Aptamer-Based Sensing of Small Organic Molecules by Measuring Levitation Coordinate of Single Microsphere in Combined Acoustic–Gravitational Field
- Akihisa MiyagawaAkihisa MiyagawaDepartment of Chemistry, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551, JapanMore by Akihisa Miyagawa,
- Yusuke OkadaYusuke OkadaDepartment of Chemistry, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551, JapanMore by Yusuke Okada, and
- Tetsuo Okada*Tetsuo Okada*E-mail: [email protected]Department of Chemistry, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551, JapanMore by Tetsuo Okada
Copyright © 2020 American Chemical Society
Abstract
We present aptamer-based sensing using a coupled acoustic-gravitational (CAG) field, which transduces a change in the density of a microparticle (MP) to a change in the levitation coordinate. A large density of the MP is initially induced by the binding of gold nanoparticles (AuNPs) on the MP through sandwich hybridization with aptamer DNA molecules. Targets added to the system interact with the aptamer DNA molecules to form complexes, and the duplex between the aptamer and the probe DNA molecules is dissociated. This leads to the release of AuNPs from the MP and a decrease in its density. As the target concentration increases, the levitation coordinate of the MP increases. From the levitation coordinate shift, we can determine the target concentration. The detection limits for adenosine triphosphate, dopamine, and ampicillin as test targets are 9.8 nM, 17 nM, and 160 pM, respectively. The dissociation constants for the aptamer–target complexes are quantitatively determined from the dependence of the levitation coordinate on the target concentration. This scheme is a useful analytical tool not only for the trace analyses of targets but also for the evaluation of aptamer–target interactions.
Introduction
ARTICLE SECTIONS
Aptamers, which are single-stranded DNA or RNA molecules comprising 10–100 nucleotides, can selectively bind targets such as metal ions, small organic molecules, peptides, proteins, and cells with high affinity and specificity. Aptamers are mostly identified by in vitro selections, that is, the systematic evolution of ligands by exponential enrichment (SELEX). Aptamers allow versatile designs of efficient analytical methods, which have many advantages over antibody-based systems, for example, high thermal stability, ease of handling and synthesis, low immunogenicity, low toxicity, and reusability.(1−5) For these reasons, aptamers have received much attention in various fields such as clinical diagnosis, forensics, food safety, and environmental science, and various bioanalytical schemes have been proposed based on aptamer chemistry.
Aptamer-based sensing often utilizes the conformation changes of aptamer molecules, which can be classified into simple binding, folding, and structure switching.(5) In the simple binding methods, the binding between aptamers and targets is detected in the form of changes in electrochemical signals, fluorescence intensity, mass, and refractive index.(6−8) The aptamer folding is modified by the formation of an aptamer–target complex, which changes, for example, the fluorescence intensity.(9,10) Stojanovic et al. reported a fluorescence sensor for cocaine using aptamer folding.(11) In this method, the ends of the aptamer molecules were labeled with a fluorophore and quencher. Whereas the fluorescence signal was observed in the absence of cocaine because the fluorophore and quencher were located apart, the fluorescence decreased in the presence of cocaine because the aptamer folding owing to the cocaine complex formation forced the fluorophore and quencher to come together. However, this detection scheme is limited to the cases where the head–tail contact of the aptamer is induced by its complexation. In contrast, structure switching, which uses the duplex dissociation between the aptamer and complementary DNA by the interaction of the aptamer with the target, allows more versatile designs of biosensing.(6,12,13) Lu et al., for example, proposed a detection scheme for human thrombin using this approach and demonstrated a detection limit at the nanomolar (nM) level.(14) Graphene oxide, which acts as a fluorescence quencher, effectively adsorbs single-strand aptamer DNA. The complexation of a target with the aptamer causes the desorption of the aptamer from the graphene oxide surface. This entire process enhances fluorescence. Structure switching also involves the duplex dissociation between the aptamer and complementary DNA molecules in the presence of a target. This approach was applied to various detection schemes also.
The schematic design and sensitivity of aptamer-based sensors largely rely on the stability of the aptamer–target complex. A number of methods have been developed for the determination of the dissociation constants (Kd) of aptamer–target complexes, which include surface plasmon resonance (SPR) and electrophoresis.(15−18) Win et al. determined the Kd values for the codeine–aptamer complexes using a direct coupling SPR assay.(19) Two most stable aptamers, with Kd = 2.50 and 4.00 μM, were found from the sequences generated using an iterative in vitro selection process. Lee et al. reported an aptamer DNA-based SPR biosensor for the retinol binding protein 4 (RBP4).(20) The label-free RBP4 detection was performed using SPR with an aptamer-immobilized gold chip. Gong et al. reported the determination of Kd for a thrombin–aptamer complex using microchip capillary electrophoresis, in which the peak ratio of free and bound aptamers is used to obtain Kd.(21)
We demonstrated the label-free sensing of DNA and microRNA molecules based on the levitation coordinate shifts of a single microparticle (MP) in a combined acoustic–gravitational (CAG) field.(22,23) MPs are levitated in the CAG field at different coordinates according to their acoustic properties (density and compressibility). The density change of the MP, which was induced by the binding of gold nanoparticles (AuNPs) through DNA or RNA sandwich hybridization, caused the levitation coordinate shifts of the MP in the CAG field.(22,23) This method allowed the zeptomole (zmol) detection of DNA and microRNA. We also evaluated the kinetics involved in the avidin–biotin reaction in the CAG field.(24) Thus, this approach is efficient not only for highly responsive sensing applications but also for the evaluation of the reaction involved in detection schemes. The utilization of aptamers is expected to enhance the usefulness of this method and significantly extend its applicability. In this paper, we propose a highly versatile detection scheme based on the MP levitation in a CAG field using aptamer DNA molecules. Aptamer DNA mediates the binding between an MP and AuNPs through sandwich hybridization. The interaction between the target and aptamer induces the dissociation of the duplex, and AuNPs are released from the MP. Thus, the density of the MP becomes lower, and its levitation coordination thereby shifts according to the target concentration. Further, this method allows the quantitative evaluation of the complexation between the aptamer and target molecules from the levitation behavior of the MP.
Result and Discussion
ARTICLE SECTIONS
Sensing Principle
The levitation coordinate of an MP, z, in the CAG field is given by(22−28)
(1)
(2)
(3)where λ is the ultrasound wavelength, Eac is the average ultrasound energy density, a is a device-dependent parameter, V is the voltage applied to the transducer, g is the gravitational acceleration, and ρ and γ are the density and compressibility of the medium (water in the present case), respectively. The prime represents the corresponding properties of the MP. Eq 1 suggests that z is a function of the particle density and compressibility. Thus, any change in the acoustic properties of the MP can be evaluated from the shift of z.
(1)(2)(3)where λ is the ultrasound wavelength, Eac is the average ultrasound energy density, a is a device-dependent parameter, V is the voltage applied to the transducer, g is the gravitational acceleration, and ρ and γ are the density and compressibility of the medium (water in the present case), respectively. The prime represents the corresponding properties of the MP. Eq 1 suggests that z is a function of the particle density and compressibility. Thus, any change in the acoustic properties of the MP can be evaluated from the shift of z.Figure 1 shows the relationship between V and z of PMMAs with different densities, that is, 1.188 and 1.265 g cm–3. Because Eac is proportional to V2, as indicated by eq 3, a decrease in V lowers the levitation coordinate of the MP. When the acoustic radiation force becomes smaller than the threshold value (Vth), the MP is no longer levitated. The levitation coordinate difference between the PMMAs with different densities increases with decreasing V and is, therefore, maximized at Vth. The solid curves represent the results of curve-fitting based on eq 1 with a as the fitting parameter. The compressibility was assumed to be the same for both PMMAs (γ′ = 1.54 × 10–10 Pa–1). Curve fitting yielded a = 0.0408 and 0.0388 for low- and high-density PMMAs, respectively. Because the a values determined for different MPs almost agreed with each other, the average value, a = 0.040, is applied to the results as discussed below.
Figure 1
Figure 1. Relationships between the voltage applied to the transducer (V) and the levitation coordinates of PMMAs with different densities: (A) 1.188 and (B) 1.265 g cm–3. Solid curves were calculated using eq 1 with the fitting parameter a = 0.0408 and 0.0388 for A and B, respectively. Vth represents the threshold V values for the PMMAs, below which the particles do not levitate.
As shown in our previous work, the levitation coordinate of an MP is dominantly determined by its density rather than compressibility when the density of the MP is modified by the binding of the AuNPs.(24,25) The AuNP possesses two orders of magnitude smaller compressibility than the polymer MP, and therefore, the contribution from the former to the entire compressibility is negligible even though AuNPs cover the entire surface of the MP.(25) In this study, AuNP-bound PMMAs were prepared through complementary hybridization between the aptamer DNA and probe DNA anchored on the particles as illustrated in Figure 2. When the AuNP-bound PMMAs are treated with the target molecule, the aptamer DNA interacts with the target and the duplex between the aptamer and probe DNAs is dissociated. The release of AuNPs from the AuNP-bound PMMA lowers its density, and thereby, z increases according to the amount of target added to the system. Magnetic levitation (MagLev) is also an efficient method for measuring the density of a particle.(29) MagLev has higher density resolution (10–2–10–6 g cm–3) than the present acoustic levitation. However, magnetic levitation requires a paramagnetic medium, such as Mn2+ or Gd3+, and, therefore, has limited applicability to biological reactions. In addition, MagLev is typically applied to millimeter (mm)-sized materials. Because AuNP-binding induces a larger density change on smaller particles, the use of microparticle is advantageous for sensitive sensing of AuNP binding. From these standpoints, acoustic levitation is suitable for the present purpose.
Figure 2
Figure 2. Schematic representation of aptamer-based sensing in the CAG field.
In this study, all of the measurements were conducted at V = 7.5 V, that is, Eac = 2.25 J m–3. Although a lower value of V is advantageous for high sensitivity, this voltage was selected to obtain stable levitation; at lower voltage, the levitation coordinate was changed with time. Figure S1 in the Supporting Information shows the calculated relationship between the number of AuNPs bound on a PMMA (nAuNP/PMMA) and the difference in z between the bare and AuNP-bound PMMAs (Δz) at V = 7.5 V. A linear relationship was confirmed in the range of nAuNP/PMMA = 0–6000. As noted above, a decrease in the density of the AuNP-bound PMMA is induced by the aptamer–target complexation in this study. Therefore, the target concentration can be determined from a decrease in Δz. The linear relationship shown in Figure S1 confirms the reasonability of the principle of the present approach.
Aptamer-Based Sensing of Target Molecules
Adenosine triphosphate (ATP) plays a critical role in the regulation of cellular metabolism.(30−33) The shortage of ATP causes various diseases such as angiocardiopathy, hypoglycemia, ischemia, and Parkinson’s disease. Dopamine (DA) is a vital neurotransmitter that plays a significant role in the functioning of our memory, behavior, sleep, and cognition.(34−36) The low concentration of DA is related to Parkinson’s disease, attention deficit hyperactivity disorder, and schizophrenia. Therefore, the efficient sensing of these compounds of physiological importance is strongly required in biomedical monitoring. Further, ampicillin (AMP) is widely used to treat infectious bacterial diseases such as pneumonia, gonorrhea, bronchitis, and venereal diseases because of its broad spectrum and low cost.(37,38) However, there are several side effects such as skin rashes, dizziness, and diarrhea. Thus, the development of the effective sensing of AMP is also a crucial task.
Aptamer-mediated AuNP-bound PMMAs were treated with various concentrations of the target, that is, ATP, DA, or AMP. The interaction between the aptamer and target induces the dissociation of the binding between the PMMA and AuNP, and Δz decreases as a result. Figure 3 shows the relationships between the logarithmic concentration of ATP, DA, and AMP (log c) and Δz of the PMMA. The levitation of the PMMA was repeatedly measured five times; the error bars in Figure 3 are given based on the standard deviations (σ). The errors in the Δz measurements originate from the deviations of the PMMA size, difference in the ratio of the AuNP-binding between PMMAs, and the instability of the acoustic field. The first factor becomes marginal as the size of the MP increases. In contrast, the sensitivity is higher for smaller MPs because a larger density change is induced by binding of AuNPs. Hence, the size of MP should be optimized taking these two different size dependencies into consideration; the present size (d ∼ 10 μm) was thus determined.(24) We confirmed that the acoustic field instability comes not from a temperature change but from a change in the acoustic resonance conditions in the entire instrumental system. It was difficult to keep exactly the same resonance conditions for different measurements; the deviations of Δz mainly arise from this factor. Evidently, Δz decreases with increasing log c in a sigmoidal manner. The limit of detection (LOD) was determined from 3σ for Δz of the probe PMMA in the absence of the target. The details for the determination of LOD are given in Figure S2 and related descriptions in Supporting Information. The LODs for ATP, DA, and AMP were 9.8 nM, 17 nM, and 160 pM, respectively. This means that 3.2 × 108 ATP, 5.5 × 108 DA, and 5.0 × 106 AMP molecules are detectable per single PMMA.
Figure 3
Figure 3. Relationships between the logarithmic concentration target (log c) and Δz for ATP (blue), DA (red), and AMP (black). The red dashed line represents the average maximum Δz at rPMMA/AuNP = 10,000.
