-risk couples by using isolated fetal cell-free DNA from maternal plasma. The modified ARMS RT-PCR primers targeted one of the following paternally inherited beta thalassemia mutation: -28 A→G, CD17 A→T, CD 26 G→A, IVS1-1 G→T and CD 41-42 -CTTT. The method could be successfully employed for NIPST starting with the 7(th) week of gestation. The results showed that 19 pregnant women were negative for PIBTM (53%). After an on-track and on-time of one year, including postnatal thalassemia blood tests, none of the babies showed symptoms or signs of beta thalassemia disease. We concluded that the modified ARMS RT-PCR method was an accurate, cost-effective and feasible method for use as a NIPST for at-risk couples with the potential of having a baby with CHBT.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MnksFCrsQ%253D%253D&md5=4ebe386640217e1c2efb4b1293f06705
  21. 21
    Huggett, J. F.; The dMIQE Group; Whale, A. S. The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin. Chem. 2020, 66, 1012– 1029,  DOI: 10.1093/clinchem/hvaa125
    Google Scholar
    21
    The Digital MIQE Guidelines Update: Minimum Information for Publication of Quantitative Digital PCR Experiments for 2020
    Huggett Jim F
    Clinical chemistry (2020), 66 (8), 1012-1029 ISSN:.
    Digital PCR (dPCR) has developed considerably since the publication of the Minimum Information for Publication of Digital PCR Experiments (dMIQE) guidelines in 2013, with advances in instrumentation, software, applications, and our understanding of its technological potential. Yet these developments also have associated challenges; data analysis steps, including threshold setting, can be difficult and preanalytical steps required to purify, concentrate, and modify nucleic acids can lead to measurement error. To assist independent corroboration of conclusions, comprehensive disclosure of all relevant experimental details is required. To support the community and reflect the growing use of dPCR, we present an update to dMIQE, dMIQE2020, including a simplified dMIQE table format to assist researchers in providing key experimental information and understanding of the associated experimental process. Adoption of dMIQE2020 by the scientific community will assist in standardizing experimental protocols, maximize efficient utilization of resources, and further enhance the impact of this powerful technology.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38fgs1Srsg%253D%253D&md5=99e07b40b9a700650740812b33b30e05
  22. 22
    Bustin, S. A.; Benes, V.; Garson, J. A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M. W.; Shipley, G. L. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611– 622,  DOI: 10.1373/clinchem.2008.112797
    Google Scholar
    22
    The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments
    Bustin, Stephen A.; Benes, Vladimir; Garson, Jeremy A.; Hellemans, Jan; Huggett, Jim; Kubista, Mikael; Mueller, Reinhold; Nolan, Tania; Pfaffl, Michael W.; Shipley, Gregory L.; Vandesompele, Jo; Wittwer, Carl T.
    Clinical Chemistry (Washington, DC, United States) (2009), 55 (4), 611-622CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)
    A review. BACKGROUND: Currently, a lack of consensus exists on how best to perform and interpret quant. real-time PCR (qPCR) expts. The problem is exacerbated by a lack of sufficient exptl. detail in many publications, which impedes a reader's ability to evaluate critically the quality of the results presented or to repeat the expts. CONTENT: The Min. Information for Publication of Quant. Real-Time PCR Expts. (MIQE) guidelines target the reliability of results to help ensure the integrity of the scientific literature, promote consistency between labs., and increase exptl. transparency. MIQE is a set of guidelines that describe the min. information necessary for evaluating qPCR expts. Included is a checklist to accompany the initial submission of a manuscript to the publisher. By providing all relevant exptl. conditions and assay characteristics, reviewers can assess the validity of the protocols used. Full disclosure of all reagents, sequences, and anal. methods is necessary to enable other investigators to reproduce results. MIQE details should be published either in abbreviated form or as an online supplement. SUMMARY: Following these guidelines will encourage better exptl. practice, allowing more reliable and unequivocal interpretation of qPCR results.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXktVWqs7g%253D&md5=a5db2cfd34dae856784bc5f33aee0023
  23. 23
    Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2– ΔΔCT method. Methods 2001, 25, 402– 408,  DOI: 10.1006/meth.2001.1262
    Google Scholar
    23
    Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method
    Livak, Kenneth J.; Schmittgen, Thomas D.
    Methods (San Diego, CA, United States) (2001), 25 (4), 402-408CODEN: MTHDE9; ISSN:1046-2023. (Academic Press)
    The two most commonly used methods to analyze data from real-time, quant. PCR expts. are abs. quantification and relative quantification. Abs. quantification dets. the input copy no., usually by relating the PCR signal to a std. curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2-ΔΔCT method is a convenient way to analyze the relative changes in gene expression from real-time quant. PCR expts. The purpose of this report is to present the derivation, assumptions, and applications of the 2-ΔΔCT method. In addn., we present the derivation and applications of two variations of the 2-ΔΔCT method that may be useful in the anal. of real-time, quant. PCR data. (c) 2001 Academic Press.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XhtFelt7s%253D&md5=f849383250ea43f7380ed540db8a64b1
  24. 24
    Gubala, A. J. Multiplex real-time PCR detection of Vibrio cholerae. J. Microbiol. Methods 2006, 65, 278– 293,  DOI: 10.1016/j.mimet.2005.07.017
    Google Scholar
    24
    Multiplex real-time PCR detection of Vibrio cholerae
    Gubala, Aneta J.
    Journal of Microbiological Methods (2006), 65 (2), 278-293CODEN: JMIMDQ; ISSN:0167-7012. (Elsevier B.V.)
    Cholera is an important enteric disease, which is endemic to different regions of the world and has historically been the cause of severe pandemics. Vibrio cholerae is a natural inhabitant of the aquatic environment and the toxigenic strains are causative agents of potentially life-threatening diarrhea. A multiplex, real-time detection assay was developed targeting four genes characteristic of potentially toxigenic strains of V. cholerae, encoding: repeat in toxin (rtxA), extracellular secretory protein (epsM), mannose-sensitive pili (mshA) and the toxin coregulated pilus (tcpA). The assay was developed on the Cepheid Smart Cycler using SYBR Green I for detection and the products were differentiated based on melting temp. (T m) anal. Validation of the assay was achieved by testing against a range of Vibrio and non-Vibrio species. The detection limit of the assay was detd. to be 103 CFU using cells from pure culture. This assay was also successful at detecting V. cholerae directly from spiked environmental water samples in the order of 104 CFU, except from sea water which inhibited the assay. The incorporation of a simple DNA purifn. step prior to the addn. to the PCR increased the sensitivity 10 fold to 103 CFU. This multiplex real-time PCR assay allows for a more reliable, rapid detection and identification of V. cholerae which is considerably faster than current conventional detection assays.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xjs1Wlsb0%253D&md5=4d1e250eb2feb0027b9d272269e7ef59
  25. 25
    Waggoner, J. J.; Abeynayake, J.; Sahoo, M. K.; Gresh, L.; Tellez, Y.; Gonzalez, K.; Ballesteros, G.; Pierro, A. M.; Gaibani, P.; Guo, F. P. Single-reaction, multiplex, real-time rt-PCR for the detection, quantitation, and serotyping of dengue viruses. PLoS Neglected Trop. Dis. 2013, 7, e2116  DOI: 10.1371/journal.pntd.0002116
    Google Scholar
    25
    Single-reaction, multiplex, real-time RT-PCR for the detection, quantitation, and serotyping of dengue viruses
    Waggoner, Jesse J.; Abeynayake, Janaki; Sahoo, Malaya K.; Gresh, Lionel; Tellez, Yolanda; Gonzalez, Karla; Ballesteros, Gabriela; Pierro, Anna M.; Gaibani, Paolo; Guo, Frances P.; Sambri, Vittorio; Balmaseda, Angel; Karunaratne, Kumudu; Harris, Eva; Pinsky, Benjamin A.
    PLoS Neglected Tropical Diseases (2013), 7 (4), e2116CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)
    Background: Dengue fever results from infection with one or more of four different serotypes of dengue virus (DENV). Despite the widespread nature of this infection, available mol. diagnostics have significant limitations. The aim of this study was to develop a multiplex, real-time, reverse transcriptase-PCR (rRT-PCR) for the detection, quantitation, and serotyping of dengue viruses in a single reaction. Methodol./Principal Findings: An rRT-PCR assay targeting the 5' untranslated region and capsid gene of the DENV genome was designed using mol. beacons to provide serotype specificity. Using ref. DENV strains, the assay was linear from 7.0 to 1.0 log10 cDNA equiv./μL for each serotype. The lower limit of detection using genomic RNA was 0.3, 13.8, 0.8, and 12.4 cDNA equiv./μL for serotypes 1-4, resp., which was 6- to 275-fold more anal. sensitive than a widely used hemi-nested RT-PCR. Using samples from Nicaragua collected within the first five days of illness, the multiplex rRT-PCR was pos. in 100% (69/69) of specimens that were pos. by the hemi-nested assay, with full serotype agreement. Furthermore, the multiplex rRT-PCR detected DENV RNA in 97.2% (35/36) of specimens from Sri Lanka pos. for anti-DENV IgM antibodies compared to just 44.4% (16/36) by the hemi-nested RT-PCR. No amplification was obsd. in 80 clin. samples sent for routine quant. hepatitis C virus testing or when genomic RNA from other flaviviruses was tested. Conclusions/Significance: This single-reaction, quant., multiplex rRT-PCR for DENV serotyping demonstrates superior anal. and clin. performance, as well as simpler workflow compared to the hemi-nested RT-PCR ref. In particular, this multiplex rRT-PCR detects viral RNA and provides serotype information in specimens collected more than five days after fever onset and from patients who had already developed anti-DENV IgM antibodies. The implementation of this assay in dengue-endemic areas has the potential to improve both dengue diagnosis and epidemiol. surveillance.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsFaitbk%253D&md5=06c8bd64ca32e66a2e768100f773bd2a
  26. 26
    Zhang, H.; Li, H.; Zhu, H.; Pekárek, J.; Podešva, P.; Chang, H.; Neužil, P. Revealing the secrets of PCR. Sens. Actuators, B 2019, 298, 126924  DOI: 10.1016/j.snb.2019.126924
    Google Scholar
    26
    Revealing the secrets of PCR
    Zhang, Haoqing; Li, Huanan; Zhu, Hanliang; Pekarek, Jan; Podesva, Pavel; Chang, Honglong; Neuzil, Pavel
    Sensors and Actuators, B: Chemical (2019), 298 (), 126924CODEN: SABCEB; ISSN:0925-4005. (Elsevier B.V.)
    The polymerase chain reaction (PCR) method and its quant. variant (qPCR) were a landmark discovery for detection and quantification of small amts. of unambiguous DNAs (DNA) due to its enormous sensitivity and specificity. The current methods for qPCR protocol optimization provide no information of the PCR propagation during the cycles as only single data point is extd. at the end of each thermal cycles, limiting a thorough understanding of reaction details. In this study, we utilized the continuous fluorescence monitoring method to observe progress of the reaction in real time with over 100 data points per each cycle, thus gaining a profound insight into the PCR itself. This provided information about the real-time PCR status, dominating reactions and their completion/incompletion during each cycle as well as their reaction kinetics. We then adjusted the duration of either annealing or elongation steps to ensure their completion within each cycle, resulting in the protocol optimization with complete amplification, enhancing PCR efficiency and taking < 20 min to obtain max. product amt. The proposed method was verified using DNA with lengths of 177 base pairs (bp), 250 bp, and 400 bp. It can also be adopted for helping with qPCR troubleshooting as well as protocol optimizing just by reprogramming com. real-time PCR cyclers.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGnsrnK&md5=a7c4d71de0ba157760e531cc591b5188
  27. 27
    Ahrberg, C. D.; Manz, A.; Neuzil, P. Single fluorescence channel-based multiplex detection of avian influenza virus by quantitative PCR with intercalating dye. Sci. Rep. 2015, 5, 11479  DOI: 10.1038/srep11479
    Google Scholar
    There is no corresponding record for this reference.
  28. 28
    Zhu, H.; Zhang, H.; Ni, S.; Korabečná, M.; Yobas, L.; Neuzil, P. The vision of point-of-care PCR tests for the COVID-19 pandemic and beyond. TrAC, Trends Anal. Chem. 2020, 130, 115984  DOI: 10.1016/j.trac.2020.115984
    Google Scholar
    28
    The vision of point-of-care PCR tests for the COVID-19 pandemic and beyond
    Zhu, Hanliang; Zhang, Haoqing; Ni, Sheng; Korabecna, Marie; Yobas, Levent; Neuzil, Pavel
    TrAC, Trends in Analytical Chemistry (2020), 130 (), 115984CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B.V.)
    A review. Infectious diseases, such as the most recent case of coronavirus disease 2019, have brought the prospect of point-of-care (POC) diagnostic tests into the spotlight. A rapid, accurate, low-cost, and easy-to-use test in the field could stop epidemics before they develop into full-blown pandemics. Unfortunately, despite all the advances, it still does not exist. We critically review the limited no. of prototypes demonstrated to date that is based on a polymerase chain reaction (PCR) and has come close to fulfill this vision. We summarize the requirements for the POC-PCR tests and then go on to discuss the PCR product-detection methods, integration of their functional components, potential applications, and other practical issues related to the implementation of lab-on-a-chip technologies. We conclude our review with a discussion of the latest findings on nucleic acid-based diagnosis.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVOru7bF&md5=be67c4f8c13058ff3d70a3e9a8999b96
  29. 29
    Ahrberg, C. D.; Neužil, P. Doubling throughput of a real-time PCR. Sci. Rep. 2015, 5, 12595  DOI: 10.1038/srep12595
    Google Scholar
    29
    Doubling Throughput of a Real-Time PCR
    Ahrberg, Christian D.; Neuzil, Pavel
    Scientific Reports (2015), 5 (), 12595CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)
    The invention of polymerase chain reaction (PCR) in 1983 revolutionized many areas of science, due to its ability to multiply a no. of copies of DNA sequences (known as amplicons). Here we report on a method to double the throughput of quant. PCR which could be esp. useful for PCR-based mass screening. We concurrently amplified two target genes using only single fluorescent dye. A FAM probe labeled olionucleotide was attached to a quencher for one amplicon while the second one was without a probe. The PCR was performed in the presence of the intercalating dye SYBR Green I. We collected the fluorescence amplitude at two points per PCR cycle, at the denaturation and extension steps. The signal at denaturation is related only to the amplicon with the FAM probe while the amplitude at the extension contained information from both amplicons. We thus detected two genes within the same well using a single fluorescent channel. Any com. real-time PCR systems can use this method doubling the no. of detected genes. The method can be used for abs. quantification of DNA using a known concn. of housekeeping gene at one fluorescent channel.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhtlWhur%252FN&md5=8029b7090138185261a2d379de239068
  30. 30
    Rodriguez-Manzano, J.; Moniri, A.; Malpartida-Cardenas, K.; Dronavalli, J.; Davies, F.; Holmes, A.; Georgiou, P. Simultaneous single-channel multiplexing and quantification of carbapenem-resistant genes using multidimensional standard curves. Anal. Chem. 2019, 91, 2013– 2020,  DOI: 10.1021/acs.analchem.8b04412
    Google Scholar
    30
    Simultaneous Single-Channel Multiplexing and Quantification of Carbapenem-Resistant Genes Using Multidimensional Standard Curves
    Rodriguez-Manzano, Jesus; Moniri, Ahmad; Malpartida-Cardenas, Kenny; Dronavalli, Jyothsna; Davies, Frances; Holmes, Alison; Georgiou, Pantelis
    Analytical Chemistry (Washington, DC, United States) (2019), 91 (3), 2013-2020CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
    Multiplexing and quantification of nucleic acids, both have, in their own right, significant and extensive use in biomedical related fields. Currently, the ability to detect several nucleic acid targets in a single-reaction scales linearly with the no. of targets; an expensive and time-consuming feat. Here, we propose a new methodol. based on multidimensional std. curves that extends the use of real-time PCR data obtained by common qPCR instruments. By applying this novel methodol., we achieve simultaneous single-channel multiplexing and enhanced quantification of multiple targets using only real-time amplification data. This is obtained without the need of fluorescent probes, agarose gels, melting curves or sequencing anal. Given the importance and demand for tackling challenges in antimicrobial resistance, the proposed method is applied to four of the most prominent carbapenem-resistant genes: blaOXA-48, blaNDM, blaVIM, and blaKPC, which account for 97% of the UK's reported carbapenemase-producing Enterobacteriaceae.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXms1elsA%253D%253D&md5=ca5c3deb2c1008e0418884e57dcf5acf
  31. 31
    Moniri, A.; Rodriguez-Manzano, J.; Malpartida-Cardenas, K.; Yu, L.-S.; Didelot, X.; Holmes, A.; Georgiou, P. Framework for DNA quantification and outlier detection using multidimensional standard curves. Anal. Chem. 2019, 91, 7426– 7434,  DOI: 10.1021/acs.analchem.9b01466
    Google Scholar
    31
    Framework for DNA Quantification and Outlier Detection Using Multidimensional Standard Curves
    Moniri, Ahmad; Rodriguez-Manzano, Jesus; Malpartida-Cardenas, Kenny; Yu, Ling-Shan; Didelot, Xavier; Holmes, Alison; Georgiou, Pantelis
    Analytical Chemistry (Washington, DC, United States) (2019), 91 (11), 7426-7434CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
    Real-time PCR is a highly sensitive and powerful technol. for the quantification of DNA and has become the method of choice in microbiol., bioengineering and mol. biol. Currently, the anal. of real-time PCR data is hampered by only considering a single feature of the amplification profile to generate a std. curve. The current "gold std." is the cycle-threshold (Ct) method which is known to provide poor quantification under inconsistent reaction efficiencies. Multiple single-feature methods have been developed to overcome the limitations of the Ct method, however, there is an unexplored area of combining multiple features in order to benefit from their joint information. Here, the authors propose a novel framework that combines existing std. curve methods into a multidimensional std. curve. This is achieved by considering multiple features together such that each amplification curve is viewed as a point in a multidimensional space. Contrary to only considering a single-feature, in the multidimensional space, data points do not fall exactly on the std. curve, which enables a similarity measure between amplification curves based on distances between data points. The authors show that this framework expands the capabilities of std. curves in order to: optimize quantification performance, provide a measure of how suitable an amplification curve is for a std., and thus automatically detect outliers and increase the reliability of quantification. The aim is to provide an affordable soln. to enhance existing diagnostic settings through maximizing the amt. of information extd. from conventional instruments.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXovVKgtbw%253D&md5=50a38da1855a1f94d2c903ce2f773cff
  32. 32
    Moniri, A.; Miglietta, L.; Malpartida-Cardenas, K.; Pennisi, I.; Cacho-Soblechero, M.; Moser, N.; Holmes, A.; Georgiou, P.; Rodriguez-Manzano, J. Amplification curve analysis: data-driven multiplexing using real-time digital PCR. Anal. Chem. 2020, 92, 13134– 13143,  DOI: 10.1021/acs.analchem.0c02253
    Google Scholar
    32
    Amplification Curve Analysis: Data-Driven Multiplexing Using Real-Time Digital PCR
    Moniri, Ahmad; Miglietta, Luca; Malpartida-Cardenas, Kenny; Pennisi, Ivana; Cacho-Soblechero, Miguel; Moser, Nicolas; Holmes, Alison; Georgiou, Pantelis; Rodriguez-Manzano, Jesus
    Analytical Chemistry (Washington, DC, United States) (2020), 92 (19), 13134-13143CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
    Information about the kinetics of PCR reactions is encoded in the amplification curve. However, in digital PCR (dPCR), this information is typically neglected by collapsing each amplification curve into a binary output (pos./neg.). Here, we demonstrate that the large vol. of raw data obtained from real-time dPCR instruments can be exploited to perform data-driven multiplexing in a single fluorescent channel using machine learning methods, by virtue of the information in the amplification curve. This new approach, referred to as amplification curve anal. (ACA), was shown using an intercalating dye (EvaGreen), reducing the cost and complexity of the assay and enabling the use of melting curve anal. for validation. As a case study, we multiplexed 3 carbapenem-resistant genes to show the impact of this approach on global challenges such as antimicrobial resistance. In the presence of single targets, we report a classification accuracy of 99.1% (N = 16188), which represents a 19.7% increase compared to multiplexing based on the final fluorescent intensity. Considering all combinations of amplification events (including coamplifications), the accuracy was shown to be 92.9% (N = 10383). To support the anal., we derived a formula to est. the occurrence of coamplification in dPCR based on multivariate Poisson statistics and suggest reducing the digital occupancy in the case of multiple targets in the same digital panel. The ACA approach takes a step toward maximizing the capabilities of existing real-time dPCR instruments and chemistries, by extg. more information from data to enable data-driven multiplexing with high accuracy. Furthermore, we expect that combining this method with existing probe-based assays will increase multiplexing capabilities significantly. We envision that once emerging point-of-care technologies can reliably capture real-time data from isothermal chemistries, the ACA method will facilitate the implementation of dPCR outside of the lab.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVGjtrjP&md5=7df1aedf67404095737d8f345272e6ff
  33. 33
    Wang, C.; Gao, D.; Vaglenov, A.; Kaltenboeck, B. One-step real-time duplex reverse transcription PCRs simultaneously quantify analyte and housekeeping gene mRNAs. Biotechniques 2004, 36, 508– 519,  DOI: 10.2144/04363RN06
    Google Scholar
    33
    One-step real-time duplex reverse transcription PCRs simultaneously quantify analyte and housekeeping gene mRNAs
    Wang, Chengming; Gao, Dongya; Vaglenov, Alexander; Kaltenboeck, Bernhard
    BioTechniques (2004), 36 (3), 508-514, 516, 518-519CODEN: BTNQDO; ISSN:0736-6205. (Eaton Publishing Co.)
    The authors developed a one-step real-time duplex reverse transcription PCR (RT-PCR) method using the LightCycler platform. This method allows simultaneous reverse transcription and real-time PCR amplification of two mRNAs of specific genes of interest (analyte genes) and mRNA of constantly transcribed genes (housekeeping genes) in a single-tube reaction. Specimen total nucleic acids were used because eukaryotic cDNA is discriminated from genomic DNA using exon-spanning primers and/or fluorescence resonance energy transfer (FRET) probes. Transcripts of murine arginase I and hypoxanthine-phosphoribosyl transferase (HPRT; housekeeping gene) or murine arginase II analyte and porphobilinogen deaminase (PBGD; housekeeping gene) were quantified in such duplex RT-PCRs. Twenty-minute reverse transcription reactions at 55° followed by 18 high-stringency step-down thermal cycles and 25 relaxed-stringency fluorescence acquisition cycles produced sensitive and accurate RT-PCR results. Fluorescent signal spillover between channels was fully compensated. A matrix of duplex PCRs at variable ratios of target stds. yielded equations for factors that correct PCR-specific target ratio-dependent deviations in quantification. The one-step real-time duplex RT-PCRs reliably and accurately detd. 10-10,000 copies of each target over a 100,000-fold range of target copy ratios (analyte to housekeeping mRNA = 10-2.5-102.5) in a single assay.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXitlertL0%253D&md5=06292dd2c0379a07c9d5a4ece418d642
  34. 34
    Tan, C.; Chen, X.; Wang, F.; Wang, D.; Cao, Z.; Zhu, X.; Lu, C.; Yang, W.; Gao, N.; Gao, H. J. A. A multiplex droplet digital PCR assay for non-invasive prenatal testing of fetal aneuploidies. Analyst 2019, 144, 2239– 2247,  DOI: 10.1039/C8AN02018C
    Google Scholar
    34
    A multiplex droplet digital PCR assay for non-invasive prenatal testing of fetal aneuploidies
    Tan, Chianru; Chen, Xihua; Wang, Fang; Wang, Dong; Cao, Zongfu; Zhu, Xiurui; Lu, Chao; Yang, Wenjun; Gao, Na; Gao, Huafang; Guo, Yong; Zhu, Lingxiang
    Analyst (Cambridge, United Kingdom) (2019), 144 (7), 2239-2247CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)
    Higher multiplexing in droplet digital PCR (ddPCR) can simplify the detection process of ddPCR-based non-invasive prenatal testing (NIPT) and improve its reliability, making it a practical approach in clin. practice. However, a high level of multiplex ddPCR-based NIPT has rarely been reported. In this study, we developed a multiplex ddPCR assay using universal locked nucleic acid (LNA) probes to reliably identify fetal aneuploidies. We first performed statistical anal. based on the Poisson distribution to evaluate the required no. of target DNA mols. and the total no. of droplets for a ddPCR assay. Next, we designed two sets of primers and probes to quantify cfDNA from chromosomes 21 and 18 and then detd. the disease status of a sample. Finally, we evaluated our multiplex ddPCR assay with 60 clin. plasma samples. All of the 60 clin. samples were correctly identified. The accessibility and cost-effectiveness of our multiplex ddPCR-based NIPT make it a competitive prenatal testing method in clin. use.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXkvVOqsw%253D%253D&md5=f1294d218a673c97c734bb2678e66824
  35. 35
    Liu, W.; Saint, D. A. Validation of a quantitative method for real time PCR kinetics. Biochem. Biophys. Res. Commun. 2002, 294, 347– 353,  DOI: 10.1016/S0006-291X(02)00478-3
    Google Scholar
    35
    Validation of a quantitative method for real time PCR kinetics
    Liu, Weihong; Saint, David A.
    Biochemical and Biophysical Research Communications (2002), 294 (2), 347-353CODEN: BBRCA9; ISSN:0006-291X. (Elsevier Science)
    Real time RT-PCR is the most sensitive method for quantitation of gene expression levels. The accuracy can be dependent on the math. model on which the quant. methods are based. The generally accepted math. model assumes that amplification efficiencies are equal at the exponential phase of the reactions for the same amplicon. However, no methods are available to test the assumptions regarding amplification efficiency before one starts the real time PCR quantitation. Here we further develop and test the validity of a new math. model which dynamically fits real time PCR data with good correlation (R2=0.9995±0.002, n=50). The method is capable of measuring cycle-by-cycle PCR amplification efficiencies and demonstrates that these change dynamically. Validation of the method revealed the intrinsic relationship between the initial amt. of gene transcript and kinetic parameters. A new quant. method is proposed which represents a simple but accurate quant. method.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XktlGrsLo%253D&md5=913195753ead41917be71b152f2d5975
  36. 36
    Rutledge, R. Sigmoidal curve-fitting redefines quantitative real-time PCR with the prospective of developing automated high-throughput applications. Nucleic Acids Res. 2004, 32, e178  DOI: 10.1093/nar/gnh177
    Google Scholar
    36
    Sigmoidal curve-fitting redefines quantitative real-time PCR with the prospective of developing automated high-throughput applications
    Rutledge, R. G.
    Nucleic Acids Research (2004), 32 (22), e178/1-e178/8CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)
    Quant. real-time PCR has revolutionized many aspects of genetic research, biomedical diagnostics and pathogen detection. Nevertheless, the full potential of this technol. has yet to be realized, primarily due to the limitations of the threshold-based methodologies that are currently used for quant. anal. Prone to errors caused by variations in reaction prepn. and amplification conditions, these approaches necessitate construction of std. curves for each target sequence, significantly limiting the development of high-throughput applications that demand substantive levels of reliability and automation. In this study, an alternative approach based upon fitting of fluorescence data to a four-parametric sigmoid function is shown to dramatically increase both the utility and reliability of quant. real-time PCR. By math. modeling individual amplification reactions, quantification can be achieved without the use of std. curves and without prior knowledge of amplification efficiency. Combined with provision of quant. scale via optical calibration, sigmoidal curve-fitting could confer the capability for fully automated quantification of nucleic acids with unparalleled accuracy and reliability.
    >> More from SciFinder ®
    https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXkt1altg%253D%253D&md5=684ce0b8261f252e3b365015e84b6906