Figure 4 shows FE-SEM images of AuNP-bound PMMAs designed for ATP detection. The particles are compared after reactions with 1 nM and 1 mM ATP. Almost no AuNPs are seen on the PMMA after the reaction with 1 mM ATP, whereas a number of AuNPs remain on the PMMA when treated with 1 nM ATP. Thus, the FE-SEM observation revealed that AuNPs bound on the PMMA were effectively released by the duplex dissociation caused by the reaction of the aptamer with ATP. In this work, the number ratio of AuNPs to PMMA in a sample solution (rAuNP/PMMA) was maintained at 10,000. The surface coverage of AuNPs on the PMMA should be 25% assuming the complete reaction between AuNPs and PMMA. However, as shown in Figure 4, the number of AuNPs on the PMMA was smaller than that expected from the complete binding. This arises from the incomplete binding of AuNPs as well as the loss of AuNPs during the sample preparation for FE-SEM such as filtering, washing, and sputtering. Therefore, the use of FE-SEM for determining of the number of AuNPs bound on a PMMA was not appropriate. We evaluated the actual number of AuNPs bound on a PMMA (nAuNP/PMMA) from Δz. At rAuNP/PMMA = 10,000, the measured Δz was 71 ± 5.2 μm. The linear relationship between Δz and nAuNP/PMMA shown in Figure S1 is represented by the equation Δz = 1.48 × 10–2nAuNP/PMMA. From this relation, we confirmed that nAuNP/PMMA = 4736 ± 338 for Δz = 71 ± 5.2 μm. This indicates that the reaction ratio of AuNPs was 47% under the present condition. The surface coverage of AuNPs on the PMMA is thus 12% at rAuNP/PMMA = 10,000. Thus, the present scheme shown in Figure 2 works well, as expected.
Figure 4
Figure 4. FE-SEM images of PMMAs for ATP at (A) c = 1 nM and (B) c = 1 mM.
Application to a Blood Sample
The present method was applied to the determination of ATP in swine blood. The blood was diluted 104 times with water. The known amounts of ATP were spiked to the diluted blood. AuNP-bound PMMAs mediated by the ATP-aptamer DNA molecules (rAuNP/PMMA = 10,000) were added to the diluted blood and spiked samples, and Δz values were measured for resulting PMMAs in the CAG field. Figure 5 compares the calibration graphs obtained for the diluted blood and for aqueous ATP standard solutions. The Δz values were converted into the ratio of the aptamer molecules that reacted with ATP. This value was plotted against the logarithmic concentration of ATP in this figure. The plots for the standard solutions prepared in water almost overlapped with that prepared in diluted swine blood, suggesting that the blood matrices did not interfere with the present detection scheme.
Figure 5
Figure 5. Calibration graphs for ATP in swine blood. Black open circles; standard solutions prepared in water. Red solid circles; standard solution prepared in diluted swine blood.
From the calibration graph, the ATP concentration in the diluted swine blood was determined to be 17.6 nM; the original blood contained 176 μM ATP. The concentration of ATP was also determined by a luciferase assay to validate this concentration; this method also requires 104 times dilution of the blood sample. The luminescence measurement gave 202 μM ATP in the original blood. The agreement between these two values indicates that the present scheme is applicable to real samples without pretreatments.
The incubation time of 4 h in the present method can be a disadvantage for practical purposes. We did not attempt to reduce the incubation time because applications are not the main purpose of the present work. Our previous work(24) indicates that the long incubation time originates from the low diffusion nature of the particles and that the reduction of the time results in incomplete reactions (in the present case, the incomplete dissociation of AuNPs from PMMA). However, because the reproducibility rather than incomplete reactions is crucial in practical analyses, the incubation time can be substantially reduced. This is a task for facilitating practical applications.
Equilibrium Model in Aptamer Sensing
As shown in Figure 2, AuNPs, which are bound on the PMMA through hybridization by the aptamer DNA, are released by the interaction between the aptamer and its target molecule. Therefore, the sensitivity of the present scheme is determined by the balance between the sandwich hybridization strength and the stability of the aptamer–target complex. Figure 6 summarizes the equilibria involved in the present scheme. The present results were analyzed using this equilibrium model. The amount of capture DNA anchored on the PMMAs (A) was fluorometrically determined to be 1.6 × 107 molecules per particle using FITC-labeled complementary DNAs. All the capture DNA molecules can be involved in the interparticle hybridization. In contrast, only one reporter DNA molecule on an AuNP takes part in the interparticle hybridization in the presence of the aptamer, and the rest remain free after the completion of the interparticle hybridization. Because of the dominant population of AuNPs over PMMAs in a reaction solution, AuNP-bridged PMMA aggregation was not observed. Therefore, the concentration of C depicted in Figure 6 can be considered to be equal to that of AuNPs. Figure S3 shows the relationship between log K1 and the number of AuNPs bound on a PMMA at rAuNP/PMMA = 10,000. As shown above, because nAuNP/PMMA = 4736 ± 338, K1 was determined to be 1.58 × 1020 M–2.
Figure 6
Figure 6. Equilibrium models of aptamer-based sensing. (A)–(F) represent (A) capture probe DNA anchored on PMMA, (B) aptamer, (C) AuNP with probe DNA, (D) duplex between the aptamer and probe DNA molecules, (E) target, and (F) aptamer–target complex.
Figure 7 shows the relationship between log c and the reaction ratios for three aptamer-target combinations. The sigmoidal curves shown in Figure 7 were calculated assuming K2 = 1.00 × 10–11 M for AMP and 1.58 × 10–13 M for DA and K2 = 3.98 × 10–14 M for ATP. Because the dissociation constant of the aptamer and the target, K3, is given by K3 = 1/(K1K2), its values are 6.33 × 10–10, 4.00 × 10–8, and 1.59 × 10–7 M–1 for AMP, DA, and ATP, respectively. All of these dissociation constants are larger than the corresponding reported values.(39−41) The affinity between the target and the aptamer DNA as well as the strength of the DNA duplex formation is influenced by the buffer salt concentration and/or composition.(42−45) For example, Baldrich et al. reported that the structure of thrombin-binding aptamer (TBA) depends on the types of salt added to the system.(42) Although the TBA–thrombin complex was stable in the presence of KCl, the addition of Na+ or Mg2+ disrupted the formation of the complex. On the other hand, Munzar et al. reported that the hybridization affinity of the aptamer–complementary DNA duplex increases with the increasing concentration of ions in the buffer.(44) Thus, the aptamer–target complexation and formation of an aptamer duplex depend on various factors involving types and concentrations of salts. Therefore, a simple comparison of the dissociation constants for the aptamer–target complexation is difficult. The results discussed here indicate that the present method can be an efficient tool for the evaluation of the aptamer–target complexation.
Figure 7
Figure 7. Relationships between the logarithmic target concentration (log c) and the reaction ratios of aptamers-targets calculated from Δz shown in Figure 3. Symbols: ATP: blue dots, DA: red dots, and AMP: black dots. Curves represent the results of calculation assuming K1 = 1.58 × 1020 M–2, K2 = 1.00 × 10–11 for AMP, 1.58 × 10–13 for DA, and 3.98 × 10–14 M for ATP.
Basically, 1:1 aptamer–target binding was assumed for the explanation of the experimental results shown in Figure 6. However, it was reported that the ATP aptamer has two binding sites.(45,46) A calculation was also attempted by considering 1:2 (aptamer: ATP) complexation for ATP, as shown in Figure S4. Evidently, the calculated curve departs from the experimental plots and cannot explain the experimental results better than the 1:1 binding assumption. Thus, the 1:1 complexation between the ATP and aptamer is reasonable in the present case.
Conclusions
ARTICLE SECTIONS
We proposed aptamer-based sensing for ATP, DA, and AMP as test targets using the CAG field. In this scheme, the duplex of aptamer–complementary DNA is dissociated through aptamer–target complexation, and Δz in the CAG field decreases as a result. The detection limit ranges from picomolar (pM) to nanomolar (nM) depending on the affinity between the aptamer and the target. This scheme also allows us to evaluate the dissociation constants of the aptamer–target complexes without labeling. This is another advantage of the present scheme.
Aptamer DNAs have been developed for inorganic ions (K+, Hg2+, and so on), organic molecules (cocaine, ibuprofen, and so on), large biomolecules (peptides and proteins), and microorganisms (bacteria and cells). The present sensing scheme was designed so that the aptamer crosslinks the two probe DNA molecules anchored on the PMMA and AuNP to yield the AuNP-bound PMMA. This scheme can be extended to any similar system simply by changing the sequence of aptamer and complimentary probe DNA molecules. Further, simultaneous detection of multiple targets is possible using MPs of different sizes, as reported in the case of microRNA detection in our previous work.(23) Simultaneous detection is necessary to provide reliable diagnoses under conditions such as inflammation, fungal infection, and toxin accumulation. Thus, the application of the present scheme to a wide range of fundamental and practical fields, including biochemistry, environmental science, and medical diagnoses, is expected.
Experimental Section
ARTICLE SECTIONS
The instrument used in this study was basically the same as that employed in our previous work.(22−28)Figure S5 shows a photo of the instrumental setup. The levitation of an MP was measured in a silica glass cell (of 30 mm length, 8 mm width, and 12.62 mm height) with a rectangular channel (of 3.0 mm width and 1.5 mm height) pasted on a transducer (2 cm × 2 cm lead zirconate titanate, resonance frequency of 500 kHz, Fuji Ceramics). The resonance frequency was 453 kHz under experimental conditions. A diluted MP suspension was introduced into the cell, and a single MP was entrapped by the acoustic radiation force. The levitation coordinate of the particle was measured at a constant voltage of V = 7.5 V supplied to the transducer.
Two types of polymethyl methacrylate MPs (PMMAs) were used to study the effect of their density on the levitation coordinate. PMMA with a density of 1.265 g cm–3 was purchased from GreenChem Inc. (Osaka, Japan). Carboxyl-functionalized PMMA (C-PMMA; 9.57 ± 0.21 μm diameter, 1.188 g cm–3 density) was purchased from Microparticle GmbH (Berlin, Germany). The carboxyl group density of the C-PMMA was 20 μmol g–1. The particle concentration of the C-PMMA in the stock solution was determined to be 1.88 × 108 mL–1 by counting the number of particles contained in 2 μL aliquots of the suspension using a microscope. The carboxyl-functionalized AuNPs with a 100 nm diameter were purchased from Cytodiagnostics (Burlington, Canada). The carboxyl group density of the AuNPs was 255 μmol g–1. The concentration of AuNPs was determined to be 1.92 × 1011 mL–1 by UV–vis spectrometry, which was developed by Fernig et al.(47) The probe and aptamer DNA were purchased from Fasmac Co., Ltd. (Kanagawa, Japan). ATP, DA, and AMP were selected as the aptamer-target molecules. The aptamer DNA sequences were determined by referring to the literature.(39−41)Table 1 summarizes the sequences of nucleotides (probe and aptamer DNA molecules) used in this work. The amino-terminated DNA probes were covalently conjugated onto the C-PMMAs and carboxyl-functionalized AuNPs by the condensation reaction using 1-[3-(dimethylamino)propyl]-3-ethyl carbodiimide and N-hydroxysuccinimide. Swine blood containing sodium citrate as the anticoagulant was purchased from KAC Co. (Kyoto, Japan). The blood was diluted 104 times with water and then used for the determination of the ATP concentration.
Table 1. Sequences of Nucleotides Used in this Work
| symbol | sequence (5′ → 3′) | functional group |
|---|---|---|
| ATP aptamer | CCTGGGGGAGTATTGCGGAGGAAGG | |
| ATP aptamer capture | ATACTCCCCCAGG-PMMA | amino (3′) |
| ATP aptamer reporter | AuNP-CCTTCCTCCGCA | amino (5′) |
| AMP aptamer | AAAGCGGGCGGTTGTATAGCGGAA | |
| AMP aptamer capture | ACCGCCCGCTTT-PMMA | amino (3′) |
| AMP aptamer reporter | AuNP-TTCCGCTATACA | amino (5′) |
| DA aptamer | GTCTCTGTGTGCGCCAGAGAACACTGGGGCAGATATGGGCCAGCACAGAATGAGGCCC | |
| DA aptamer capture | GGCGCACACAGAGAC-PMMA | amino (3′) |
| DA aptamer reporter | AuNP-GGGCCTCATTCTGTG | amino (5′) |
Aptamer DNA was added to a 10 μL aliquot of a capture DNA-anchored PMMA suspension. The mixture was diluted to 300 μL with tris–HCl buffer (pH 7.4, containing 140 mM NaCl and 5 mM MgCl2) and shaken for 4 h. The reporter DNA-anchored AuNPs (170 μL) were then added to the mixture. The mixture was diluted to 1 mL with tris–HCl buffer and left to stand for 4 h. The mixture was sonicated every 15 min. The number ratio of PMMAs to AuNPs (rAuNP/PMMA) was maintained constant at 10,000 for all of the experiments. The AuNP-bound PMMA suspension was added to the aptamer–target solution. Thereafter, the mixture was diluted to 1.5 mL with tris–HCl buffer and left to stand for 4 h. The mixture was sonicated every 15 min. The number ratio of the aptamer DNA to the AuNP-bound PMMA was maintained constant at 11,000 for all the experiments. Thus, the number ratio of PMMA/AuNP/aptamer was 1:10,000:11,000.
For comparison purpose, the concentration of ATP in the blood sample was determined by a luciferase assay using an ATP determination kit (BA100) purchased from Toyo B-Net (Tokyo, Japan). Luminescence was measured using a luminometer, Luminescencer Octa (ATTO, Tokyo).