Cited By

Click to copy section linkSection link copied!

This article is cited by 8 publications.

  1. Dipak Koirala, Forrest Dalbec, Jeremy May, Kailash Hamal, Peter B. Allen, I. Francis Cheng. Biosensing with Polymerase Chain Reaction-Stable DNA-Functionalized Magnetically Susceptible Carbon–Iron Microparticles. Analytical Chemistry 2023, 95 (45) , 16631-16638. https://doi.org/10.1021/acs.analchem.3c02978
  2. Minjung Shin, Jun-Won Kang, Dong-Hyun Kang. A study on antibiotic resistance gene degradation in fresh produce using peracetic acid combined with an ultraviolet-C light-emitting-diode. Food Control 2023, 145 , 109478. https://doi.org/10.1016/j.foodcont.2022.109478
  3. Haoqing Zhang, Soňa Laššáková, Zhiqiang Yan, Xinlu Wang, Pavel Šenkyřík, Martina Gaňová, Honglong Chang, Marie Korabečná, Pavel Neuzil. Digital polymerase chain reaction duplexing method in a single fluorescence channel. Analytica Chimica Acta 2023, 1238 , 340243. https://doi.org/10.1016/j.aca.2022.340243
  4. Sharifah Aliah Diyanah Syed Hussin, Ang-Lim Chua, Hassanain Al-Talib, Shamala Devi Sekaran, Seok Mui Wang. An Overview of Laboratory Diagnosis of Central Nervous System Viral Infections. Journal of Pure and Applied Microbiology 2022, 16 (4) , 2225-2245. https://doi.org/10.22207/JPAM.16.4.34
  5. Chaoyu Cao, Minli You, Haoyang Tong, Zhenrui Xue, Chang Liu, Wanghong He, Ping Peng, Chunyan Yao, Ang Li, Xiayu Xu, Feng Xu. Similar color analysis based on deep learning (SCAD) for multiplex digital PCR via a single fluorescent channel. Lab on a Chip 2022, 22 (20) , 3837-3847. https://doi.org/10.1039/D2LC00637E
  6. Matthew M. Hernandez, Radhika Banu, Ana S. Gonzalez-Reiche, Brandon Gray, Paras Shrestha, Liyong Cao, Feng Chen, Huanzhi Shi, Ayman Hanna, Juan David Ramírez, Adriana van de Guchte, Robert Sebra, Melissa R. Gitman, Michael D. Nowak, Carlos Cordon-Cardo, Ted E. Schutzbank, Viviana Simon, Harm van Bakel, Emilia Mia Sordillo, Alberto E. Paniz-Mondolfi. RT-PCR/MALDI-TOF Diagnostic Target Performance Reflects Circulating SARS-CoV-2 Variant Diversity in New York City. The Journal of Molecular Diagnostics 2022, 24 (7) , 738-749. https://doi.org/10.1016/j.jmoldx.2022.04.003
  7. Haoqing Zhang, Zhiqiang Yan, Xinlu Wang, Martina Gaňová, Marie Korabečná, Pavel Zahradník, Honglong Chang, Pavel Neuzil. Digital PCR system development accelerator—A methodology to emulate dPCR results. Sensors and Actuators B: Chemical 2022, 358 , 131527. https://doi.org/10.1016/j.snb.2022.131527
  8. Zhiqiang Yan, Haoqing Zhang, Xinlu Wang, Martina Gaňová, Tomáš Lednický, Hanliang Zhu, Xiaocheng Liu, Marie Korabečná, Honglong Chang, Pavel Neužil. An image-to-answer algorithm for fully automated digital PCR image processing. Lab on a Chip 2022, 22 (7) , 1333-1343. https://doi.org/10.1039/D1LC01175H
Download PDF
Open PDF
Go to ACS Omega
Get e-Alerts
Get e-Alerts

ACS Omega

Cite this: ACS Omega 2021, 6, 34, 22292–22300
Click to copy citationCitation copied!
https://doi.org/10.1021/acsomega.1c02971
Published August 19, 2021

Copyright © 2021 The Authors. Published by American Chemical Society. This publication is licensed under

CC-BY-NC-ND 4.0 .

Article Views

10k

Altmetric

-

Citations

8
Learn about these metrics

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

  • Abstract

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 1

    Figure 1. Principle of the proposed qPCR multiplexing method. (A) We prepared the PCR master mix containing two DNA templates, two sets of relevant forward and reverse primers, a FAM probe specific to one DNA template, and EvaGreen intercalating dye. (B) We performed the PCR and captured the F (green curve) during each cycle at the end of the denaturation and elongation steps, while the red curve represents the heater temperature. Contributions to the F at the denaturation step are only from the FAM probe (inset B1). F at the elongation step consists of both the FAM probe linked to Chr21 as well as the EvaGreen intercalating dye with both targets (inset B2). (C) All of the collected data during the PCR followed by the MCA were split (D) into two sets and plotted separately, which represents the denaturation amplification curve (red) and the elongation amplification curves in gradient colors from dark to light green for different cn18. (E) We also plotted an MCA as well as the negative derivation of F showing the presence of two different amplicons in the PCR master mix.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 2

    Figure 2. Determination of the copy numbers of both targets based on calculation. (A) Values of CtD and CtE as a function of cn21 with cn18 as the parameter. The black lines with squares are three denaturation curves overlapping each other that have been calculated using eq 1. The blue curve with downward triangles, the green with upward triangles, and the red with circles are elongation curves calculated by eq 2. Each of them represents different values of cn18. (B) ΔCt values as a function of RSET with cn18 as the parameter that has been extracted from Figure 2A. All three curves overlap, which shows that it is the RSET value determining the ΔCt instead of an absolute value of cn18.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 3

    Figure 3. Ct values extracted from the PCR with EvaGreen intercalating dye and the FAM probe. (A) PCR standard curves of the variable cn21 values with three different cn18 values as the parameter with the denaturation curves marked with circles and the elongation with squares. The cn21 values could be determined in an entire range from the denaturation standard curves. The arrow pointed to the curved region where minor Chr21 clearly influences Chr18 amplification. The green line marked with triangles was formed by the curve fitting of an average value from all three denaturation curves. (B) Values of ΔCt plotted as a function of RSET showing the importance of the RSET value and not the individual cn21 or cn18. (C) Equivalent of (A) with cn18 as the variable and cn21 as the parameter with elongation curves marked by squares and the denaturation by circles. (D) Equivalent of (B) with cn18 as the variable and cn21 as a parameter.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 4

    Figure 4. Ct values extracted from the PCR with FAM and VIC probes. (A) FAM channel with a cn21 variable with cn18 as the parameter showing the problems with the dual-channel amplification as the standard curves with different values of cn18 should be collinear and form a single line regardless of the cn18 value. (B) Same PCR mixtures using a VIC channel also showed the influence of cn21 on cn18 as the results should be independent of cn21 since it was Chr18 with the VIC probe. (C) Implementation of the 2–ΔΔCt method showing its shortcoming with the noncompensated data for fluorescence spillover. (D–F) Similar results for a mixture with the cn18 value variable and the cn21 as the parameter.