JSM-7500F (JEOL, Japan) was used to observe the field-emission scanning electron microscopy (FE-SEM) images of PMMAs. The FE-SEM was operated at 6 kV. High-resolution images were obtained using secondary electron detection. The samples were coated with Pt/Pd.
ARTICLE SECTIONS
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.9b03860.
Relationship between nAuNP/PMMA and Δz, LOD determination, relationship between log K1 and the number of AuNPs bound on a PMMA at rAuNP/PMMA = 10,000, relationships between the log c for ATP and the reaction ratio assuming 1:2 aptamer–ATP complexation, and experimental setup (PDF)
Terms & Conditions
Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.
Author Information
ARTICLE SECTIONS
- Tetsuo Okada - Department of Chemistry, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551, Japan;
http://orcid.org/0000-0002-1976-7936;
The authors declare no competing financial interest.
Acknowledgments
ARTICLE SECTIONS
This work was supported by a Grant-in-Aid for the Scientific Research from the Japan Society for the Promotion of Science. We are grateful to Professor Masaru Kato (Showa University) for permission to use a luminometer for the ATP determination. We also thank the Ookayama Materials Analysis Division, Technical Department, Tokyo Institute of Technology, for FE-SEM observations.
References
ARTICLE SECTIONS
This article references 47 other publications.
- 1Ilgu, M.; Nilsen-Hamilton, M. Aptamers in analytics. Analyst 2016, 141, 1551– 1568, DOI: 10.1039/C5AN01824B[Crossref], [PubMed], [CAS], Google Scholar1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xps1Kktw%253D%253D&md5=430fe7d8ac293b13b9c91bc903f26ab1Aptamers in analyticsIlgu, Muslum; Nilsen-Hamilton, MaritAnalyst (Cambridge, United Kingdom) (2016), 141 (5), 1551-1568CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Nucleic acid aptamers are promising alternatives to antibodies in analytics. They are generally obtained through an iterative SELEX protocol that enriches a population of synthetic oligonucleotides to a subset that can recognize the chosen target mol. specifically and avidly. A wide range of targets is recognized by aptamers. Once identified and optimized for performance, aptamers can be reproducibly synthesized and offer other key features, like small size, low cost, sensitivity, specificity, rapid response, stability, and reusability. This makes them excellent options for sensory units in a variety of anal. platforms including those with electrochem., optical, and mass sensitive transduction detection. Many novel sensing strategies have been developed by rational design to take advantage of the tendency of aptamers to undergo conformational changes upon target/analyte binding and employing the principles of base complementarity that can drive the nucleic acid structure. Despite their many advantages over antibodies, surprisingly few aptamers have yet been integrated into com. available anal. devices. In this review, how to select and engineer aptamers for their identified application(s), some of the challenges faced in developing aptamers for analytics and many examples of their reported successful performance as sensors in a variety of anal. platforms are discussed.
- 2Hayat, A.; Marty, J. L. Aptamer based electrochemical sensors for emerging environmental pollutants. Front. Chem. 2014, 2, 41, DOI: 10.3389/fchem.2014.00041[Crossref], [PubMed], [CAS], Google Scholar2https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cbhvVartg%253D%253D&md5=b480c4875941328731776f29d6ce3e9eAptamer based electrochemical sensors for emerging environmental pollutantsHayat Akhtar; Marty Jean LFrontiers in chemistry (2014), 2 (), 41 ISSN:2296-2646.Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.
- 3Ku, T.-H.; Zhang, T.; Luo, H.; Yen, T.; Chen, P.-W.; Han, Y.; Lo, Y. H. Nucleic acid aptamers: an emerging tool for biotechnology and biomedical sensing. Sensors 2015, 15, 16281– 16313, DOI: 10.3390/s150716281[Crossref], [CAS], Google Scholar3https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhs1Sjsb%252FN&md5=926504bcb663742578fc943ebc420dc1Nucleic acid aptamers: an emerging tool for biotechnology and biomedical sensingKu, Ti-Hsuan; Zhang, Tiantian; Luo, Hua; Yen, Tony M.; Chen, Ping-Wei; Han, Yuanyuan; Lo, Yu-HwaSensors (2015), 15 (7), 16281-16313CODEN: SENSC9; ISSN:1424-8220. (MDPI AG)Detection of small mols. or proteins of living cells provides an exceptional opportunity to study genetic variations and functions, cellular behaviors, and various diseases including cancer and microbial infections. Our aim in this review is to give an overview of selected research activities related to nucleic acid-based aptamer techniques that have been reported in the past two decades. Limitations of aptamers and possible approaches to overcome these limitations are also discussed.
- 4Du, Y.; Dong, S. Nucleic acid biosensors: recent advances and perspectives. Anal. Chem. 2017, 89, 189– 215, DOI: 10.1021/acs.analchem.6b04190[ACS Full Text
], [CAS], Google Scholar4https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvVert7nK&md5=b47d361b503d5c89271c4d965b83bb8aNucleic Acid Biosensors: Recent Advances and PerspectivesDu, Yan; Dong, ShaojunAnalytical Chemistry (Washington, DC, United States) (2017), 89 (1), 189-215CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A review. In this review, progress in research of biosensors based on DNA and aptamer/DNAzyme throughout recent years (2014-2016) is summarized. The representative properties are listed in this review, together with existing deficiencies, and current challenges are also discussed for future development of biosensor technol. - 5Zhou, W.; Huang, P.-J. J.; Ding, J.; Liu, J. Aptamer-based biosensors for biomedical diagnostics. Analyst 2014, 139, 2627– 2640, DOI: 10.1039/c4an00132j[Crossref], [PubMed], [CAS], Google Scholar5https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXnsFWksbo%253D&md5=73e637042ce5801ba535feec1cbd25f2Aptamer-based biosensors for biomedical diagnosticsZhou, Wenhu; Huang, Po-Jung Jimmy; Ding, Jinsong; Liu, JuewenAnalyst (Cambridge, United Kingdom) (2014), 139 (11), 2627-2640CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Aptamers are single-stranded nucleic acids that selectively bind to target mols. Most aptamers are obtained through a combinatorial biol. technique called SELEX. Since aptamers can be isolated to bind to almost any mol. of choice, can be readily modified at arbitrary positions and they possess predictable secondary structures, this platform technol. shows great promise in biosensor development. Over the past two decades, more than one thousand papers have been published on aptamer-based biosensors. Given this progress, the application of aptamer technol. in biomedical diagnosis is still in a quite preliminary stage. Most previous work involves only a few model aptamers to demonstrate the sensing concept with limited biomedical impact. This crit. review aims to summarize progress that might enable practical applications of aptamers for biol. samples. First, general sensing strategies based on the unique properties of aptamers are summarized. Each strategy can be coupled to various signaling methods. Among these, a few detection methods including fluorescence lifetime, flow cytometry, upconverting nanoparticles, nanoflare technol., magnetic resonance imaging, electronic aptamer-based sensors, and lateral flow devices have been discussed in more detail since they are more likely to work in a complex sample matrix. The current limitations of this field include the lack of high quality aptamers for clin. important targets. In addn., the aptamer technol. has to be extensively tested in a clin. sample matrix to establish reliability and accuracy. Future directions are also speculated to overcome these challenges.
- 6Cheng, A. K. H.; Sen, D.; Yu, H. Z. Design and testing of aptamer-based electrochemical biosensors for proteins and small molecules. Bioelectrochemistry 2009, 77, 1– 12, DOI: 10.1016/j.bioelechem.2009.04.007[Crossref], [PubMed], [CAS], Google Scholar6https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXht1WmsrjO&md5=880b0842ffe20062f47a6a9b376c77dfDesign and testing of aptamer-based electrochemical biosensors for proteins and small moleculesCheng, Alan K. H.; Sen, Dipankar; Yu, Hua-ZhongBioelectrochemistry (2009), 77 (1), 1-12CODEN: BIOEFK; ISSN:1567-5394. (Elsevier B.V.)A review. The fabrication of aptamer-based electrochem. biosensors as an emerging technol. has made the detection of small and macromol. analytes easier, faster, and more suited for the ongoing transition from fundamental anal. science to the early detection of protein biomarkers. Aptamers are synthetic oligonucleotides that have undergone iterative rounds of in vitro selection for binding with high affinity to specific analytes of choice; a sensitive yet simple method to utilize aptamers as recognition entities for the development of biosensors is to transduce the signal electrochem. In this review article, we attempt to summarize the state-of-the-art research progresses that have been published in recent years; in particular, we focus on the electrochem. biosensors that incorporate aptamers for sensing small org. mols. and proteins. Based on differences in the design of the DNA/RNA-modified electrodes, we classify aptamer-based electrochem. sensors into three categories, for which the analyte detection relies on: (a) configurational change, i.e., the analyte binding induces either an assembly or dissocn. of the sensor construct; (b) conformational change, i.e., the analyte binding induces an alteration in the conformation (folding) of the surface immobilized aptamer strands; and (c) cond. change, i.e., the analyte binding "switches on" the cond. of the surface-bound aptamer-DNA constructs. In each section, we will discuss the performance of these novel biosensors with representative examples reported in recent literature.
- 7Li, Y.; Lee, H. J.; Corn, R. M. Detection of protein biomarkers using RNA aptamer microarrays and enzymatically amplified surface plasmon resonance imaging. Anal. Chem. 2007, 79, 1082– 1088, DOI: 10.1021/ac061849m[ACS Full Text], [CAS], Google Scholar7https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXlsVKn&md5=b3eb78a9d1b13c86cac97b8342fb1b34Detection of Protein Biomarkers Using RNA Aptamer Microarrays and Enzymatically Amplified Surface Plasmon Resonance ImagingLi, Yuan; Lee, Hye Jin; Corn, Robert M.Analytical Chemistry (2007), 79 (3), 1082-1088CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A methodol. for the detection of protein biomarkers at picomolar concns. that utilizes surface plasmon resonance imaging (SPRI) measurements of RNA aptamer microarrays is developed. The adsorption of proteins onto the RNA microarray is detected by the formation of a surface aptamer-protein-antibody complex. The SPRI response signal is then amplified using a localized pptn. reaction catalyzed by the enzyme horseradish peroxidase that is conjugated to the antibody. This enzymically amplified SPRI methodol. is first characterized by the detection of human thrombin at a concn. of 500 fM; the appropriate thrombin aptamer for the sandwich assay is identified from a microarray of three potential thrombin aptamer candidates. The SPRI method is then used to detect the protein vascular endothelial growth factor (VEGF) at a biol. relevant concn. of 1 pM. VEGF is a signaling protein that has been used as a serum biomarker for rheumatoid arthritis, breast cancer, lung cancer, and colorectal cancer and is also assocd. with age-related macular degeneration.
- 8Savran, C. A.; Knudsen, S. M.; Ellington, A. D.; Manalis, S. R. Micromechanical detection of proteins using aptamer-based receptor molecules. Anal. Chem. 2004, 76, 3194– 3198, DOI: 10.1021/ac049859f[ACS Full Text], [CAS], Google Scholar8https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXjsVOit74%253D&md5=5b6a978ea5c5f2f110db1e00ac841671Micromechanical detection of proteins using aptamer-based receptor moleculesSavran, Cagri A.; Knudsen, Scott M.; Ellington, Andrew D.; Manalis, Scott R.Analytical Chemistry (2004), 76 (11), 3194-3198CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)We report label-free protein detection using a microfabricated cantilever-based sensor that is functionalized with DNA aptamers to act as receptor mols. The sensor utilizes two adjacent cantilevers that constitute a sensor/ref. pair and allows direct detection of the differential bending between the two cantilevers. One cantilever is functionalized with aptamers selected for Taq DNA polymerase while the other is blocked with single-stranded DNA. We have found that the polymerase-aptamer binding induces a change in surface stress, which causes a differential cantilever bending that ranges from 3 to 32 nm depending on the ligand concn. Protein recognition on the sensor surface is specific and has a concn. dependence that is similar to that in soln.
- 9Ueyama, H.; Takagi, M.; Takenaka, S. A novel potassium sensing in aqueous media with a synthetic oligonucleotide derivative. Fluorescence resonance energy transfer associated with guanine quartet-potassium ion complex formation. J. Am. Chem. Soc. 2002, 124, 14286– 14287, DOI: 10.1021/ja026892f[ACS Full Text], [CAS], Google Scholar9https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XosVCgtLc%253D&md5=7536c6e47b1d3385b1ca0155901ba556A novel potassium sensing in aqueous media with a synthetic oligonucleotide derivative. fluorescence resonance energy transfer associated with guanine quartet-potassium ion complex formationUeyama, Hiroyuki; Takagi, Makoto; Takenaka, ShigeoriJournal of the American Chemical Society (2002), 124 (48), 14286-14287CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)A novel potassium sensing oligonucleotide (PSO) was constructed by attaching fluorophores 6-FAM and 6-TAMRA to the 5'- and 3'-termini of d(GGG TTA GGG TTA GGG TTA GGG), resp. The affinity of PSO for K+ was 43 000 times greater than that for Na+, high enough selectivity enabling quantitation of K+ specifically in the presence of excess Na+. Fluorescence resonance energy transfer (FRET) to 6-TAMRA from 6-FAM of PSO was obsd. only in the presence of K+. This phenomenon is based on the approxn. of the two fluorophores upon formation of a guanine quartet mediated by K+. Furthermore, the fluorescent color of PSO changes from yellow to red upon formation of the complex, thereby enabling visualization of K+ in aq. media.
- 10Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. Light-switching excimer probes for rapid protein monitoring in complex biological fluids. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 17278, DOI: 10.1073/pnas.0508821102[Crossref], [PubMed], [CAS], Google Scholar10https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXhtlSqtLfP&md5=e117da837df74f10cd711db7ca9b2287Light-switching excimer probes for rapid protein monitoring in complex biological fluidsYang, Chaoyong James; Jockusch, Steffen; Vicens, Marie; Turro, Nicholas J.; Tan, WeihongProceedings of the National Academy of Sciences of the United States of America (2005), 102 (48), 17278-17283CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Quant. protein bioanal. in complex biol. fluids presents considerable challenges in biol. studies and disease diagnosis. The major obstacles are the background signals from both the probe and the biol. fluids where the proteins reside. The authors have molecularly engineered light-switching excimer aptamer probes for rapid and sensitive detection of a biomarker protein, platelet-derived growth factor (PDGF). Labeled with one pyrene at each end, the aptamer switches its fluorescence emission from ≈400 nm (pyrene monomer) to 485 nm (pyrene excimer) upon PDGF binding. This fluorescence wavelength change from monomer to excimer emission is a result of aptamer conformation rearrangement induced by target binding. The excimer probe is able to effectively detect picomolar PDGF in homogeneous solns. Because the excimer has a much longer fluorescence lifetime (≈40 ns) than that of the background (≈5 ns), time-resolved measurements were used to eliminate the biol. background. The authors thus were able to detect PDGF in a cell sample quant. without any sample pretreatment. This mol. engineering strategy can be used to develop other aptamer probes for protein monitoring. Combined with lifetime-based measurements and mol. engineering, light-switching excimer aptamer probes hold great potential in protein anal. for biomedical studies.
- 11Stojanovic, M. N.; de Prada, P.; Landry, D. W. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 2001, 123, 4928– 4931, DOI: 10.1021/ja0038171[ACS Full Text], [CAS], Google Scholar11https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXjtFGqsro%253D&md5=490c17b48056c3dfe513b32c5276a3e3Aptamer-Based Folding Fluorescent Sensor for CocaineStojanovic, Milan N.; de Prada, Paloma; Landry, Donald W.Journal of the American Chemical Society (2001), 123 (21), 4928-4931CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)We adapted in two steps a deoxyribonucleotide-based aptamer to signal the recognition of cocaine: an instability was engineered in one stem of a three-way junction that forms the cocaine-binding pocket and the resulting short stem was end labeled with a fluorophore and a quencher. In the absence of cocaine, two stems are open, but in its presence they close and the three-way junction forms. This major structural change brings fluorophore and quencher together thereby signaling the presence and concn. of ligand. The sensor is selective for cocaine over its metabolites, can operate in serum, and is useful for the screening of cocaine hydrolases.
- 12Liu, J.; Lee, J. H.; Lu, Y. Quantum dot encoding of aptamer-linked nanostructures for one-pot simultaneous detection of multiple analytes. Anal. Chem. 2007, 79, 4120– 4125, DOI: 10.1021/ac070055k[ACS Full Text], [CAS], Google Scholar12https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXkvVymur4%253D&md5=cf36d80fb34287f6405d2deb08a30ef5Quantum Dot Encoding of Aptamer-Linked Nanostructures for One-Pot Simultaneous Detection of Multiple AnalytesLiu, Juewen; Lee, Jung Heon; Lu, YiAnalytical Chemistry (Washington, DC, United States) (2007), 79 (11), 4120-4125CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)One major challenge in anal. chem. is multiplex sensing of a no. of analytes with each analyte displaying a different signal. To meet such a challenge, quantum dots that emit at 525 and 585 nm are used to encode aptamer-linked nanostructures sensitive to adenosine and cocaine, resp. In addn. to quantum dots, the nanostructures also contain gold nanoparticles that serve as quenchers. Addn. of target analytes disassembles the nanostructures and results in increased emission from quantum dots. Simultaneous colorimetric and fluorescent detection and quantification of both mols. in one pot is demonstrated.
- 13Liu, J.; Lu, Y. Fast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticles. Angew. Chem., Int. Ed. 2006, 45, 90, DOI: 10.1002/anie.200502589[Crossref], [CAS], Google Scholar13https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhslKgtQ%253D%253D&md5=8038b410625aa97ca2e0d53e1ea8216cFast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticlesLiu, Juewen; Lu, YiAngewandte Chemie, International Edition (2006), 45 (1), 90-94CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)DNA aptamers have been used to assemble DNA-functionalized gold nanoparticles to produce highly sensitive and selective colorimetric sensors with an instantaneous color response on addn. of a substrate. The general method has been shown for adenosine and cocaine, but should be applicable to any aptamer of choice.
- 14Lu, C. H.; Yang, H. H.; Zhu, C. L.; Chen, X.; Chen, G. N. A graphene platform for sensing biomolecules. Angew. Chem., Int. Ed. 2009, 48, 4785– 4787, DOI: 10.1002/anie.200901479[Crossref], [PubMed], [CAS], Google Scholar14https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXntlOitb4%253D&md5=60952d44796a7b63706a2225a19f4729A Graphene Platform for Sensing BiomoleculesLu, Chun-Hua; Yang, Huang-Hao; Zhu, Chun-Ling; Chen, Xi; Chen, Guo-NanAngewandte Chemie, International Edition (2009), 48 (26), 4785-4787CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)The use of graphene oxide (GO) as a platform for the sensitive and selective detection of DNA and proteins is presented. The interaction of GO and dye-labeled single-stranded DNA leads to quenching of the dye fluorescence. Conversely, the presence of a target DNA or protein leads to the binding of the dye-labeled DNA and target, releasing the DNA from GO, thereby restoring the dye fluorescence.
- 15Peyrin, E. Nucleic acid aptamer molecular recognition principles and application in liquid chromatography and capillary electrophoresis. J. Sep. Sci. 2009, 32, 1531– 1536, DOI: 10.1002/jssc.200900061[Crossref], [PubMed], [CAS], Google Scholar15https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmvFCmt74%253D&md5=eae0c26d0f022ffc9e8ac915c215ef66Nucleic acid aptamer molecular recognition principles and application in liquid chromatography and capillary electrophoresisPeyrin, EricJournal of Separation Science (2009), 32 (10), 1531-1536CODEN: JSSCCJ; ISSN:1615-9306. (Wiley-VCH Verlag GmbH & Co. KGaA)A review. Nucleic acid aptamers isolated from the systematic evolution of ligands by exponential enrichment (SELEX) have the capacity to recognize various classes of target mols. with high affinity and specificity. In this context, the development of aptamer-based mol. recognition tools has become a very interesting and promising anal. strategy during the last few years. In this review, the mol. recognition features of aptamers as well as the key factors for their practical applicability to the chromatog. and capillary electrophoretic fields are summarized.
- 16Yu, F.; Zhao, Q.; Zhang, D.; Yuan, Z.; Wang, H. Affinity interactions by capillary electrophoresis: binding, separation, and detection. Anal. Chem. 2019, 91, 372– 387, DOI: 10.1021/acs.analchem.8b04741[ACS Full Text], [CAS], Google Scholar16https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVyju7fJ&md5=cfa143cb4653e5ff791901f327206822Affinity Interactions by Capillary Electrophoresis: Binding, Separation, and DetectionYu, Fangzhi; Zhao, Qiang; Zhang, Dapeng; Yuan, Zheng; Wang, HailinAnalytical Chemistry (Washington, DC, United States) (2019), 91 (1), 372-387CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A review. Affinity interactions between mols. constitute this amazing and mysterious world of the human-living earth. At the level of individuals, affinity interactions are fundamental for the paramount functions and exquisite architectures of all organisms in life, for the occurrence and development of diseases, for the therapy-assocd. diagnosis, pharmaceutics and medicine (and cutting-edge regenerative medicine), and for the environment-life interplayed sphere. At the level of cells, affinity interactions function critically throughout every facet of every cells (e.g., division, differentiation, and motility), between cells (e.g., communication, aggregation, immune response), during organogenesis and organ maintenance. At the level of mol. events, affinity interactions allow the cells to make DNA package (nucleosome, chromosome), to perform precise DNA replication and timely DNA repair, transcription, translation, mRNA splicing, and to modify proteins and nucleic acids (typically in epigenetics). In essence, all mols. within and outside the cells, such as proteins, nucleic acids, hormones, and nutrients play vital roles through affinity interaction network in regulating fundamental life processes.
- 17Šmuc, T.; Ahn, I.-Y.; Ulrich, H. Nucleic acid aptamers as high affinity ligands in biotechnology and biosensorics. J. Pharm. Biomed. Anal. 2013, 81-82, 210– 217, DOI: 10.1016/j.jpba.2013.03.014[Crossref], [PubMed], [CAS], Google Scholar17https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXotlGmsbo%253D&md5=cb33a9d7caf3208889015185fd8a31bbNucleic acid aptamers as high affinity ligands in biotechnology and biosensoricsSmuc, Tina; Ahn, Il-Young; Ulrich, HenningJournal of Pharmaceutical and Biomedical Analysis (2013), 81-82 (), 210-217CODEN: JPBADA; ISSN:0731-7085. (Elsevier B.V.)A review. Aptamers are small nucleic acid mols. capable of binding to a wide range of target mols. with high affinity and specificity. They have been developed and widely used not only as research tools, but also as biosensors, specific antagonists, and diagnostic markers and as protein purifn. platform for many pharmaceutical and clin. applications. Here, the authors will explore biochem. aspects of aptamer-target interactions and show why aptamers rival antibodies in target recognition and purifn. procedures. This review will focus on strategies of using aptamers as affinity ligands for mols. of therapeutic and pharmaceutical interest including applications in chromatog. and capillary electrophoresis for protein and small mol. purifn. Moreover, the authors will also discuss aptamers whose binding parameters can be controlled on demand for diagnostic approaches and used as sensitive receptors in biosensorics. Aptamers have opened up exciting fields in basic and applied research of pharmaceutical and biotechnol. interest.
- 18Cai, S.; Yan, J.; Xiong, H.; Liu, Y.; Peng, D.; Liu, Z. Investigations on the interface of nucleic acid aptamers and binding targets. Analyst 2018, 143, 5317– 5338, DOI: 10.1039/C8AN01467A[Crossref], [PubMed], [CAS], Google Scholar18https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVKmsbzM&md5=8a7f0354ca9a1ad38377a1948b89278aInvestigations on the interface of nucleic acid aptamers and binding targetsCai, Shundong; Yan, Jianhua; Xiong, Hongjie; Liu, Yanfei; Peng, Dongming; Liu, ZhenbaoAnalyst (Cambridge, United Kingdom) (2018), 143 (22), 5317-5338CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Nucleic acid aptamers are single-stranded DNA or RNA of 20-100 nucleotides in length that have attracted substantial scientific interest due to their ability to specifically bind to target mols. via the formation of three-dimensional structures. Compared to traditional protein antibodies, aptamers have several advantages, such as their small size, high binding affinity, specificity, flexible structure, being chem. synthesizable and modifiable, good biocompatibility, high stability and low immunogenicity, which all contribute to their widely applications in the biomedical field. To date, much progress has been made in the study and applications of aptamers, however, detailed information on how aptamers bind to their targets is still scarce. Over the past few decades, many methods have been introduced to investigate the aptamer-target binding process, such as measuring the main kinetic or thermodn. parameters, detecting the structural changes of the binding complexes, etc. Apart from traditional physicochem. methods, various types of mol. docking programs have been applied to simulate the aptamer-target interactions, while these simulations also have limitations. To facilitate the further research on the interactions, herein, we provide a brief review to illustrate the recent advances in the study of aptamer-target interactions. We summarize the binding targets of aptamers, such as small mols., macromols., and even cells. Their binding consts. (KD) are also summarized. Methods to probe the aptamer-target binding process, such as surface plasmon resonance (SPR), CD spectroscopy (CD), isothermal titrn. calorimetry (ITC), footprinting assay, truncation and mutation assay, NMR spectroscopy (NMR), X-ray crystallog. and mol. docking simulation are indicated. The binding forces mediating the aptamer-target interactions, such as hydrogen bonding, electrostatic interaction, the hydrophobic effect, π-π stacking and van der Waals forces are summarized. The challenges and future perspectives are also discussed.
- 19Win, M. N.; Klein, J. S.; Smolke, C. D. Codeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assay. Nucleic Acids Res. 2006, 34, 5670– 5682, DOI: 10.1093/nar/gkl718[Crossref], [PubMed], [CAS], Google Scholar19https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xht1SrtL%252FE&md5=ef0c207f41faa5278bfb985088abf5edCodeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assayWin, Maung Nyan; Klein, Joshua S.; Smolke, Christina D.Nucleic Acids Research (2006), 34 (19), 5670-5682CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)RNA aptamers that bind the opium alkaloid codeine were generated using an iterative in vitro selection process. The binding properties of these aptamers, including equil. and kinetic rate consts., were detd. through a rapid, high-throughput approach using surface plasmon resonance (SPR) anal. to measure real-time binding. The approach involves direct coupling of the target small mol. onto a sensor chip without utilization of a carrier protein. Two highest binding aptamer sequences, FC5 and FC45 with Kd values of 2.50 and 4.00 μM, resp., were extensively studied. Corresponding mini-aptamers for FC5 and FC45 were subsequently identified through the described direct coupling Biacore assays. These assays were also employed to confirm the proposed secondary structures of the mini-aptamers. Both aptamers exhibit high specificity to codeine over morphine, which differs from codeine by a Me group. Finally, the direct coupling method was demonstrated to eliminate potential non-specific interactions that may be assocd. with indirect coupling methods in which protein linkers are commonly employed. Therefore, in addn. to presenting the first RNA aptamers to a subclass of benzylisoquinoline alkaloid mols., this work highlights a method for characterizing small mol. aptamers that is more robust, precise, rapid and high-throughput than other commonly employed techniques.