    High Resolution Image
    Download MS PowerPoint Slide

  • References

    This article references 36 other publications.

    1. 1
      Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 1986, 263– 273,  DOI: 10.1101/sqb.1986.051.01.032
      1
      Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction
      Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H.
      Cold Spring Harbor Symposia on Quantitative Biology (1986), 51 (Mol. Biol. Homo sapiens, Pt. 1), 263-73CODEN: CSHSAZ; ISSN:0091-7451.
      An in vitro method for prepn. of multiple copies of DNA from a single copy of DNA is described. The initial DNA mol. was sepd. into 2 single-stranded mols. by denaturation at 95°. After cooling to 30°, DNA polymerase and short primer DNA were added, resulting in the formation of 2 copies of the initial DNA mol. This process was repeated 20-27 times for the prodn. of large no. of copies of the initial DNA. Theor., each cycle of this process doubles the no. of copies. This process is termed polymerase chain reaction.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaL2sXkslajtb0%253D&md5=6e43c4cd0c2eac04871c405adb57c846
    2. 2
      Zhu, H.; Zhang, H.; Xu, Y.; Laššáková, S.; Korabečná, M.; Neužil, P. PCR past, present and future. BioTechniques 2020, 69, 317– 325,  DOI: 10.2144/btn-2020-0057
      2
      PCR past, present and future
      Zhu, Hanliang; Zhang, Haoqing; Xu, Ying; Lassakova, Sona; Korabecna, Marie; Neuzil, Pavel
      BioTechniques (2020), 69 (4), 317-325CODEN: BTNQDO; ISSN:1940-9818. (Future Science Ltd.)
      A review. PCR has become one of the most valuable techniques currently used in bioscience, diagnostics and forensic science. Here we review the history of PCR development and the technologies that have evolved from the original PCR method. Currently, there are two main areas of PCR utilization in bioscience: high-throughput PCR systems and microfluidics-based PCR devices for point-of-care (POC) applications. We also discuss the commercialization of these techniques and conclude with a look into their modifications and use in innovative areas of biomedicine. For example, real-time reverse transcription PCR is the gold std. for SARS-CoV-2 diagnoses. It could also be used for POC applications, being a key component of the sample-to-answer system.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitVynsb%252FK&md5=c61d65d43e851fb138b78a5433edff05
    3. 3
      Shu, B.; Zhang, C.; Xing, D. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection. Anal. Chim. Acta 2014, 826, 51– 60,  DOI: 10.1016/j.aca.2014.04.017
      3
      Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection
      Shu, Bowen; Zhang, Chunsun; Xing, Da
      Analytica Chimica Acta (2014), 826 (), 51-60CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
      High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixt. is driven to pass three temp. zones, thus providing a rapid anal. throughput of m × n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temps., flow rates, polymerase concn. and amt. of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19 min, and the limit of detection was low, down to 102 copies μL-1. As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4 × 3 with no detectable cross-contamination.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmslamsbo%253D&md5=ca76aa8f47cd18c866f8c1f6d30b772e
    4. 4
      Kubista, M.; Andrade, J. M.; Bengtsson, M.; Forootan, A.; Jonák, J.; Lind, K.; Sindelka, R.; Sjöback, R.; Sjögreen, B.; Strömbom, L.; Ståhlberg, A.; Zoric, N. The real-time polymerase chain reaction. Mol. Aspects Med. 2006, 27, 95– 125,  DOI: 10.1016/j.mam.2005.12.007
      4
      The real-time polymerase chain reaction
      Kubista, Mikael; Andrade, Jose Manuel; Bengtsson, Martin; Forootan, Amin; Jonak, Jiri; Lind, Kristina; Sindelka, Radek; Sjoeback, Robert; Sjoegreen, Bjoern; Stroembom, Linda; Stahlberg, Anders; Zoric, Neven
      Molecular Aspects of Medicine (2006), 27 (2-3), 95-125CODEN: MAMED5; ISSN:0098-2997. (Elsevier B.V.)
      A review. The scientific, medical, and diagnostic communities have been presented the most powerful tool for quant. nucleic acids anal.: real-time PCR [Bustin, S.A., 2004. A-Z of Quant. PCR. IUL Press, San Diego, CA]. This new technique is a refinement of the original Polymerase Chain Reaction (PCR) developed by Kary Mullis and coworkers in the mid-80s, for which Kary Mullis was awarded the 1993 Nobel prize in Chem. By PCR essentially any nucleic acid sequence present in a complex sample can be amplified in a cyclic process to generate a large no. of identical copies that can readily be analyzed. This made it possible, for example, to manipulate DNA for cloning purposes, genetic engineering, and sequencing. But as an anal. technique the original PCR method had some serious limitations. By first amplifying the DNA sequence and then analyzing the product, quantification was exceedingly difficult since the PCR gave rise to essentially the same amt. of product independently of the initial amt. of DNA template mols. that were present. This limitation was resolved in 1992 by the development of real-time PCR by Higuchi et al. In real-time PCR the amt. of product formed is monitored during the course of the reaction by monitoring the fluorescence of dyes or probes introduced into the reaction that is proportional to the amt. of product formed, and the no. of amplification cycles required to obtain a particular amt. of DNA mols. is registered. Assuming a certain amplification efficiency, which typically is close to a doubling of the no. of mols. per amplification cycle, it is possible to calc. the no. of DNA mols. of the amplified sequence that were initially present in the sample. With the highly efficient detection chemistries, sensitive instrumentation, and optimized assays that are available today the no. of DNA mols. of a particular sequence in a complex sample can be detd. with unprecedented accuracy and sensitivity sufficient to detect a single mol. Typical uses of real-time PCR include pathogen detection, gene expression anal., single nucleotide polymorphism (SNP) anal., anal. of chromosome aberrations, and most recently also protein detection by real-time immuno PCR.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XisF2gsL4%253D&md5=2d3f419baac9c7342f91f8c898f5f33a
    5. 5
      Vogelstein, B.; Kinzler, K. W. Digital PCR. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 9236– 9241,  DOI: 10.1073/pnas.96.16.9236
      5
      Digital PCR
      Vogelstein, Bert; Kinzler, Kenneth W.
      Proceedings of the National Academy of Sciences of the United States of America (1999), 96 (16), 9236-9241CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
      The identification of predefined mutations expected to be present in a minor fraction of a cell population is important for a variety of basic research and clin. applications. Here, we describe an approach for transforming the exponential, analog nature of the PCR into a linear, digital signal suitable for this purpose. Single mols. are isolated by diln. and individually amplified by PCR; each product is then analyzed sep. for the presence of mutations by using fluorescent probes. The feasibility of the approach is demonstrated through the detection of a mutant ras oncogene in the stool of patients with colorectal cancer. The process provides a reliable and quant. measure of the proportion of variant sequences within a DNA sample.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK1MXltVequrY%253D&md5=f6373991690687dc4d930389cba7cf05
    6. 6
      Zhu, H.; Fohlerová, Z.; Pekárek, J.; Basova, E.; Neužil, P. Recent advances in lab-on-a-chip technologies for viral diagnosis. Biosens. Bioelectron. 2020, 153, 112041  DOI: 10.1016/j.bios.2020.112041
      6
      Recent advances in lab-on-a-chip technologies for viral diagnosis
      Zhu, Hanliang; Fohlerova, Zdenka; Pekarek, Jan; Basova, Evgenia; Neuzil, Pavel
      Biosensors & Bioelectronics (2020), 153 (), 112041CODEN: BBIOE4; ISSN:0956-5663. (Elsevier B.V.)
      A review. The global risk of viral disease outbreaks emphasizes the need for rapid, accurate, and sensitive detection techniques to speed up diagnostics allowing early intervention. An emerging field of microfluidics also known as the lab-on-a-chip (LOC) or micro total anal. system includes a wide range of diagnostic devices. This review briefly covers both conventional and microfluidics-based techniques for rapid viral detection. We first describe conventional detection methods such as cell culturing, immunofluorescence or ELISA (ELISA), or reverse transcription polymerase chain reaction (RT-PCR). These methods often have limited speed, sensitivity, or specificity and are performed with typically bulky equipment. Here, we discuss some of the LOC technologies that can overcome these demerits, highlighting the latest advances in LOC devices for viral disease diagnosis. We also discuss the fabrication of LOC systems to produce devices for performing either individual steps or virus detection in samples with the sample to answer method. The complete system consists of sample prepn., and ELISA and RT-PCR for viral-antibody and nucleic acid detection, resp. Finally, we formulate our opinions on these areas for the future development of LOC systems for viral diagnostics.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitFeltLo%253D&md5=2a1c17dbb24f81c67ae80791ed3efa94
    7. 7
      Shoute, L. C.; Loppnow, G. R. Characterization of the binding interactions between EvaGreen dye and dsDNA. Phys. Chem. Chem. Phys. 2018, 20, 4772– 4780,  DOI: 10.1039/C7CP06058K
      7
      Characterization of the binding interactions between EvaGreen dye and dsDNA
      Shoute, L. C. T.; Loppnow, G. R.
      Physical Chemistry Chemical Physics (2018), 20 (7), 4772-4780CODEN: PPCPFQ; ISSN:1463-9076. (Royal Society of Chemistry)
      Understanding the double-stranded (ds)DNA·EvaGreen (EG) binding interaction is important because the EG dye is increasingly used in the real-time quant. polymerase chain reaction, high-resoln. melting anal., and routine quantification of DNA. Here, a binding isotherm for the interactions of EG with dsDNA (poly-dA17·poly-dT17) was detd. from the absorption and fluorescence spectra of EG and the dsDNA·EG complex. The isotherm had a sigmoidal shape and could be modeled with the Hill equation, indicating pos. cooperativity for the binding interaction. A Scatchard plot of the binding data yielded a concave-down curve in agreement with the Hill anal. of the binding isotherm for a pos. cooperative binding interaction. Anal. of the Scatchard plot with the modified McGhee and von Hippel model for a finite one-dimensional homogeneous lattice and nonspecific binding of ligands to dsDNA yielded the intrinsic binding const., the no. of lattice sites occluded by a bound ligand, and the cooperativity parameter of 3.6 × 105 M-1, 4.0, and 8.1, resp. The occluded site size of 4 indicated that moieties of the EG intercalated into the adjacent base pairs of the dsDNA with a gap of one intercalation site between EG binding sites, as expected for a bifunctional mol. Interestingly, at high [EG]/[base pair] values, the intercalation was disrupted. A model was proposed based on the fluorescence spectrum where the formation of anti-parallel stacked chains of EGs bound externally to the dsDNA occur at these high ratios.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhs1OlurY%253D&md5=b2652b6a7cf4d049ecf2bc8cc813b04b
    8. 8
      Lehmusvuori, A.; Karhunen, U.; Tapio, A.-H.; Lamminmäki, U.; Soukka, T. High-performance closed-tube PCR based on switchable luminescence probes. Anal. Chim. Acta 2012, 731, 88– 92,  DOI: 10.1016/j.aca.2012.04.027
      8
      High-performance closed-tube PCR based on switchable luminescence probes
      Lehmusvuori, Ari; Karhunen, Ulla; Tapio, Antti-Heikki; Lamminmaki, Urpo; Soukka, Tero
      Analytica Chimica Acta (2012), 731 (), 88-92CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