- 20Lee, S. J.; Youn, B. S.; Park, J. W.; Niazi, J. H.; Kim, Y. S.; Gu, M. B. ssDNA aptamer-based surface plasmon resonance biosensor for the detection of retinol binding protein 4 for the early diagnosis of type 2 diabates. Anal. Chem. 2008, 80, 2867– 2873, DOI: 10.1021/ac800050a[ACS Full Text], [CAS], Google Scholar20https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXivV2gt7s%253D&md5=a7b8e06a7a3e62ab6f0dee2816b04321ssDNA Aptamer-Based Surface Plasmon Resonance Biosensor for the Detection of Retinol Binding Protein 4 for the Early Diagnosis of Type 2 DiabetesLee, Su Jin; Youn, Byung-Soo; Park, Ji Woo; Niazi, Javed H.; Kim, Yeon Seok; Gu, Man BockAnalytical Chemistry (Washington, DC, United States) (2008), 80 (8), 2867-2873CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)Retinol binding protein 4 (RBP4) is a useful biomarker in the diagnosis of type 2 diabetes since its level in the serum is higher in insulin-resistant states. Accurate measurement of the serum RBP4 levels is hampered by conventional immunol. methods, such as ELISA. In this study, therefore, the authors have developed an aptamer-based surface plasmon resonance (SPR) biosensor that can be used to sense for RBP4 in serum samples. A single-stranded DNA (ssDNA) aptamer that showed high affinity (Kd = 0.2±0.03 μM) and specificity to RBP4 was selected. This RBP4-specific aptamer was immobilized on a gold chip and used in a label-free RBP4 detection using SPR. Anal. of RBP4 in artificial serum using SPR was compared with ELISA and Western blot anal. The authors' results indicated that the RBP4-specific aptamer-based SPR biosensor gave better dose-dependent responses and was more sensitive than ELISA assays. As such, this RBP4 aptamer-based SPR biosensor can be potentially used to monitor the RBP4 levels within the serum as an indicator of type 2 diabetes.
- 21Gong, M.; Nikcevic, I.; Wehmeyer, K. R.; Limbach, P. A.; Heineman, W. R. Protein-aptamer binding studies using microchip affinity capillary electrophoresis. Electrophoresis 2008, 29, 1415– 1422, DOI: 10.1002/elps.200700777[Crossref], [PubMed], [CAS], Google Scholar21https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXlt1WktLs%253D&md5=b1180e4ca92bf43fb91bc4107b9fb3b7Protein-aptamer binding studies using microchip affinity capillary electrophoresisGong, Maojun; Nikcevic, Irena; Wehmeyer, Kenneth R.; Limbach, Patrick A.; Heineman, William R.Electrophoresis (2008), 29 (7), 1415-1422CODEN: ELCTDN; ISSN:0173-0835. (Wiley-VCH Verlag GmbH & Co. KGaA)The use of traditional CE [capillary electrophoresis] to detect weak binding complexes is problematic due to the fast-off rate resulting in the dissocn. of the complex during the sepn. process. Addnl., proteins involved in binding interactions often nonspecifically stick to the bare-silica capillary walls, which further complicates the binding anal. Microchip CE allows flexibly positioning the detector along the sepn. channel and conveniently adjusting the sepn. length. A short sepn. length plus a high elec. field enables rapid sepns. thus reducing both the dissocn. of the complex and the amt. of protein loss due to nonspecific adsorption during the sepn. process. Thrombin and a selective thrombin-binding aptamer were used to demonstrate the capability of microchip CE for the study of relatively weak binding systems that have inherent limitations when using the migration shift method or other CE methods. The rapid sepn. of the thrombin-aptamer complex from the free aptamer was achieved in less than 10 s on a single-cross glass microchip with a relatively short detection length (1.0 cm) and a high elec. field (670 V/cm). The dissocn. const. was detd. to be 43 nM, consistent with reported results. In addn., aptamer probes were used for the quantitation of std. thrombin samples by constructing a calibration curve, which showed good linearity over two orders of magnitude with an LOD for thrombin of 5 nM at a three-fold S/N.
- 22Miyagawa, A.; Harada, M.; Okada, T. Zeptomole biosensing of DNA with flexible selectivity based on acoustic levitation of a single microsphere binding gold nanoparticles by hybridization. ACS Sensors 2018, 3, 1870– 1875, DOI: 10.1021/acssensors.8b00748[ACS Full Text], [CAS], Google Scholar22https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsF2gs73L&md5=7e244ba99019fdbdcf911a24bc9b213cZeptomole Biosensing of DNA with Flexible Selectivity Based on Acoustic Levitation of a Single Microsphere Binding Gold Nanoparticles by HybridizationMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoACS Sensors (2018), 3 (9), 1870-1875CODEN: ASCEFJ; ISSN:2379-3694. (American Chemical Society)A novel scheme for DNA sensing at the zeptomole level is presented, based on the levitation of a single microsphere in a combined acoustic-gravitational (CAG) field. The levitation of a microsphere in the field is predominantly detd. by its d. Capture and reporter probe DNAs are anchored on poly(Me methacrylate) microsphere (PMMA) and gold nanoparticles (AuNPs), resp., and a target DNA induces the binding of AuNPs on PMMA. This interparticle sandwich DNA-hybridization induces d. increase in PMMA, which is detected as a shift in the levitation coordinate in the CAG field. The reporter DNAs are designed based on base-pair (bp) no. selectivity, which is evaluated using direct interparticle hybridization between DNA-bound PMMA and complementary DNA-anchored AuNPs. Interestingly, the bp-no. selectivity can be enlarged by lowering the reactant concns. Thus, the threshold bp, at which no d. change is detected, can be adjusted by controlling the reactant concns. This strategy is extended to the sensing of HIV-2 DNA and single nucleotide polymorphism (SNP) detection of the KRAS gene by sandwich hybridization. In SNP detection, the present method selectively distinguishes wild-type DNA from mutant DNA differing by one nucleotide in the 21-nucleotide sequence by optimizing the lengths of probe DNAs and particle concns. This approach allows the detection of 1000 DNA mols.
- 23Miyagawa, A.; Harada, M.; Okada, T. Multiple microRNA quantification based on acoustic levitation of single microspheres after one-pot sandwich interparticle hybridization. Anal. Chem. 2018, 90, 13729– 13735, DOI: 10.1021/acs.analchem.8b04143[ACS Full Text], [CAS], Google Scholar23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVKitbbI&md5=95a3beee6f19634750fb757041b2ea78Multiple MicroRNA Quantification Based on Acoustic Levitation of Single Microspheres after One-Pot Sandwich Interparticle HybridizationsMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2018), 90 (22), 13729-13735CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The authors propose a scheme for the sensitive quantification of multiple microRNAs (miRNAs) on the basis of the levitation coordinate change (Δz) of single microparticles of different sizes in a coupled acoustic-gravitational (CAG) field. This field transduces the d. change of a microparticle into Δz, which can be measured with high precision. The d. of a microparticle is induced by the binding of gold nanoparticles (AuNPs) on it through the sandwich DNA hybridization with miRNA. Different probe DNAs are anchored onto microparticles of different sizes, which are clearly distinguishable on a microscopic view. The target miRNAs are captured by these particles having complementary nucleotide sequences and then entrap reporter-anchored AuNPs. Thus, the densities of the microparticles are modified according to the concn. of individual target miRNAs. The interparticle hybridizations for multiple target miRNAs are conducted in one-pot reactions before the levitation of the microparticles is measured in the CAG field. This principle is successfully applied to the quantification of miR-21 and miR-122 in the total RNA extd. from liver cancer tissues.
- 24Miyagawa, A.; Harada, M.; Okada, T. Zeptomole detection scheme based on levitation coordinate measurements of a single microparticle in a coupled acoustic-gravitational field. Anal. Chem. 2018, 90, 2310– 2316, DOI: 10.1021/acs.analchem.7b04752[ACS Full Text], [CAS], Google Scholar24https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXnvVertg%253D%253D&md5=6bcbd263993c548d132ce5b1c412b772Zeptomole Detection Scheme Based on Levitation Coordinate Measurements of a Single Microparticle in a Coupled Acoustic-Gravitational FieldMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2018), 90 (3), 2310-2316CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The authors present a novel anal. principle in which an analyte (according to its concn.) induces a change in the d. of a microparticle, which was measured as a vertical coordinate in a coupled acoustic-gravitational (CAG) field. The d. change is caused by the binding of gold nanoparticles (AuNP's) on a polystyrene (PS) microparticle through avidin-biotin assocn. The d. of a 10-μm PS particle increases by 2% when 500,100-nm AuNP's are bound to the PS. The CAG can detect this d. change as a 5-10 μm shift of the levitation coordinate of the PS. This approach, which allows the authors to detect 700 AuNP's bound to a PS particle, was used to detect biotin in soln. Biotin is detectable at a picomolar level. The reaction kinetics plays a significant role in the entire process. The kinetic aspects are also quant. discussed based on the levitation behavior of the PS particles in the CAG field.
- 25Miyagawa, A.; Inoue, Y.; Harada, M.; Okada, T. Acoustic sensing based on density shift of microspheres by surface binding of gold nanoparticles. Anal. Sci. 2017, 33, 939– 944, DOI: 10.2116/analsci.33.939[Crossref], [PubMed], [CAS], Google Scholar25https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXptVOhtQ%253D%253D&md5=da827d3d9d7462171c0d1294a2ce7c88Acoustic sensing based on density shift of microspheres by surface binding of gold nanoparticlesMiyagawa, Akihisa; Inoue, Yoshinori; Harada, Makoto; Okada, TetsuoAnalytical Sciences (2017), 33 (9), 939CODEN: ANSCEN; ISSN:0910-6340. (Japan Society for Analytical Chemistry)There is no expanded citation for this reference.
- 26Kanazaki, T.; Hirawa, S.; Harada, M.; Okada, T. Coupled acoustic-gravity field for dynamic evaluation of ion exchange with a single resin bead. Anal. Chem. 2010, 82, 4472– 4478, DOI: 10.1021/ac100275p[ACS Full Text], [CAS], Google Scholar26https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXlvF2js7g%253D&md5=44e820383a49454bde1a01cc4c072827Coupled Acoustic-Gravity Field for Dynamic Evaluation of Ion Exchange with a Single Resin BeadKanazaki, Takahiro; Hirawa, Shungo; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2010), 82 (11), 4472-4478CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A coupled acoustic-gravity field is efficient for entrapping a particle at the position detd. by its acoustic properties rather than its size. This field was applied to the dynamic observation of ion-exchange reactions occurring in a single resin bead. The replacement of counterions in an ion-exchange resin induces changes in its acoustic properties, such as d. and compressibility. Therefore, the authors can visually trace the advancement of an ion-exchange reaction as a time change in the levitation position of a resin bead entrapped in the field. Cation-exchange reactions occurring in resin beads with diams. of 40-120 μm are typically completed within 100-200 s. Ion-exchange equil. or kinetics is often evaluated with off-line chem. analyses, which require a batch amt. of ion exchangers. Measurements with a single resin particle allow one to evaluate ion-exchange dynamics and kinetics of ions including those that are difficult to measure by usual off-line analyses. The diffusion properties of ions in resins were successfully evaluated from the time change in the levitation positions of resin beads.
- 27Kanazaki, T.; Okada, T. Two-dimensional particle separation in coupled acoustic-gravity-flow field vertically by composition and laterally by size. Anal. Chem. 2012, 84, 10750– 10755, DOI: 10.1021/ac302637e[ACS Full Text], [CAS], Google Scholar27https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsleqtLjI&md5=b5ab14ccc0daca545d3c2003ad83fcebTwo-Dimensional Particle Separation in Coupled Acoustic-Gravity-Flow Field Vertically by Composition and Laterally by SizeKanazaki, Takahiro; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2012), 84 (24), 10750-10755CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A flow-based sepn. of particles usually relies on differences in their mobility in the flow direction, which are mostly produced by a phys. force. Various properties of particles, typically the size and compn., simultaneously affect their mobility and, therefore, often complicate the result of sepn. If these properties are distinguished on different sepn. axes, well-defined sepn. should be realized. Two-dimensional sepn. of particles was devised by a simple exptl. setup based on the acoustic radiation forces and the Stokes drag. A vertical acoustic-gravity field provides the d. resoln. better than 1%, and horizontal acoustic-flow field can also resolve particle sizes with the resoln. of < 1%. Two-dimensional sepn. based on the compns. and sizes of particles is demonstrated.
- 28Masudo, T.; Okada, T. Particle characterization and separation by a coupled acoustic-gravity field. Anal. Chem. 2001, 73, 3467– 3471, DOI: 10.1021/ac001354b[ACS Full Text], [CAS], Google Scholar28https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXktVyksr0%253D&md5=55f3952a530f1a0333bd29c7e8bd5db7Particle Characterization and Separation by a Coupled Acoustic-Gravity FieldMasudo, Takashi; Okada, TetsuoAnalytical Chemistry (2001), 73 (14), 3467-3471CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A coupled acoustic-gravity field is proposed as a novel external field for particle sepn. and characterization. When a standing plane ultrasound wave is generated, particles move to the node of the wave along the ultrasound force gradient. If the particles also undergo a sedimentation force, they aggregate at the equil. position, where these two forces are balanced. The equil. position, which is detd. by the d. and compressibility of a medium and particles, characterizes the particles. The local ultrasound energy, which is necessary for quant. discussions, is evaluated by using a std. particle, the phys. parameters of which are unambiguously detd.; aluminum particles are used in the present study. The local ultrasound energy makes possible the detn. of the compressibility of unknown materials. Nonporous particles of inorg. and polymeric materials, the particle sizes of which range from 3 to 100 μm, follow a derived model, suggesting that the local ultrasound energy and a derived model be valid. The proposed external field can be used for sepn. of particles having different acoustic natures.
- 29Ge, S.; Nemiroski, A.; Mirica, K. A.; Mace, C. R.; Hennek, J. W.; Kumar, A. A.; Whitesides, G. M. Magnetic levitation in chemistry, materials science, and biochemistry. Angew. Chem., Int. Ed. 2019, DOI: 10.1002/anie.201903391
- 30Ma, C.; Lin, C.; Wang, Y.; Chen, X. DNA-based ATP sensing. TrAC, Trends Anal. Chem. 2016, 77, 226– 241, DOI: 10.1016/j.trac.2016.01.013[Crossref], [CAS], Google Scholar30https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhsl2qs70%253D&md5=b28a26db10d3573a689500971c5993d6DNA-based ATP sensingMa, Chunhua; Lin, Chunshui; Wang, Yiru; Chen, XiTrAC, Trends in Analytical Chemistry (2016), 77 (), 226-241CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)The detection of ATP is of great value due to its role in the regulation and integration of cellular metab. DNA has been developed as a promising recognition element in ATP sensing, among which ATP-binding aptamer (ABA) exhibits many advantages in terms of the simplicity of synthesis, ease of labeling and excellent stability. Moreover, progress in the development of nanomaterials and enzyme amplification provides ABA even more flexibility as an ATP recognition tool in the fields of fluorescence, electrochem. and colorimetric. In addn. to ABA, ATP dependent enzyme reaction (ATP-DER, T4 DNA ligase) using DNA as a substrate has been developed for ATP sensing with high sensitivity and selectivity. In this review, we summarize the recent advances in DNA-based ATP sensors and their applications in living cells, and also discuss their future development.
- 31Rajendran, M.; Dane, E.; Conley, J.; Tantama, M. Imaging adenosine triphosphate (ATP). Biol. Bull. 2016, 231, 73– 84, DOI: 10.1086/689592[Crossref], [PubMed], [CAS], Google Scholar31https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXltVSmsr0%253D&md5=ec572184105cf32f7ca3f46a8df77eafImaging adenosine triphosphateRajendran, Megha; Dane, Eric; Conley, Jason; Tantama, MathewBiological Bulletin (Woods Hole, MA, United States) (2016), 231 (1), 73-84CODEN: BIBUBX; ISSN:0006-3185. (Marine Biological Laboratory)ATP (ATP) is a universal mediator of metab. and signaling across unicellular and multicellular species. There is a fundamental interdependence between the dynamics of ATP and the physiol. that occurs inside and outside the cell. Characterizing and understanding ATP dynamics provide valuable mechanistic insight into processes that range from neurotransmission to the chemotaxis of immune cells. Therefore, we require the methodol. to interrogate both temporal and spatial components of ATP dynamics from the subcellular to the organismal levels in live specimens. Over the last several decades, a no. of mol. probes that are specific to ATP have been developed. These probes have been combined with imaging approaches, particularly optical microscopy, to enable qual. and quant. detection of this crit. mol. In this review, we survey current examples of technologies available for visualizing ATP in living cells, and identify areas where new tools and approaches are needed to expand our capabilities.
- 32Dong, J.; Zhao, M. In-vivo fluorescence imaging of adenosine 5′-triphosphate. TrAC, Trends Anal. Chem. 2016, 80, 190– 203, DOI: 10.1016/j.trac.2016.03.020[Crossref], [CAS], Google Scholar32https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XkvVertLs%253D&md5=1f177b37c0bcdbba1592d18b9d428a17In-vivo fluorescence imaging of adenosine 5'-triphosphateDong, Jiantong; Zhao, MeipingTrAC, Trends in Analytical Chemistry (2016), 80 (), 190-203CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)As a crit. and multifunctional nucleotide, ATP (ATP) is involved in many cellular metab. and signal transduction processes. Monitoring the level and dynamics of ATP in living organisms contributes to better understanding of basic cellular functions. Fluorescent indicators are distinctly superior in detecting ATP in vivo due to their advantages of high sensitivity, good selectivity, fast response and flexible manipulation. The current indicators including small org. fluorescent chemosensors, genetically encoded fluorescent reporters, artificially designed aptamers conjugated with nanomaterials, and fluorescent nanosensors based on ATP-dependent luciferase have successfully achieved imaging of ATP in living cells or organisms, providing valuable insights into exploring related physiol. actions. This article reviews the recent advances in the fluorescence anal. of ATP in vivo, describes their sensing mechanisms and characteristics, points out their applications in biol. research, and offers prospects of the developments in the future.
- 33Ng, S.; Lim, H. S.; Ma, Q.; Gao, Z. Optical aptasensors for adenosine triphosphate. Theranostics 2016, 6, 1683– 1702, DOI: 10.7150/thno.15850[Crossref], [PubMed], [CAS], Google Scholar33https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFersrzI&md5=5e94cc8ac9afbbbb1dc81aeab0d53a88Optical aptasensors for adenosine triphosphateNg, Stella; Lim, Hui Si; Ma, Qian; Gao, ZhiqiangTheranostics (2016), 6 (10), 1683-1702CODEN: THERDS; ISSN:1838-7640. (Ivyspring International Publisher)Nucleic acids are among the most researched and applied biomols. Their diverse two- and three-dimensional structures in conjunction with their robust chem. and ease of manipulation provide a rare opportunity for sensor applications. Moreover, their high biocompatibility has seen them being used in the construction of in vivo assays. Various nucleic acid-based devices have been extensively studied as either the principal element in discrete mol.-like sensors or as the main component in the fabrication of sensing devices. The use of aptamers in sensors - aptasensors, in particular, has led to improvements in sensitivity, selectivity, and multiplexing capacity for a wide verity of analytes like proteins, nucleic acids, as well as small biomols. such as glucose and ATP (ATP). This article reviews the progress in the use of aptamers as the principal component in sensors for optical detection of ATP with an emphasis on sensing mechanism, performance, and applications with some discussion on challenges and perspectives.
- 34Sajid, M.; Nazal, M. K.; Mansha, M.; Alsharaa, A.; Jillani, S. M. S.; Basheer, C. Chemically modified electrodes for electrochemical detection of dopamine in the presence of uric acid and ascorbic acid: A review. TrAC, Trends Anal. Chem. 2016, 76, 15– 29, DOI: 10.1016/j.trac.2015.09.006[Crossref], [CAS], Google Scholar34https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFanu7%252FK&md5=d2db41933dbc8c56e7a510ce78ed2a01Chemically modified electrodes for electrochemical detection of dopamine in the presence of uric acid and ascorbic acid: A reviewSajid, Muhammad; Nazal, Mazen Khaled; Mansha, Muhammad; Alsharaa, Abdulnaser; Jillani, Shehzada Muhammad Sajid; Basheer, ChanbashaTrAC, Trends in Analytical Chemistry (2016), 76 (), 15-29CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)Dopamine (DA) is an important neurotransmitter and its abnormal concns. are assocd. with different diseases. Electrochem. detection of DA in real samples is challenging because of the presence of high concns. of electroactive interferents such as uric acid (UA) and ascorbic acid (AA). Chem. modified electrodes have been widely used to counter the problems of poor sensitivity and selectivity faced at bare electrodes. We have briefly reviewed the materials that have been extensively used to fabricate modified electrode surfaces for detection of DA. The characteristics of the materials that improve the electrocatalytic activity of the modified surfaces are discussed. The boundary of search was limited to the electrochem. methods dealing with the simultaneous detection of DA, UA, and AA levels or detection of only DA in the presence of UA and AA. Challenges assocd. with the quant. detn. of dopamine in real samples are critically reviewed and the possible solns. are described.
- 35Pandikumar, A.; How, G. T. S.; See, T. P.; Omar, F. S.; Jayabal, S.; Kamali, K. Z.; Yusoff, N.; Jamil, A.; Ramaraj, R.; John, S. A.; Lim, H. N.; Huang, N. M. Graphene and its nanocomposite material based electrochemical sensor platform for dopamine. RSC Adv. 2014, 4, 63296– 63323, DOI: 10.1039/C4RA13777A[Crossref], [CAS], Google Scholar35https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhvV2gtb%252FE&md5=a091dd571052f26a6534e810cf542f51Graphene and its nanocomposite material based electrochemical sensor platform for dopaminePandikumar, Alagarsamy; Soon How, Gregory Thien; See, Teo Peik; Omar, Fatin Saiha; Jayabal, Subramaniam; Kamali, Khosro Zangeneh; Yusoff, Norazriena; Jamil, Asilah; Ramaraj, Ramasamy; John, Swamidoss Abraham; Lim, Hong Ngee; Huang, Nay MingRSC Advances (2014), 4 (108), 63296-63323CODEN: RSCACL; ISSN:2046-2069. (Royal Society of Chemistry)A review. Dopamine (DA) is an important catecholamine neurotransmitter in the mammalian central nervous system that influences several physiol. functions. The impact of DA levels within the human body significantly affects the body functions. Maintaining DA level is essential and the electrochem. detection methods are often used to detect the DA level to regulate the body function. In this review, graphene (functionalized graphene and N-doped graphene) and its composites (metal, metal oxide, polymer, carbonaceous materials, clay, zeolite, and metal-org. framework based graphene composites) modified electrodes with their improved sensing performance towards DA along with several interfering species are described. Further, recent developments on the fabrication of various graphene based composite modified electrodes are also presented. Some important strategies to improve the selectivity and sensitivity towards DA with graphene based composite modified electrodes are also described.
- 36Rasheed, P. A.; Lee, J. S. recent advances in optical detection of dopamine using nanomaterials. Microchim. Acta 2017, 184, 1239– 1266, DOI: 10.1007/s00604-017-2183-6
- 37Mehlhorn, A.; Rahimi, P.; Joseph, Y. Aptamer-based biosensors for antibiotic detection: A review. Biosensors 2018, 8, 54, DOI: 10.3390/bios8020054[Crossref], [CAS], Google Scholar37https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvVahtrjF&md5=c64dbe18b3a5a5d262581b9252d0c258Aptamer-based biosensors for antibiotic detection: a reviewMehlhorn, Asol; Rahimi, Parvaneh; Joseph, YvonneBiosensors (2018), 8 (2), 54CODEN: BIOSHU; ISSN:2079-6374. (MDPI AG)Antibiotic resistance and, accordingly, their pollution because of uncontrolled usage has emerged as a serious problem in recent years. Hence, there is an increased demand to develop robust, easy, and sensitive methods for rapid evaluation of antibiotics and their residues. Among different anal. methods, the aptamer-based biosensors (aptasensors) have attracted considerable attention because of good selectivity, specificity, and sensitivity. This review gives an overview about recently-developed aptasensors for antibiotic detection. The use of various aptamer assays to det. different groups of antibiotics, like β-lactams, aminoglycosides, anthracyclines, chloramphenicol, (fluoro)quinolones, lincosamide, tetracyclines, and sulfonamides are presented in this paper.
- 38Shrivas, K.; Sahu, J.; Maji, P.; Sinha, D. Label-free selective detection of ampicillin drug in human urine samples using silver nanoparticles as a colorimetric sensing probe. New J. Chem. 2017, 41, 6685– 6692, DOI: 10.1039/C7NJ00448F[Crossref], [CAS], Google Scholar38https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhtVamsLnJ&md5=2e0f4159b1627f66ac8be8c322225393Label-free selective detection of ampicillin drug in human urine samples using silver nanoparticles as a colorimetric sensing probeShrivas, Kamlesh; Sahu, Jharna; Maji, Pathik; Sinha, DeepakNew Journal of Chemistry (2017), 41 (14), 6685-6692CODEN: NJCHE5; ISSN:1144-0546. (Royal Society of Chemistry)Stable citrate-capped silver nanoparticles (AgNPs) were developed as a colorimetric sensing probe for selective detection of ampicillin in urine samples. The method is based on the color change from yellow-to-pink and a red shift of localized surface plasmon resonance (LSPR) absorption band of AgNPs in UV-Vis region after the addn. of ampicillin into the NPs soln. This is due to the aggregation of AgNPs induced via the replacement of citrate stabilizing mols. from the surface of NPs by hydrolyzed product of ampicillin (penicillamine) formed at pH 4.0 through Ag-sulfur binding and electrostatic force of interactions. The control expts. were also carried out in those drugs that were not hydrolyzed and had no sulfur entity. They did not exhibit any color change and red shift of LSPR in UV-Vis region. The linear range for detn. of ampicillin was found in the range of 25-1200 ng mL-1 with their limit of detection being 10 ng mL-1. In comparison to conventional spectrophotometric and sophisticated anal. instruments, the proposed method was found to be simple, sensitive and cost effective for the detn. of ampicillin in urine samples.