      We introduce a switchable lanthanide luminescence reporter technol. based closed-tube PCR for the detection of specific target DNA sequence. In the switchable lanthanide chelate complementation based reporter technol. hybridization of two nonfluorescent oligonucleotide probes to the adjacent positions of the complementary strand leads to the formation of a highly fluorescent lanthanide chelate complex. The complex is self-assembled from a nonfluorescent lanthanide chelate and a light-harvesting antenna ligand when the reporter mols. are brought into close proximity by the oligonucleotide probes. Outstanding signal-to-background discrimination in real-time PCR assay was achieved due to the very low background fluorescence level and high specific signal generation. High sensitivity of the reporter technol. allows the detection of a lower concn. of amplified DNA in the real-time PCR, resulting in detection of the target at the earlier amplification cycle compared to commonly used methods.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XntVSrsrc%253D&md5=30182c4b484c53cb6abdc9f288b0b36c
    9. 9
      Zimmermann, B.; Holzgreve, W.; Wenzel, F.; Hahn, S. Novel real-time quantitative PCR test for trisomy 21. Clin. Chem. 2002, 48, 362– 363,  DOI: 10.1093/clinchem/48.2.362
      9
      Novel real-time quantitative PCR test for trisomy 21
      Zimmermann, Bernhard; Holzgreve, Wolfgang; Wenzel, Friedel; Hahn, Sinuhe
      Clinical Chemistry (Washington, DC, United States) (2002), 48 (2), 362-363CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)
      A novel real-time polymerase chain reaction (PCR) assay was developed for the detection of trisomy 21 that is readily open to automation and high-throughput screening. A multiplex real-time PCR assay was utilized in which amplification of both loci was simultaneously monitored in the same reaction vessel. DNA extd. from amniocyte cultures obtained from 10 trisomy 21 fetuses was examd. The ratio of the two loci, as detd. by the difference in threshold cycle value, distinguished trisomy 21 from karyotypically normal tissue. The ploidy of 9 of 11 cases with normal karyotype was correctly detd. using the novel real-time PCR. This technol. could be easily applied to evaluate the most common fetal aneuploidies. Because real-time PCR allows the anal. of numerous samples in an automated manner, it could be more suited to do this task than current mol. or cellular cytogenic methods because these are significantly more time- and labor-intensive. The real-time PCR assay is also comparable with a fluorescent PCR-based approach or fluorescence in situ hybridization anal. regarding speed and price.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XhtVyhsrc%253D&md5=208b77197c6c035fef1552a037c575e5
    10. 10
      Farzan, V. M.; Kvach, M. V.; Aparin, I. O.; Kireev, D. E.; Prikazchikova, T. A.; Ustinov, A. V.; Shmanai, V. V.; Shipulin, G. A.; Korshun, V. A.; Zatsepin, T. S. Novel homo Yin-Yang probes improve sensitivity in RT-qPCR detection of low copy HIV RNA. Talanta 2019, 194, 226– 232,  DOI: 10.1016/j.talanta.2018.10.043
      10
      Novel homo Yin-Yang probes improve sensitivity in RT-qPCR detection of low copy HIV RNA
      Farzan, Valentina M.; Kvach, Maksim V.; Aparin, Ilya O.; Kireev, Dmitry E.; Prikazchikova, Tatiana A.; Ustinov, Alexey V.; Shmanai, Vadim V.; Shipulin, German A.; Korshun, Vladimir A.; Zatsepin, Timofei S.
      Talanta (2019), 194 (), 226-232CODEN: TLNTA2; ISSN:0039-9140. (Elsevier B.V.)
      Nucleic acids labeled with a fluorophore/quencher pair are widely used as probes in biomedical research and mol. diagnostics. Here we synthesized novel DNA mol. beacons double labeled with the identical dyes (R6G, ROX and Cy5) at 5'- and 3'-end and studied their photo phys. properties. We demonstrated that fluorescence quenching by formation of the homo dimer exciton in such mol. beacons allows using them in homogeneous assays. Further, we developed and evaluated homo Yin-Yang DNA probes labeled with identical dyes and used them for detection of low copy HIV RNA by RT-qPCR. They demonstrated improved sensitivity (LLQ: 10 vs 30 copies mL-1) in comparison to com. available Abbott RealTime HIV-1 kit based on VIC-BHQ dyes both for model mixts. (naive human plasma with added deactivated HIV-1 virus) and for preliminarily confirmed 36 clin. samples (4 vs 1 pos. ones for low-copy samples).
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVWqs7nM&md5=7a790bd59559476c2ff08a4142f024bd
    11. 11
      Chamberlain, J. S.; Gibbs, R. A.; Rainer, J. E.; Nguyen, P. N.; Thomas, C. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 1988, 16, 11141– 11156,  DOI: 10.1093/nar/16.23.11141
      11
      Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification
      Chamberlain, Jeffrey S.; Gibbs, Richard A.; Ranier, Joel E.; Nguyen Phi Nga; Caskey, C. Thomas
      Nucleic Acids Research (1988), 16 (23), 11141-56CODEN: NARHAD; ISSN:0305-1048.
      The isolation and DNA sequence of several deletion prone exons from the human Duchenne muscular dystrophy (DMD) gene are reported. A rapid method capable of detecting the majority of deletions in the DMD gene is also described. This procedure utilizes simultaneous genomic DNA amplification of multiple widely sepd. sequences and should permit deletion scanning at any hemizygous locus. The application of this multiplex reaction for prenatal and postnatal diagnosis of DMD is demonstrated.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaL1MXht12rt7Y%253D&md5=442224240f4de3f6f66fb902f371e862
    12. 12
      Gaňová, M.; Zhang, H.; Zhu, H.; Korabečná, M.; Neužil, P. Multiplexed digital polymerase chain reaction as a powerful diagnostic tool. Biosens. Bioelectron. 2021, 181, 113155  DOI: 10.1016/j.bios.2021.113155
      12
      Multiplexed digital polymerase chain reaction as a powerful diagnostic tool
      Ganova, Martina; Zhang, Haoqing; Zhu, Hanliang; Korabecna, Marie; Neuzil, Pavel
      Biosensors & Bioelectronics (2021), 181 (), 113155CODEN: BBIOE4; ISSN:0956-5663. (Elsevier B.V.)
      A review. The digital polymerase chain reaction (dPCR) multiplexing method can simultaneously detect and quantify closely related DNA sequences in complex mixts. The dPCR concept is continuously improved by the development of microfluidics and micro- and nanofabrication, and different complex techniques are introduced. In this review, we introduce dPCR techniques based on sample compartmentalization, droplet- and chip-based systems, and their combinations. We then discuss dPCR multiplexing methods in both lab. research settings and advanced or routine clin. applications. We focus on their strengths and weaknesses with regard to the character of biol. samples and to the required precision of such anal., as well as showing recently published work based on those methods. Finally, we envisage possible future achievements in this field.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3MXmvVOqsL0%253D&md5=8d5250cd91445c05bcaee99b3ba2ba47
    13. 13
      DuVall, J. A.; Le Roux, D.; Thompson, B. L.; Birch, C.; Nelson, D. A.; Li, J.; Mills, D. L.; Tsuei, A.-c.; Ensenberger, M. G.; Sprecher, C.; Storts, D. R.; Root, B. E.; Landers, J. P. Rapid multiplex DNA amplification on an inexpensive microdevice for human identification via short tandem repeat analysis. Anal. Chim. Acta 2017, 980, 41– 49,  DOI: 10.1016/j.aca.2017.04.051
      13
      Rapid multiplex DNA amplification on an inexpensive microdevice for human identification via short tandem repeat analysis
      DuVall, Jacquelyn A.; Le Roux, Delphine; Thompson, Brandon L.; Birch, Christopher; Nelson, Daniel A.; Li, Jingyi; Mills, Daniel L.; Tsuei, An-chi; Ensenberger, Martin G.; Sprecher, Cindy; Storts, Douglas R.; Root, Brian E.; Landers, James P.
      Analytica Chimica Acta (2017), 980 (), 41-49CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
      Forensic DNA anal. requires several steps, including DNA extn., PCR amplification, and sepn. of PCR fragments. Intuitively, there are numerous situations where it would be beneficial to speed up the overall DNA anal. process; the authors focus on the most time-consuming component in the anal. pipeline, namely the polymerase chain reaction (PCR). Primers were specially designed to target 10 human genomic loci, all yielding amplicons shorter than 350 bases, for ease of downstream integration with on-board microchip electrophoresis. Primer concns. were adjusted specifically for microdevice amplification, resulting in well-balanced short tandem repeat (STR) profiles. Furthermore, studies were performed to push the limits of the DNA polymerase to achieve rapid, multiplexed PCR on various substrates, including transparent and black polyethylene terephthalate (Pe), and with two distinct adhesives, toner and heat sensitive adhesive (HSA). Rapid STR-based multiplexed PCR amplification is demonstrated in 15 min on a Pe microdevice using a custom-built system for fluid flow control and thermocycling for the full 10-plex, and in 10 min for a smaller multiplex consisting of six core CODIS loci plus Amelogenin with amplicons shorter than 200bp. Lastly, preliminary studies indicate the capability of this PCR microdevice platform to be integrated with both upstream DNA extn., and downstream microchip electrophoresis. This, coupled to the use of reagents that are compatible with lyophilization (lyo-compatible) for PCR, represents the potential for a fully integrated rotationally-driven microdevice for complete forensic DNA anal.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXot1Wls7g%253D&md5=b90b889f96fd11679b3d2d88b343bb66
    14. 14
      Li, Y.; Li, Y.; Zheng, B.; Qu, L.; Li, C. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization. Anal. Chim. Acta 2009, 643, 100– 107,  DOI: 10.1016/j.aca.2009.04.006
      14
      Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization
      Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can
      Analytica Chimica Acta (2009), 643 (1-2), 100-107CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
      A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous anal. of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the sepn. conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 × 102 CFU mL-1 of Vibrio parahemolyticus, 2.9 × 102 CFU mL-1 of Salmonella, 8.7 × 101 CFU mL-1 of E. coli O157:H7 and 5.2 × 101 CFU mL-1 of Shigella, resp. The relative std. deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resoln. and less anal. time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmtVeksLY%253D&md5=cc1d4288a53db5ffcba2d964b0f5964e
    15. 15
      Arnold, L.; Alexiadis, V.; watanaskul, T.; Zarrabi, V.; Poole, J.; Singh, V. Clinical validation of qPCR Target Selector assays using highly specific switch-blockers for rare mutation detection. J. Clin. Pathol. 2020, 73, 648– 655,  DOI: 10.1136/jclinpath-2019-206381
      15
      Clinical validation of qPCR Target Selector assays using highly specific switch-blockers for rare mutation detection
      Arnold, Lyle; Alexiadis, Vassilios; watanaskul, Tim; Zarrabi, Vahid; Poole, Jason; Singh, Veena
      Journal of Clinical Pathology (2020), 73 (10), 648-655CODEN: JCPAAK; ISSN:0021-9746. (BMJ)
      Aims The identification of actionable DNA mutations assocd. with a patient's tumor is crit. for devising a targeted, personalised cancer treatment strategy. However, these mol. analyses are typically performed using tissue obtained via biopsy, which involves substantial risk and is often not feasible. In addn., biopsied tissue does not always reflect tumor heterogeneity, and sequential biopsies to track disease progression (eg, emergence of drug resistance mutations) are not well tolerated. To overcome these and other biopsy-assocd. limitations, we have developed non-invasive 'liq. biopsy' technologies to enable the mol. characterization of a patient's cancer using peripheral blood samples. Methods The Target Selector ctDNA platform uses a real-time PCR-based approach, coupled with DNA sequencing, to identify cancer-assocd. genetic mutations within circulating tumor DNA. This is accomplished via a patented blocking approach suppressing wild-type DNA amplification, while allowing specific amplification of mutant alleles. Results To promote the clin. uptake of liq. biopsy technologies, it is first crit. to demonstrate concordance between results obtained via liq. and traditional biopsy procedures. Here, we focused on three genes frequently mutated in cancer: EGFR (Del19, L858, and T790), BRAF (V600) and KRAS (G12/G13). For each Target Selector assay, we demonstrated extremely high accuracy, sensitivity and specificity compared with results obtained from tissue biopsies. Overall, we found between 93% and 96% concordance to blinded tissue samples across 127 clin. assays. Conclusions The switch-blocker technol. reported here offers a highly effective method for non-invasively detg. the mol. signatures of patients with cancer.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitF2rur3N&md5=1ee406d8c2f7a96d3221c8eea1508fd0