- 39Huizenga, D. E.; Szostak, J. W. A DNA aptamer that binds adenosine and ATP. Biochemistry 1995, 34, 656– 665, DOI: 10.1021/bi00002a033[ACS Full Text], [CAS], Google Scholar39https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK2MXivFOqs7o%253D&md5=74cb35b81ca489f99b253c2c29ff6c99A DNA Aptamer That Binds Adenosine and ATPHuizenga, David E.; Szostak, Jack W.Biochemistry (1995), 34 (2), 656-65CODEN: BICHAW; ISSN:0006-2960. (American Chemical Society)We have used in vitro selection to isolate adenosine/ATP-binding DNA sequences from a pool of ≈2 × 1014 different random-sequence single-stranded DNA mols. One of these aptamers has been characterized and binds adenosine in soln. with a dissocn. const. of 6 ± 3 μM. Expts. with ATP analogs indicate that functional groups on both the base and the sugar of ATP are involved in the ligand/aptamer interaction. The binding domain of this aptamer was localized to a 42 base sequence by deletion anal. A pool of mutagenized versions of this sequence was then synthesized and screened for functional adenosine binding sequences; comparison of the selected variants revealed two highly conserved guanosine-rich regions, two invariant adenosine residues, and two regions of predominantly Watson-Crick covariation. This data led us to propose a model of the ATP-binding DNA structure which is based on a stable framework composed of two stacked G-quartets. The two highly conserved adenosine residues may stack between the top G-quartet and the two short stems, forming a pocket in which the adenosine or ATP ligand binds. Site-directed mutagenesis, base analog substitution studies, and the design of highly divergent but functional sequences provide support for this model.
- 40Song, K. M.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal. Bioanal. Chem. 2012, 402, 2153– 2161, DOI: 10.1007/s00216-011-5662-3[Crossref], [PubMed], [CAS], Google Scholar40https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XjtFKisw%253D%253D&md5=b3483118b3925886f8dec0d8594ef017Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methodsSong, Kyung-Mi; Jeong, Euiyoung; Jeon, Weejeong; Cho, Minseon; Ban, ChangillAnalytical and Bioanalytical Chemistry (2012), 402 (6), 2153-2161CODEN: ABCNBP; ISSN:1618-2642. (Springer)A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (Kd, AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, resp.). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distd. water. Because these detection limits were below the max. residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addn., this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry. The dual fluorescence-colorimetric method for the detection of ampicillin using the AMP17 ssDNA aptamer. The FAM-AMP17 aptamer is quenched by adsorption onto the surface of the AuNPs. If ampicillin and salt (NaCl) are added to the soln., fluorescence is recovered and the AuNPs aggregate. Conversely, the AuNP soln. treated with only salt shows no obvious changes.
- 41Walsh, R.; DeRosa, M. C. retention of function in the DNA homolog of the RNA dopamine aptamer. Biochem. Biophys. Res. Commun. 2009, 388, 732– 735, DOI: 10.1016/j.bbrc.2009.08.084[Crossref], [PubMed], [CAS], Google Scholar41https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhtFajsbzO&md5=c8b2229a6203d1ebb3b99d32e63b2c6eRetention of function in the DNA homolog of the RNA dopamine aptamerWalsh, Ryan; De Rosa, Maria C.Biochemical and Biophysical Research Communications (2009), 388 (4), 732-735CODEN: BBRCA9; ISSN:0006-291X. (Elsevier B.V.)While it is generally accepted that the functional tertiary structures formed by RNA cannot be replicated by a deoxy version of the same sequence, here we demonstrate conservation of function for a DNA homolog of an RNA aptamer. Using fluorescence anisotropy expts., this work demonstrates that the all-DNA version of the RNA dopamine aptamer is able to bind dopamine with improved affinity and similar specificity relative to the RNA aptamer. Mutation studies suggest that the binding site is maintained in both structure types. These findings will help to elucidate what sequences and secondary structures allow for retention of function in both RNA and DNA.
- 42Baldrich, E.; Restrepo, A.; OˈSullivan, C. K. aptasensor development: Elucidation of critical parameters for optical aptamer performance. Anal. Chem. 2004, 76, 7053– 7063, DOI: 10.1021/ac049258o[ACS Full Text], [CAS], Google Scholar42https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXptVamsLs%253D&md5=f5837fd8f91b6bb333fb17fd6b133198Aptasensor Development: Elucidation of Critical Parameters for Optimal Aptamer PerformanceBaldrich, Eva; Restrepo, Alexandre; O'Sullivan, Ciara K.Analytical Chemistry (2004), 76 (23), 7053-7063CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)Aptamers are synthetic oligonucleotides specifically selected to bind a certain target. Thanks to their high affinity and sensitivity, aptamers appear as alternative candidates to antibodies for anal. devices and several assays have been reported. However, and contrary to what happens with DNA probes, the aptamers' ability to bind their targets depends on folding and 3-D structure, which may be affected by the incubation conditions and buffer compn. In this report, a systematic evaluation of the parameters with potential effect on the ELAA (Enzyme Linked Aptamer Assay) performance has been carried out. Addnl., diverse ELAA and mixed ELISA/ELAA formats exploiting the thrombin-binding aptamer have been optimized and their efficiencies compared. ELAA results have been confirmed using NMR, electrophoresis, and surface plasmon resonance. Our results indicate that parameters such as immobilization strategy, incubation time/temp., and buffer compn. should be optimized for each aptamer as they affect folding and, thus, binding efficiency. Among the studied assays, the mixed ELISA/ELAA sandwich formats showed the lowest limit of detection obsd. (<1 nM thrombin), while a competition ELAA appeared as the best assay in terms of high sensitivity (1.8 nM) and short assay time (1 h, 30 min). The elucidation of optimal parameters for assay performance reported here clearly indicates that aptamers are unique structures. Formation of the 3-D structures required for target binding is influenced by variable parameters, and unlike DNA/antibody based assays, there are no general recommendations, with each assay requiring individual optimization of parameters.
- 43Haq, I.; Lincoln, P.; Suh, D.; Norden, B.; Chowdhry, B. Z.; Chaires, J. B. Interaction of Δ- and Λ-[Ru(phen)2DPPZ]2+ with DNA: A colorimetric and Equilibrium binding study. J. B. J. Am. Chem. Soc. 1995, 117, 4788– 4796, DOI: 10.1021/ja00122a008[ACS Full Text], [CAS], Google Scholar43https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK2MXlt1SrtLo%253D&md5=c293fdc027fa3a946a95198efe7e1c13Interaction of Δ- and Λ-[Ru(phen)2DPPZ]2+ with DNA: A Calorimetric and Equilibrium Binding StudyHaq, Ihtshamul; Lincoln, Per; Suh, Dongchul; Norden, Bengt; Chowdhry, Babur Z.; Chaires, Jonathan B.Journal of the American Chemical Society (1995), 117 (17), 4788-96CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)Fluorescence and absorption spectroscopy, isothermal titrn. calorimetry, and viscosity measurements have been used to characterize the interaction of Δ and Λ [Ru(phen)2DPPZ]2+ with calf thymus DNA. The method of continuous variations revealed two distinct binding stoichiometries for both Δ- and Λ-DPPZ, corresponding to 0.7 and 3 mol of base pair/mol of ligand. Binding isotherms were obtained for the two enantiomers, both of which show strong binding to DNA, with K = 3.2 × 106 M-1 bp and 1.7 × 106 M-1 bp for the Δ and Λ isomers, resp., at 25 °C in solns. contg. 50 mM NaCl. Titrn. calorimetry gave ΔH values of +0.3 kcal mol-1 for Δ-DPPZ and +2.9 kcal mol-1 for Λ-DPPZ for their interaction with DNA. These small pos. enthalpies, which were confirmed using thermal difference spectroscopy, indicated that the binding of these compds. to DNA is entropically driven. An enthalpy of +2.5 kcal mol-1 was obtained for the binding of the parent compd., tris(phenanthroline)Ru(II), to DNA. Titrn. of all three compds. into buffer gave a nonnegligible heat of diln. The salt dependence of the binding const. was examd. for both isomers. The slope SK = (δlogK/δlog[Na+]) was found to be 1.9 and 2.1 for the Δ and Λ isomers, resp. By using polyelectrolyte theory to interpret the obsd. salt dependence of the equil. const., it can be shown that there is a significant nonelectrostatic contribution to the binding const. Relative viscosity expts. showed that both Δ- and Λ-DPPZ increase the length of rod-like DNA, in a manner consistent with binding by classical intercalation. Fluorescence energy transfer expts. provided addnl. evidence for the intercalation of Δ- and Λ-[Ru(phen)2DPPZ]2+ into DNA.
- 44Munzar, J. D.; Ng, A.; Juncker, D. Duplexed aptamers: history, design, theory, and application to biosensing. Chem. Soc. Rev. 2019, 48, 1390– 1419, DOI: 10.1039/C8CS00880A[Crossref], [PubMed], [CAS], Google Scholar44https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXktVKktbs%253D&md5=e7d21ead990f43e31fe5bab82dd60628Duplexed aptamers: history, design, theory, and application to biosensingMunzar, Jeffrey D.; Ng, Andy; Juncker, DavidChemical Society Reviews (2019), 48 (5), 1390-1419CODEN: CSRVBR; ISSN:0306-0012. (Royal Society of Chemistry)Nucleic acid aptamers are single stranded DNA or RNA sequences that specifically bind a cognate ligand. In addn. to their widespread use as stand-alone affinity binding reagents in anal. chem., aptamers have been engineered into a variety of ligand-specific biosensors, termed aptasensors. One of the most common aptasensor formats is the duplexed aptamer (DA). As defined herein, DAs are aptasensors contg. two nucleic acid elements coupled via Watson-Crick base pairing: (i) an aptamer sequence, which serves as a ligand-specific receptor, and (ii) an aptamer-complementary element (ACE), such as a short DNA oligonucleotide, which is designed to hybridize to the aptamer. The ACE competes with ligand binding, such that DAs generate a signal upon ligand-dependent ACE-aptamer dehybridization. DAs possess intrinsic advantages over other aptasensor designs. For example, DA biosensing designs generalize across DNA and RNA aptamers, DAs are compatible with many readout methods, and DAs are inherently tunable on the basis of nucleic acid hybridization. However, despite their utility and popularity, DAs have not been well defined in the literature, leading to confusion over the differences between DAs and other aptasensor formats. In this review, we introduce a framework for DAs based on ACEs, and use this framework to distinguish DAs from other aptasensor formats and to categorize cis- and trans-DA designs. We then explore the ligand binding dynamics and chem. properties that underpin DA systems, which fall under conformational selection and induced fit models, and which mirror classical SN1 and SN2 models of nucleophilic substitution reactions. We further review a variety of in vitro and in vivo applications of DAs in the chem. and biol. sciences, including riboswitches and riboregulators. Finally, we present future directions of DAs as ligand-responsive nucleic acids. Owing to their tractability, versatility and ease of engineering, DA biosensors bear a great potential for the development of new applications and technologies in fields ranging from anal. chem. and mechanistic modeling to medicine and synthetic biol.
- 45Wang, J.; Jiang, Y.; Zhou, C.; Fang, X. Aptamer-based ATP assay using a luminescent light switching complex. Anal. Chem. 2005, 77, 3542– 3546, DOI: 10.1021/ac050165w[ACS Full Text], [CAS], Google Scholar45https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXjsFaiu7s%253D&md5=168ab63fd0dd0836d2b2776739d4e874Aptamer-Based ATP Assay Using a Luminescent Light Switching ComplexWang, Jun; Jiang, Yaxin; Zhou, Cuisong; Fang, XiaohongAnalytical Chemistry (2005), 77 (11), 3542-3546CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)With the increasing applications of nucleic acid aptamers as a new class of mol. recognition probes in bioanal. and biosensor development, the development of general and simple signaling strategies to transduce aptamer-target binding events to detectable signals is demanding. We have developed a new signaling method based on aptamers and a DNA mol. light switching complex, [Ru(phen)2(dppz)]2+, for sensitive protein detection. In this work, we have demonstrated the applicability of this signaling mechanism to small-mol. detection using ATP as a model target. Our results have shown that upon ATP binding to the folded aptamer where [Ru(phen)2(dppz)]2+ intercalated, the conformational change or distortion of the aptamer is large enough to cause a significant luminescence change of [Ru(phen)2(dppz)]2+. By monitoring the ATP-dependent luminescence intensity change, we have achieved ATP detection with high selectivity and high sensitivity down to 1 nM in homogeneous soln. The method is very simple without the needs for covalently labeling aptamers or using costly enzymes and multistep anal. as other reported fluorescence/luminescence assays for ATP. The successful detection of ATP indicates that using the signaling aptamers with [Ru(phen)2(dppz)]2+ is expected to be a general method for aptamer-based target detection.
- 46Jhaveri, S. D.; Kirby, R.; Conrad, R.; Maglott, E. J.; Bowser, M.; Kennedy, R. T.; Glick, G.; Ellington, A. D. Designed signaling aptamers that transduce molecular recognition to changes in fluorescence intensity. J. Am. Chem. Soc. 2000, 122, 2469– 2473, DOI: 10.1021/ja992393b[ACS Full Text], [CAS], Google Scholar46https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXhsValurc%253D&md5=125f40759f1a7d9306181764334bd80cDesigned Signaling Aptamers that Transduce Molecular Recognition to Changes in Fluorescence IntensityJhaveri, Sulay D.; Kirby, Romy; Conrad, Rick; Maglott, Emily J.; Bowser, Michael; Kennedy, Robert T.; Glick, Gary; Ellington, Andrew D.Journal of the American Chemical Society (2000), 122 (11), 2469-2473CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)We have engineered aptamers that contain fluorescent reporters and that signal the presence of cognate ligands in soln. Two different anti-adenosine "signaling aptamers", one made from RNA and one from DNA, can selectively signal the presence of adenosine in soln. Increases in fluorescence intensity reproducibly follow increases in adenosine concn., and can be used for quantitation. The facile methods we have developed can potentially be used for generating a wide variety of signaling aptamers for use in sensor arrays.