    16. 16
      Emaus, M. N.; Anderson, J. L. Allelic discrimination between circulating tumor DNA fragments enabled by a multiplex-qPCR assay containing DNA-enriched magnetic ionic liquids. Anal. Chim. Acta 2020, 1124, 184– 193,  DOI: 10.1016/j.aca.2020.04.078
      16
      Allelic discrimination between circulating tumor DNA fragments enabled by a multiplex-qPCR assay containing DNA-enriched magnetic ionic liquids
      Emaus, Miranda N.; Anderson, Jared L.
      Analytica Chimica Acta (2020), 1124 (), 184-193CODEN: ACACAM; ISSN:0003-2670. (Elsevier B.V.)
      Multiplex amplification of DNA can be highly valuable in circulating tumor DNA (ctDNA) anal. due to the sheer no. of potential mutations. However, com. ctDNA extn. methods struggle to preconc. low concns. of DNA and require multiple sample handling steps. Recently, magnetic ionic liqs. (MILs) have been used to ext. DNA and were integrated with a quant. polymerase chain reaction (qPCR). However, in previous studies, DNA could not be preconcd. from plasma and only one fragment could be amplified per reaction. MILs were used as DNA extn. solvents and directly integrated into a multiplex-qPCR buffer to simultaneously amplify wild-type KRAS, G12S KRAS, and wild-type BRAF, three clin.-relevant genes whose mutation status can affect the success of anti-EGFR therapy. DNA was desorbed from the MIL solvent during a multiplex-PCR without having a significant effect on the amplification efficiency, and allelic discrimination of single-nucleotide polymorphisms could still be achieved. Enrichment factors over 35 for all three sequences were achieved from Tris buffer using the [N8+,8,8,Bz][Ni(hfacac)-3] and [P6+,6,6,14][Ni(Phtfacac)-3] MILs. DNA could still be preconcd. from 2-fold dild. human plasma using the [N8+,8,8,Bz][Ni(hfacac)-3] MIL. Extns. from undiluted plasma were reproducible with the [P6+,6,6,14][Ni(Phtfacac)-3] MIL although DNA was not preconcd. with enrichment factors around 0.6 for all three fragments. Compared to com. DNA extn. methods (i.e., silica-based spin columns and magnetic beads), the MIL-based extn. achieved higher enrichment factors in Tris buffer and plasma. The ability of the MIL-based dispersive liq.-liq. microextn. (DLLME) direct-multiplex-qPCR method to simultaneously achieve high enrichment factors of multiple DNA fragments from human plasma is highly promising in the field of ctDNA detection.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpsl2jsb0%253D&md5=54000a1bde1f90aa7f49fab874152352
    17. 17
      Muenchhoff, M.; Mairhofer, H.; Nitschko, H.; Grzimek-Koschewa, N.; Hoffmann, D.; Berger, A.; Rabenau, H.; Widera, M.; Ackermann, N.; Konrad, R. Multicentre comparison of quantitative PCR-based assays to detect SARS-CoV-2, Germany, March 2020. Eurosurveillance 2020, 25, 2001057  DOI: 10.2807/1560-7917.ES.2020.25.24.2001057
      There is no corresponding record for this reference.
    18. 18
      Cottenet, G.; Blancpain, C.; Sonnard, V.; Chuah, P. F. Two FAST multiplex real-time PCR reactions to assess the presence of genetically modified organisms in food. Food Chem. 2019, 274, 760– 765,  DOI: 10.1016/j.foodchem.2018.09.050
      18
      Two FAST multiplex real-time PCR reactions to assess the presence of genetically modified organisms in food
      Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Veronique; Chuah, Poh Fong
      Food Chemistry (2019), 274 (), 760-765CODEN: FOCHDJ; ISSN:0308-8146. (Elsevier Ltd.)
      Methods to detect the presence of genetically modified organisms (GMOs) are evolving constantly to comply with legislation and include new transgenic traits developed by biotechnol. companies. Since traditional screening methods target only a limited no. of markers, not all GM-events can be detected easily. To cover a broader range, a new GMO screening method was developed, based on two real-time PCR reactions, targeting. (i) six major GM-markers and. (ii) six GM-events that do not contain these markers. This method used the FAST PCR technol. and allowed a further redn. in time-to-result. Using a wide array of ref. materials and proficiency test samples, the method showed a broad screening capacity and the abs. limit of detection was consistently below 20 copies, thereby demonstrating the method is fit-for-purpose.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslahu73O&md5=90ff69bd6758b693895c53895ea86a56
    19. 19
      Pazourkova, E.; Zednikova, I.; Korabecna, M.; Kralova, J.; Pisacka, M.; Novotna, M.; Calda, P.; Horinek, A. Optimization of diagnostic strategy for non-invasive cell-free foetal RHD determination from maternal plasma Vox Sang. 2021, 13099. DOI: 10.1111/vox.13099
      There is no corresponding record for this reference.
    20. 20
      Suwannakhon, N.; Pangeson, T.; Seeratanachot, T.; Mahingsa, K.; Pingyod, A.; Bumrungpakdee, W.; Sanguansermsri, T. Noninvasive prenatal screening test for compound heterozygous beta thalassemia using an amplification refractory mutation system real-time polymerase chain reaction technique. Hematol. Rep. 2019, 11, 8124  DOI: 10.4081/hr.2019.8124
      20
      Noninvasive prenatal screening test for compound heterozygous beta thalassemia using an amplification refractory mutation system real-time polymerase chain reaction technique
      Suwannakhon Narutchala; Pangeson Tanapat; Seeratanachot Teerapat; Mahingsa Khwanruedee; Pingyod Arunee; Bumrungpakdee Wanwipa; Sanguansermsri Torpong
      Hematology reports (2019), 11 (3), 8124 ISSN:2038-8322.
      We propose using a modified amplification refractory mutation system real-time polymerase chain reaction (ARMS RTPCR) technique to exclude the invasive prenatal diagnosis for a non-paternally inherited beta thalassemia mutation in couples atrisk for having a baby with CHBT. The ARMS RT-PCR method was performed for 36 at-risk couples by using isolated fetal cell-free DNA from maternal plasma. The modified ARMS RT-PCR primers targeted one of the following paternally inherited beta thalassemia mutation: -28 A→G, CD17 A→T, CD 26 G→A, IVS1-1 G→T and CD 41-42 -CTTT. The method could be successfully employed for NIPST starting with the 7(th) week of gestation. The results showed that 19 pregnant women were negative for PIBTM (53%). After an on-track and on-time of one year, including postnatal thalassemia blood tests, none of the babies showed symptoms or signs of beta thalassemia disease. We concluded that the modified ARMS RT-PCR method was an accurate, cost-effective and feasible method for use as a NIPST for at-risk couples with the potential of having a baby with CHBT.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MnksFCrsQ%253D%253D&md5=4ebe386640217e1c2efb4b1293f06705
    21. 21
      Huggett, J. F.; The dMIQE Group; Whale, A. S. The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin. Chem. 2020, 66, 1012– 1029,  DOI: 10.1093/clinchem/hvaa125
      21
      The Digital MIQE Guidelines Update: Minimum Information for Publication of Quantitative Digital PCR Experiments for 2020
      Huggett Jim F
      Clinical chemistry (2020), 66 (8), 1012-1029 ISSN:.
      Digital PCR (dPCR) has developed considerably since the publication of the Minimum Information for Publication of Digital PCR Experiments (dMIQE) guidelines in 2013, with advances in instrumentation, software, applications, and our understanding of its technological potential. Yet these developments also have associated challenges; data analysis steps, including threshold setting, can be difficult and preanalytical steps required to purify, concentrate, and modify nucleic acids can lead to measurement error. To assist independent corroboration of conclusions, comprehensive disclosure of all relevant experimental details is required. To support the community and reflect the growing use of dPCR, we present an update to dMIQE, dMIQE2020, including a simplified dMIQE table format to assist researchers in providing key experimental information and understanding of the associated experimental process. Adoption of dMIQE2020 by the scientific community will assist in standardizing experimental protocols, maximize efficient utilization of resources, and further enhance the impact of this powerful technology.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38fgs1Srsg%253D%253D&md5=99e07b40b9a700650740812b33b30e05
    22. 22
      Bustin, S. A.; Benes, V.; Garson, J. A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M. W.; Shipley, G. L. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611– 622,  DOI: 10.1373/clinchem.2008.112797
      22
      The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments
      Bustin, Stephen A.; Benes, Vladimir; Garson, Jeremy A.; Hellemans, Jan; Huggett, Jim; Kubista, Mikael; Mueller, Reinhold; Nolan, Tania; Pfaffl, Michael W.; Shipley, Gregory L.; Vandesompele, Jo; Wittwer, Carl T.
      Clinical Chemistry (Washington, DC, United States) (2009), 55 (4), 611-622CODEN: CLCHAU; ISSN:0009-9147. (American Association for Clinical Chemistry)
      A review. BACKGROUND: Currently, a lack of consensus exists on how best to perform and interpret quant. real-time PCR (qPCR) expts. The problem is exacerbated by a lack of sufficient exptl. detail in many publications, which impedes a reader's ability to evaluate critically the quality of the results presented or to repeat the expts. CONTENT: The Min. Information for Publication of Quant. Real-Time PCR Expts. (MIQE) guidelines target the reliability of results to help ensure the integrity of the scientific literature, promote consistency between labs., and increase exptl. transparency. MIQE is a set of guidelines that describe the min. information necessary for evaluating qPCR expts. Included is a checklist to accompany the initial submission of a manuscript to the publisher. By providing all relevant exptl. conditions and assay characteristics, reviewers can assess the validity of the protocols used. Full disclosure of all reagents, sequences, and anal. methods is necessary to enable other investigators to reproduce results. MIQE details should be published either in abbreviated form or as an online supplement. SUMMARY: Following these guidelines will encourage better exptl. practice, allowing more reliable and unequivocal interpretation of qPCR results.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXktVWqs7g%253D&md5=a5db2cfd34dae856784bc5f33aee0023
    23. 23
      Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2– ΔΔCT method. Methods 2001, 25, 402– 408,  DOI: 10.1006/meth.2001.1262
      23
      Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method
      Livak, Kenneth J.; Schmittgen, Thomas D.
      Methods (San Diego, CA, United States) (2001), 25 (4), 402-408CODEN: MTHDE9; ISSN:1046-2023. (Academic Press)
      The two most commonly used methods to analyze data from real-time, quant. PCR expts. are abs. quantification and relative quantification. Abs. quantification dets. the input copy no., usually by relating the PCR signal to a std. curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2-ΔΔCT method is a convenient way to analyze the relative changes in gene expression from real-time quant. PCR expts. The purpose of this report is to present the derivation, assumptions, and applications of the 2-ΔΔCT method. In addn., we present the derivation and applications of two variations of the 2-ΔΔCT method that may be useful in the anal. of real-time, quant. PCR data. (c) 2001 Academic Press.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XhtFelt7s%253D&md5=f849383250ea43f7380ed540db8a64b1
    24. 24
      Gubala, A. J. Multiplex real-time PCR detection of Vibrio cholerae. J. Microbiol. Methods 2006, 65, 278– 293,  DOI: 10.1016/j.mimet.2005.07.017
      24
      Multiplex real-time PCR detection of Vibrio cholerae
      Gubala, Aneta J.
      Journal of Microbiological Methods (2006), 65 (2), 278-293CODEN: JMIMDQ; ISSN:0167-7012. (Elsevier B.V.)
      Cholera is an important enteric disease, which is endemic to different regions of the world and has historically been the cause of severe pandemics. Vibrio cholerae is a natural inhabitant of the aquatic environment and the toxigenic strains are causative agents of potentially life-threatening diarrhea. A multiplex, real-time detection assay was developed targeting four genes characteristic of potentially toxigenic strains of V. cholerae, encoding: repeat in toxin (rtxA), extracellular secretory protein (epsM), mannose-sensitive pili (mshA) and the toxin coregulated pilus (tcpA). The assay was developed on the Cepheid Smart Cycler using SYBR Green I for detection and the products were differentiated based on melting temp. (T m) anal. Validation of the assay was achieved by testing against a range of Vibrio and non-Vibrio species. The detection limit of the assay was detd. to be 103 CFU using cells from pure culture. This assay was also successful at detecting V. cholerae directly from spiked environmental water samples in the order of 104 CFU, except from sea water which inhibited the assay. The incorporation of a simple DNA purifn. step prior to the addn. to the PCR increased the sensitivity 10 fold to 103 CFU. This multiplex real-time PCR assay allows for a more reliable, rapid detection and identification of V. cholerae which is considerably faster than current conventional detection assays.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xjs1Wlsb0%253D&md5=4d1e250eb2feb0027b9d272269e7ef59
    25. 25
      Waggoner, J. J.; Abeynayake, J.; Sahoo, M. K.; Gresh, L.; Tellez, Y.; Gonzalez, K.; Ballesteros, G.; Pierro, A. M.; Gaibani, P.; Guo, F. P. Single-reaction, multiplex, real-time rt-PCR for the detection, quantitation, and serotyping of dengue viruses. PLoS Neglected Trop. Dis. 2013, 7, e2116  DOI: 10.1371/journal.pntd.0002116
      25
      Single-reaction, multiplex, real-time RT-PCR for the detection, quantitation, and serotyping of dengue viruses
      Waggoner, Jesse J.; Abeynayake, Janaki; Sahoo, Malaya K.; Gresh, Lionel; Tellez, Yolanda; Gonzalez, Karla; Ballesteros, Gabriela; Pierro, Anna M.; Gaibani, Paolo; Guo, Frances P.; Sambri, Vittorio; Balmaseda, Angel; Karunaratne, Kumudu; Harris, Eva; Pinsky, Benjamin A.
      PLoS Neglected Tropical Diseases (2013), 7 (4), e2116CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)
      Background: Dengue fever results from infection with one or more of four different serotypes of dengue virus (DENV). Despite the widespread nature of this infection, available mol. diagnostics have significant limitations. The aim of this study was to develop a multiplex, real-time, reverse transcriptase-PCR (rRT-PCR) for the detection, quantitation, and serotyping of dengue viruses in a single reaction. Methodol./Principal Findings: An rRT-PCR assay targeting the 5' untranslated region and capsid gene of the DENV genome was designed using mol. beacons to provide serotype specificity. Using ref. DENV strains, the assay was linear from 7.0 to 1.0 log10 cDNA equiv./μL for each serotype. The lower limit of detection using genomic RNA was 0.3, 13.8, 0.8, and 12.4 cDNA equiv./μL for serotypes 1-4, resp., which was 6- to 275-fold more anal. sensitive than a widely used hemi-nested RT-PCR. Using samples from Nicaragua collected within the first five days of illness, the multiplex rRT-PCR was pos. in 100% (69/69) of specimens that were pos. by the hemi-nested assay, with full serotype agreement. Furthermore, the multiplex rRT-PCR detected DENV RNA in 97.2% (35/36) of specimens from Sri Lanka pos. for anti-DENV IgM antibodies compared to just 44.4% (16/36) by the hemi-nested RT-PCR. No amplification was obsd. in 80 clin. samples sent for routine quant. hepatitis C virus testing or when genomic RNA from other flaviviruses was tested. Conclusions/Significance: This single-reaction, quant., multiplex rRT-PCR for DENV serotyping demonstrates superior anal. and clin. performance, as well as simpler workflow compared to the hemi-nested RT-PCR ref. In particular, this multiplex rRT-PCR detects viral RNA and provides serotype information in specimens collected more than five days after fever onset and from patients who had already developed anti-DENV IgM antibodies. The implementation of this assay in dengue-endemic areas has the potential to improve both dengue diagnosis and epidemiol. surveillance.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsFaitbk%253D&md5=06c8bd64ca32e66a2e768100f773bd2a
    26. 26
      Zhang, H.; Li, H.; Zhu, H.; Pekárek, J.; Podešva, P.; Chang, H.; Neužil, P. Revealing the secrets of PCR. Sens. Actuators, B 2019, 298, 126924  DOI: 10.1016/j.snb.2019.126924
      26
      Revealing the secrets of PCR
      Zhang, Haoqing; Li, Huanan; Zhu, Hanliang; Pekarek, Jan; Podesva, Pavel; Chang, Honglong; Neuzil, Pavel
      Sensors and Actuators, B: Chemical (2019), 298 (), 126924CODEN: SABCEB; ISSN:0925-4005. (Elsevier B.V.)
      The polymerase chain reaction (PCR) method and its quant. variant (qPCR) were a landmark discovery for detection and quantification of small amts. of unambiguous DNAs (DNA) due to its enormous sensitivity and specificity. The current methods for qPCR protocol optimization provide no information of the PCR propagation during the cycles as only single data point is extd. at the end of each thermal cycles, limiting a thorough understanding of reaction details. In this study, we utilized the continuous fluorescence monitoring method to observe progress of the reaction in real time with over 100 data points per each cycle, thus gaining a profound insight into the PCR itself. This provided information about the real-time PCR status, dominating reactions and their completion/incompletion during each cycle as well as their reaction kinetics. We then adjusted the duration of either annealing or elongation steps to ensure their completion within each cycle, resulting in the protocol optimization with complete amplification, enhancing PCR efficiency and taking < 20 min to obtain max. product amt. The proposed method was verified using DNA with lengths of 177 base pairs (bp), 250 bp, and 400 bp. It can also be adopted for helping with qPCR troubleshooting as well as protocol optimizing just by reprogramming com. real-time PCR cyclers.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGnsrnK&md5=a7c4d71de0ba157760e531cc591b5188
    27. 27
      Ahrberg, C. D.; Manz, A.; Neuzil, P. Single fluorescence channel-based multiplex detection of avian influenza virus by quantitative PCR with intercalating dye. Sci. Rep. 2015, 5, 11479  DOI: 10.1038/srep11479
      There is no corresponding record for this reference.
    28. 28
      Zhu, H.; Zhang, H.; Ni, S.; Korabečná, M.; Yobas, L.; Neuzil, P. The vision of point-of-care PCR tests for the COVID-19 pandemic and beyond. TrAC, Trends Anal. Chem. 2020, 130, 115984  DOI: 10.1016/j.trac.2020.115984
      28
      The vision of point-of-care PCR tests for the COVID-19 pandemic and beyond
      Zhu, Hanliang; Zhang, Haoqing; Ni, Sheng; Korabecna, Marie; Yobas, Levent; Neuzil, Pavel
      TrAC, Trends in Analytical Chemistry (2020), 130 (), 115984CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B.V.)
      A review. Infectious diseases, such as the most recent case of coronavirus disease 2019, have brought the prospect of point-of-care (POC) diagnostic tests into the spotlight. A rapid, accurate, low-cost, and easy-to-use test in the field could stop epidemics before they develop into full-blown pandemics. Unfortunately, despite all the advances, it still does not exist. We critically review the limited no. of prototypes demonstrated to date that is based on a polymerase chain reaction (PCR) and has come close to fulfill this vision. We summarize the requirements for the POC-PCR tests and then go on to discuss the PCR product-detection methods, integration of their functional components, potential applications, and other practical issues related to the implementation of lab-on-a-chip technologies. We conclude our review with a discussion of the latest findings on nucleic acid-based diagnosis.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVOru7bF&md5=be67c4f8c13058ff3d70a3e9a8999b96
    29. 29
      Ahrberg, C. D.; Neužil, P. Doubling throughput of a real-time PCR. Sci. Rep. 2015, 5, 12595  DOI: 10.1038/srep12595
      29
      Doubling Throughput of a Real-Time PCR
      Ahrberg, Christian D.; Neuzil, Pavel
      Scientific Reports (2015), 5 (), 12595CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)
      The invention of polymerase chain reaction (PCR) in 1983 revolutionized many areas of science, due to its ability to multiply a no. of copies of DNA sequences (known as amplicons). Here we report on a method to double the throughput of quant. PCR which could be esp. useful for PCR-based mass screening. We concurrently amplified two target genes using only single fluorescent dye. A FAM probe labeled olionucleotide was attached to a quencher for one amplicon while the second one was without a probe. The PCR was performed in the presence of the intercalating dye SYBR Green I. We collected the fluorescence amplitude at two points per PCR cycle, at the denaturation and extension steps. The signal at denaturation is related only to the amplicon with the FAM probe while the amplitude at the extension contained information from both amplicons. We thus detected two genes within the same well using a single fluorescent channel. Any com. real-time PCR systems can use this method doubling the no. of detected genes. The method can be used for abs. quantification of DNA using a known concn. of housekeeping gene at one fluorescent channel.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhtlWhur%252FN&md5=8029b7090138185261a2d379de239068
    30. 30
      Rodriguez-Manzano, J.; Moniri, A.; Malpartida-Cardenas, K.; Dronavalli, J.; Davies, F.; Holmes, A.; Georgiou, P. Simultaneous single-channel multiplexing and quantification of carbapenem-resistant genes using multidimensional standard curves. Anal. Chem. 2019, 91, 2013– 2020,  DOI: 10.1021/acs.analchem.8b04412
      30
      Simultaneous Single-Channel Multiplexing and Quantification of Carbapenem-Resistant Genes Using Multidimensional Standard Curves
      Rodriguez-Manzano, Jesus; Moniri, Ahmad; Malpartida-Cardenas, Kenny; Dronavalli, Jyothsna; Davies, Frances; Holmes, Alison; Georgiou, Pantelis
      Analytical Chemistry (Washington, DC, United States) (2019), 91 (3), 2013-2020CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
      Multiplexing and quantification of nucleic acids, both have, in their own right, significant and extensive use in biomedical related fields. Currently, the ability to detect several nucleic acid targets in a single-reaction scales linearly with the no. of targets; an expensive and time-consuming feat. Here, we propose a new methodol. based on multidimensional std. curves that extends the use of real-time PCR data obtained by common qPCR instruments. By applying this novel methodol., we achieve simultaneous single-channel multiplexing and enhanced quantification of multiple targets using only real-time amplification data. This is obtained without the need of fluorescent probes, agarose gels, melting curves or sequencing anal. Given the importance and demand for tackling challenges in antimicrobial resistance, the proposed method is applied to four of the most prominent carbapenem-resistant genes: blaOXA-48, blaNDM, blaVIM, and blaKPC, which account for 97% of the UK's reported carbapenemase-producing Enterobacteriaceae.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXms1elsA%253D%253D&md5=ca5c3deb2c1008e0418884e57dcf5acf
    31. 31
      Moniri, A.; Rodriguez-Manzano, J.; Malpartida-Cardenas, K.; Yu, L.-S.; Didelot, X.; Holmes, A.; Georgiou, P. Framework for DNA quantification and outlier detection using multidimensional standard curves. Anal. Chem. 2019, 91, 7426– 7434,  DOI: 10.1021/acs.analchem.9b01466
      31
      Framework for DNA Quantification and Outlier Detection Using Multidimensional Standard Curves
      Moniri, Ahmad; Rodriguez-Manzano, Jesus; Malpartida-Cardenas, Kenny; Yu, Ling-Shan; Didelot, Xavier; Holmes, Alison; Georgiou, Pantelis
      Analytical Chemistry (Washington, DC, United States) (2019), 91 (11), 7426-7434CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
      Real-time PCR is a highly sensitive and powerful technol. for the quantification of DNA and has become the method of choice in microbiol., bioengineering and mol. biol. Currently, the anal. of real-time PCR data is hampered by only considering a single feature of the amplification profile to generate a std. curve. The current "gold std." is the cycle-threshold (Ct) method which is known to provide poor quantification under inconsistent reaction efficiencies. Multiple single-feature methods have been developed to overcome the limitations of the Ct method, however, there is an unexplored area of combining multiple features in order to benefit from their joint information. Here, the authors propose a novel framework that combines existing std. curve methods into a multidimensional std. curve. This is achieved by considering multiple features together such that each amplification curve is viewed as a point in a multidimensional space. Contrary to only considering a single-feature, in the multidimensional space, data points do not fall exactly on the std. curve, which enables a similarity measure between amplification curves based on distances between data points. The authors show that this framework expands the capabilities of std. curves in order to: optimize quantification performance, provide a measure of how suitable an amplification curve is for a std., and thus automatically detect outliers and increase the reliability of quantification. The aim is to provide an affordable soln. to enhance existing diagnostic settings through maximizing the amt. of information extd. from conventional instruments.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXovVKgtbw%253D&md5=50a38da1855a1f94d2c903ce2f773cff
    32. 32
      Moniri, A.; Miglietta, L.; Malpartida-Cardenas, K.; Pennisi, I.; Cacho-Soblechero, M.; Moser, N.; Holmes, A.; Georgiou, P.; Rodriguez-Manzano, J. Amplification curve analysis: data-driven multiplexing using real-time digital PCR. Anal. Chem. 2020, 92, 13134– 13143,  DOI: 10.1021/acs.analchem.0c02253
      32
      Amplification Curve Analysis: Data-Driven Multiplexing Using Real-Time Digital PCR
      Moniri, Ahmad; Miglietta, Luca; Malpartida-Cardenas, Kenny; Pennisi, Ivana; Cacho-Soblechero, Miguel; Moser, Nicolas; Holmes, Alison; Georgiou, Pantelis; Rodriguez-Manzano, Jesus
      Analytical Chemistry (Washington, DC, United States) (2020), 92 (19), 13134-13143CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)
      Information about the kinetics of PCR reactions is encoded in the amplification curve. However, in digital PCR (dPCR), this information is typically neglected by collapsing each amplification curve into a binary output (pos./neg.). Here, we demonstrate that the large vol. of raw data obtained from real-time dPCR instruments can be exploited to perform data-driven multiplexing in a single fluorescent channel using machine learning methods, by virtue of the information in the amplification curve. This new approach, referred to as amplification curve anal. (ACA), was shown using an intercalating dye (EvaGreen), reducing the cost and complexity of the assay and enabling the use of melting curve anal. for validation. As a case study, we multiplexed 3 carbapenem-resistant genes to show the impact of this approach on global challenges such as antimicrobial resistance. In the presence of single targets, we report a classification accuracy of 99.1% (N = 16188), which represents a 19.7% increase compared to multiplexing based on the final fluorescent intensity. Considering all combinations of amplification events (including coamplifications), the accuracy was shown to be 92.9% (N = 10383). To support the anal., we derived a formula to est. the occurrence of coamplification in dPCR based on multivariate Poisson statistics and suggest reducing the digital occupancy in the case of multiple targets in the same digital panel. The ACA approach takes a step toward maximizing the capabilities of existing real-time dPCR instruments and chemistries, by extg. more information from data to enable data-driven multiplexing with high accuracy. Furthermore, we expect that combining this method with existing probe-based assays will increase multiplexing capabilities significantly. We envision that once emerging point-of-care technologies can reliably capture real-time data from isothermal chemistries, the ACA method will facilitate the implementation of dPCR outside of the lab.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhvVGjtrjP&md5=7df1aedf67404095737d8f345272e6ff
    33. 33
      Wang, C.; Gao, D.; Vaglenov, A.; Kaltenboeck, B. One-step real-time duplex reverse transcription PCRs simultaneously quantify analyte and housekeeping gene mRNAs. Biotechniques 2004, 36, 508– 519,  DOI: 10.2144/04363RN06
      33
      One-step real-time duplex reverse transcription PCRs simultaneously quantify analyte and housekeeping gene mRNAs
      Wang, Chengming; Gao, Dongya; Vaglenov, Alexander; Kaltenboeck, Bernhard
      BioTechniques (2004), 36 (3), 508-514, 516, 518-519CODEN: BTNQDO; ISSN:0736-6205. (Eaton Publishing Co.)
      The authors developed a one-step real-time duplex reverse transcription PCR (RT-PCR) method using the LightCycler platform. This method allows simultaneous reverse transcription and real-time PCR amplification of two mRNAs of specific genes of interest (analyte genes) and mRNA of constantly transcribed genes (housekeeping genes) in a single-tube reaction. Specimen total nucleic acids were used because eukaryotic cDNA is discriminated from genomic DNA using exon-spanning primers and/or fluorescence resonance energy transfer (FRET) probes. Transcripts of murine arginase I and hypoxanthine-phosphoribosyl transferase (HPRT; housekeeping gene) or murine arginase II analyte and porphobilinogen deaminase (PBGD; housekeeping gene) were quantified in such duplex RT-PCRs. Twenty-minute reverse transcription reactions at 55° followed by 18 high-stringency step-down thermal cycles and 25 relaxed-stringency fluorescence acquisition cycles produced sensitive and accurate RT-PCR results. Fluorescent signal spillover between channels was fully compensated. A matrix of duplex PCRs at variable ratios of target stds. yielded equations for factors that correct PCR-specific target ratio-dependent deviations in quantification. The one-step real-time duplex RT-PCRs reliably and accurately detd. 10-10,000 copies of each target over a 100,000-fold range of target copy ratios (analyte to housekeeping mRNA = 10-2.5-102.5) in a single assay.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXitlertL0%253D&md5=06292dd2c0379a07c9d5a4ece418d642
    34. 34
      Tan, C.; Chen, X.; Wang, F.; Wang, D.; Cao, Z.; Zhu, X.; Lu, C.; Yang, W.; Gao, N.; Gao, H. J. A. A multiplex droplet digital PCR assay for non-invasive prenatal testing of fetal aneuploidies. Analyst 2019, 144, 2239– 2247,  DOI: 10.1039/C8AN02018C
      34
      A multiplex droplet digital PCR assay for non-invasive prenatal testing of fetal aneuploidies
      Tan, Chianru; Chen, Xihua; Wang, Fang; Wang, Dong; Cao, Zongfu; Zhu, Xiurui; Lu, Chao; Yang, Wenjun; Gao, Na; Gao, Huafang; Guo, Yong; Zhu, Lingxiang
      Analyst (Cambridge, United Kingdom) (2019), 144 (7), 2239-2247CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)
      Higher multiplexing in droplet digital PCR (ddPCR) can simplify the detection process of ddPCR-based non-invasive prenatal testing (NIPT) and improve its reliability, making it a practical approach in clin. practice. However, a high level of multiplex ddPCR-based NIPT has rarely been reported. In this study, we developed a multiplex ddPCR assay using universal locked nucleic acid (LNA) probes to reliably identify fetal aneuploidies. We first performed statistical anal. based on the Poisson distribution to evaluate the required no. of target DNA mols. and the total no. of droplets for a ddPCR assay. Next, we designed two sets of primers and probes to quantify cfDNA from chromosomes 21 and 18 and then detd. the disease status of a sample. Finally, we evaluated our multiplex ddPCR assay with 60 clin. plasma samples. All of the 60 clin. samples were correctly identified. The accessibility and cost-effectiveness of our multiplex ddPCR-based NIPT make it a competitive prenatal testing method in clin. use.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXkvVOqsw%253D%253D&md5=f1294d218a673c97c734bb2678e66824
    35. 35
      Liu, W.; Saint, D. A. Validation of a quantitative method for real time PCR kinetics. Biochem. Biophys. Res. Commun. 2002, 294, 347– 353,  DOI: 10.1016/S0006-291X(02)00478-3
      35
      Validation of a quantitative method for real time PCR kinetics
      Liu, Weihong; Saint, David A.
      Biochemical and Biophysical Research Communications (2002), 294 (2), 347-353CODEN: BBRCA9; ISSN:0006-291X. (Elsevier Science)
      Real time RT-PCR is the most sensitive method for quantitation of gene expression levels. The accuracy can be dependent on the math. model on which the quant. methods are based. The generally accepted math. model assumes that amplification efficiencies are equal at the exponential phase of the reactions for the same amplicon. However, no methods are available to test the assumptions regarding amplification efficiency before one starts the real time PCR quantitation. Here we further develop and test the validity of a new math. model which dynamically fits real time PCR data with good correlation (R2=0.9995±0.002, n=50). The method is capable of measuring cycle-by-cycle PCR amplification efficiencies and demonstrates that these change dynamically. Validation of the method revealed the intrinsic relationship between the initial amt. of gene transcript and kinetic parameters. A new quant. method is proposed which represents a simple but accurate quant. method.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XktlGrsLo%253D&md5=913195753ead41917be71b152f2d5975
    36. 36
      Rutledge, R. Sigmoidal curve-fitting redefines quantitative real-time PCR with the prospective of developing automated high-throughput applications. Nucleic Acids Res. 2004, 32, e178  DOI: 10.1093/nar/gnh177
      36
      Sigmoidal curve-fitting redefines quantitative real-time PCR with the prospective of developing automated high-throughput applications
      Rutledge, R. G.
      Nucleic Acids Research (2004), 32 (22), e178/1-e178/8CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)
      Quant. real-time PCR has revolutionized many aspects of genetic research, biomedical diagnostics and pathogen detection. Nevertheless, the full potential of this technol. has yet to be realized, primarily due to the limitations of the threshold-based methodologies that are currently used for quant. anal. Prone to errors caused by variations in reaction prepn. and amplification conditions, these approaches necessitate construction of std. curves for each target sequence, significantly limiting the development of high-throughput applications that demand substantive levels of reliability and automation. In this study, an alternative approach based upon fitting of fluorescence data to a four-parametric sigmoid function is shown to dramatically increase both the utility and reliability of quant. real-time PCR. By math. modeling individual amplification reactions, quantification can be achieved without the use of std. curves and without prior knowledge of amplification efficiency. Combined with provision of quant. scale via optical calibration, sigmoidal curve-fitting could confer the capability for fully automated quantification of nucleic acids with unparalleled accuracy and reliability.
      >> More from SciFinder ®
      https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXkt1altg%253D%253D&md5=684ce0b8261f252e3b365015e84b6906

  • Supporting Information

    Supporting Information

    The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.1c02971.

    • Standard curves of single genes, amplicon ratios of Chr21 and Chr18 with Chr21 variable, MCAs between Chr21 with the FAM probe and Chr18 having cn18 with three different values and cn21 variable, amplicon ratios of Chr21 and Chr18 with Chr18 variable and MCA after PCR, amplicon ratios of Chr21 and Chr18, and PCR master mix (PDF)


    Terms & Conditions

    Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.