- 47Haiss, W.; Thanh, N. T. K.; Aveyard, J.; Fernig, D. G. Determination of size and concentration of gold nanoparticles from UV-vis spectra. Anal. Chem. 2007, 79, 4215– 4221, DOI: 10.1021/ac0702084[ACS Full Text], [CAS], Google Scholar47https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXksFCit7s%253D&md5=ecb11697688b35428cbb97d0e660c911Determination of Size and Concentration of Gold Nanoparticles from UV-Vis SpectraHaiss, Wolfgang; Thanh, Nguyen T. K.; Aveyard, Jenny; Fernig, David G.Analytical Chemistry (Washington, DC, United States) (2007), 79 (11), 4215-4221CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The dependence of the optical properties of spherical gold nanoparticles on particle size and wavelength were analyzed theor. using multipole scattering theory, where the complex refractive index of gold was cor. for the effect of a reduced mean free path of the conduction electrons in small particles. To compare these theor. results to exptl. data, gold nanoparticles in the size range of 5 to 100 nm were synthesized and characterized with TEM and UV-visible. Excellent agreement was found between theory and expt. The data produced here can be used to det. both size and concn. of gold nanoparticles directly from UV-visible spectra. Equations for this purpose are derived, and the precision of various methods is discussed. The major aim of this work is to provide a simple and fast method to det. size and concn. of nanoparticles.
Cited By
This article is cited by 1 publications.
- Akihisa MIYAGAWA, Tetsuo OKADA. Particle Manipulation with External Field; From Recent Advancement to Perspectives. Analytical Sciences 2021, 37 (1) , 69-78. https://doi.org/10.2116/analsci.20SAR03
Abstract
Figure 1
Figure 1. Relationships between the voltage applied to the transducer (V) and the levitation coordinates of PMMAs with different densities: (A) 1.188 and (B) 1.265 g cm–3. Solid curves were calculated using eq 1 with the fitting parameter a = 0.0408 and 0.0388 for A and B, respectively. Vth represents the threshold V values for the PMMAs, below which the particles do not levitate.
Figure 2
Figure 2. Schematic representation of aptamer-based sensing in the CAG field.
Figure 3
Figure 3. Relationships between the logarithmic concentration target (log c) and Δz for ATP (blue), DA (red), and AMP (black). The red dashed line represents the average maximum Δz at rPMMA/AuNP = 10,000.
Figure 4
Figure 4. FE-SEM images of PMMAs for ATP at (A) c = 1 nM and (B) c = 1 mM.
Figure 5
Figure 5. Calibration graphs for ATP in swine blood. Black open circles; standard solutions prepared in water. Red solid circles; standard solution prepared in diluted swine blood.
Figure 6
Figure 6. Equilibrium models of aptamer-based sensing. (A)–(F) represent (A) capture probe DNA anchored on PMMA, (B) aptamer, (C) AuNP with probe DNA, (D) duplex between the aptamer and probe DNA molecules, (E) target, and (F) aptamer–target complex.
Figure 7
Figure 7. Relationships between the logarithmic target concentration (log c) and the reaction ratios of aptamers-targets calculated from Δz shown in Figure 3. Symbols: ATP: blue dots, DA: red dots, and AMP: black dots. Curves represent the results of calculation assuming K1 = 1.58 × 1020 M–2, K2 = 1.00 × 10–11 for AMP, 1.58 × 10–13 for DA, and 3.98 × 10–14 M for ATP.
References
ARTICLE SECTIONSThis article references 47 other publications.
- 1Ilgu, M.; Nilsen-Hamilton, M. Aptamers in analytics. Analyst 2016, 141, 1551– 1568, DOI: 10.1039/C5AN01824B[Crossref], [PubMed], [CAS], Google Scholar1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xps1Kktw%253D%253D&md5=430fe7d8ac293b13b9c91bc903f26ab1Aptamers in analyticsIlgu, Muslum; Nilsen-Hamilton, MaritAnalyst (Cambridge, United Kingdom) (2016), 141 (5), 1551-1568CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Nucleic acid aptamers are promising alternatives to antibodies in analytics. They are generally obtained through an iterative SELEX protocol that enriches a population of synthetic oligonucleotides to a subset that can recognize the chosen target mol. specifically and avidly. A wide range of targets is recognized by aptamers. Once identified and optimized for performance, aptamers can be reproducibly synthesized and offer other key features, like small size, low cost, sensitivity, specificity, rapid response, stability, and reusability. This makes them excellent options for sensory units in a variety of anal. platforms including those with electrochem., optical, and mass sensitive transduction detection. Many novel sensing strategies have been developed by rational design to take advantage of the tendency of aptamers to undergo conformational changes upon target/analyte binding and employing the principles of base complementarity that can drive the nucleic acid structure. Despite their many advantages over antibodies, surprisingly few aptamers have yet been integrated into com. available anal. devices. In this review, how to select and engineer aptamers for their identified application(s), some of the challenges faced in developing aptamers for analytics and many examples of their reported successful performance as sensors in a variety of anal. platforms are discussed.
- 2Hayat, A.; Marty, J. L. Aptamer based electrochemical sensors for emerging environmental pollutants. Front. Chem. 2014, 2, 41, DOI: 10.3389/fchem.2014.00041[Crossref], [PubMed], [CAS], Google Scholar2https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cbhvVartg%253D%253D&md5=b480c4875941328731776f29d6ce3e9eAptamer based electrochemical sensors for emerging environmental pollutantsHayat Akhtar; Marty Jean LFrontiers in chemistry (2014), 2 (), 41 ISSN:2296-2646.Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.
- 3Ku, T.-H.; Zhang, T.; Luo, H.; Yen, T.; Chen, P.-W.; Han, Y.; Lo, Y. H. Nucleic acid aptamers: an emerging tool for biotechnology and biomedical sensing. Sensors 2015, 15, 16281– 16313, DOI: 10.3390/s150716281[Crossref], [CAS], Google Scholar3https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhs1Sjsb%252FN&md5=926504bcb663742578fc943ebc420dc1Nucleic acid aptamers: an emerging tool for biotechnology and biomedical sensingKu, Ti-Hsuan; Zhang, Tiantian; Luo, Hua; Yen, Tony M.; Chen, Ping-Wei; Han, Yuanyuan; Lo, Yu-HwaSensors (2015), 15 (7), 16281-16313CODEN: SENSC9; ISSN:1424-8220. (MDPI AG)Detection of small mols. or proteins of living cells provides an exceptional opportunity to study genetic variations and functions, cellular behaviors, and various diseases including cancer and microbial infections. Our aim in this review is to give an overview of selected research activities related to nucleic acid-based aptamer techniques that have been reported in the past two decades. Limitations of aptamers and possible approaches to overcome these limitations are also discussed.
- 4Du, Y.; Dong, S. Nucleic acid biosensors: recent advances and perspectives. Anal. Chem. 2017, 89, 189– 215, DOI: 10.1021/acs.analchem.6b04190[ACS Full Text], [CAS], Google Scholar4https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvVert7nK&md5=b47d361b503d5c89271c4d965b83bb8aNucleic Acid Biosensors: Recent Advances and PerspectivesDu, Yan; Dong, ShaojunAnalytical Chemistry (Washington, DC, United States) (2017), 89 (1), 189-215CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A review. In this review, progress in research of biosensors based on DNA and aptamer/DNAzyme throughout recent years (2014-2016) is summarized. The representative properties are listed in this review, together with existing deficiencies, and current challenges are also discussed for future development of biosensor technol.
- 5Zhou, W.; Huang, P.-J. J.; Ding, J.; Liu, J. Aptamer-based biosensors for biomedical diagnostics. Analyst 2014, 139, 2627– 2640, DOI: 10.1039/c4an00132j[Crossref], [PubMed], [CAS], Google Scholar5https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXnsFWksbo%253D&md5=73e637042ce5801ba535feec1cbd25f2Aptamer-based biosensors for biomedical diagnosticsZhou, Wenhu; Huang, Po-Jung Jimmy; Ding, Jinsong; Liu, JuewenAnalyst (Cambridge, United Kingdom) (2014), 139 (11), 2627-2640CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Aptamers are single-stranded nucleic acids that selectively bind to target mols. Most aptamers are obtained through a combinatorial biol. technique called SELEX. Since aptamers can be isolated to bind to almost any mol. of choice, can be readily modified at arbitrary positions and they possess predictable secondary structures, this platform technol. shows great promise in biosensor development. Over the past two decades, more than one thousand papers have been published on aptamer-based biosensors. Given this progress, the application of aptamer technol. in biomedical diagnosis is still in a quite preliminary stage. Most previous work involves only a few model aptamers to demonstrate the sensing concept with limited biomedical impact. This crit. review aims to summarize progress that might enable practical applications of aptamers for biol. samples. First, general sensing strategies based on the unique properties of aptamers are summarized. Each strategy can be coupled to various signaling methods. Among these, a few detection methods including fluorescence lifetime, flow cytometry, upconverting nanoparticles, nanoflare technol., magnetic resonance imaging, electronic aptamer-based sensors, and lateral flow devices have been discussed in more detail since they are more likely to work in a complex sample matrix. The current limitations of this field include the lack of high quality aptamers for clin. important targets. In addn., the aptamer technol. has to be extensively tested in a clin. sample matrix to establish reliability and accuracy. Future directions are also speculated to overcome these challenges.
- 6Cheng, A. K. H.; Sen, D.; Yu, H. Z. Design and testing of aptamer-based electrochemical biosensors for proteins and small molecules. Bioelectrochemistry 2009, 77, 1– 12, DOI: 10.1016/j.bioelechem.2009.04.007[Crossref], [PubMed], [CAS], Google Scholar6https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXht1WmsrjO&md5=880b0842ffe20062f47a6a9b376c77dfDesign and testing of aptamer-based electrochemical biosensors for proteins and small moleculesCheng, Alan K. H.; Sen, Dipankar; Yu, Hua-ZhongBioelectrochemistry (2009), 77 (1), 1-12CODEN: BIOEFK; ISSN:1567-5394. (Elsevier B.V.)A review. The fabrication of aptamer-based electrochem. biosensors as an emerging technol. has made the detection of small and macromol. analytes easier, faster, and more suited for the ongoing transition from fundamental anal. science to the early detection of protein biomarkers. Aptamers are synthetic oligonucleotides that have undergone iterative rounds of in vitro selection for binding with high affinity to specific analytes of choice; a sensitive yet simple method to utilize aptamers as recognition entities for the development of biosensors is to transduce the signal electrochem. In this review article, we attempt to summarize the state-of-the-art research progresses that have been published in recent years; in particular, we focus on the electrochem. biosensors that incorporate aptamers for sensing small org. mols. and proteins. Based on differences in the design of the DNA/RNA-modified electrodes, we classify aptamer-based electrochem. sensors into three categories, for which the analyte detection relies on: (a) configurational change, i.e., the analyte binding induces either an assembly or dissocn. of the sensor construct; (b) conformational change, i.e., the analyte binding induces an alteration in the conformation (folding) of the surface immobilized aptamer strands; and (c) cond. change, i.e., the analyte binding "switches on" the cond. of the surface-bound aptamer-DNA constructs. In each section, we will discuss the performance of these novel biosensors with representative examples reported in recent literature.
- 7Li, Y.; Lee, H. J.; Corn, R. M. Detection of protein biomarkers using RNA aptamer microarrays and enzymatically amplified surface plasmon resonance imaging. Anal. Chem. 2007, 79, 1082– 1088, DOI: 10.1021/ac061849m[ACS Full Text], [CAS], Google Scholar7https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXlsVKn&md5=b3eb78a9d1b13c86cac97b8342fb1b34Detection of Protein Biomarkers Using RNA Aptamer Microarrays and Enzymatically Amplified Surface Plasmon Resonance ImagingLi, Yuan; Lee, Hye Jin; Corn, Robert M.Analytical Chemistry (2007), 79 (3), 1082-1088CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A methodol. for the detection of protein biomarkers at picomolar concns. that utilizes surface plasmon resonance imaging (SPRI) measurements of RNA aptamer microarrays is developed. The adsorption of proteins onto the RNA microarray is detected by the formation of a surface aptamer-protein-antibody complex. The SPRI response signal is then amplified using a localized pptn. reaction catalyzed by the enzyme horseradish peroxidase that is conjugated to the antibody. This enzymically amplified SPRI methodol. is first characterized by the detection of human thrombin at a concn. of 500 fM; the appropriate thrombin aptamer for the sandwich assay is identified from a microarray of three potential thrombin aptamer candidates. The SPRI method is then used to detect the protein vascular endothelial growth factor (VEGF) at a biol. relevant concn. of 1 pM. VEGF is a signaling protein that has been used as a serum biomarker for rheumatoid arthritis, breast cancer, lung cancer, and colorectal cancer and is also assocd. with age-related macular degeneration.
- 8Savran, C. A.; Knudsen, S. M.; Ellington, A. D.; Manalis, S. R. Micromechanical detection of proteins using aptamer-based receptor molecules. Anal. Chem. 2004, 76, 3194– 3198, DOI: 10.1021/ac049859f[ACS Full Text], [CAS], Google Scholar8https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXjsVOit74%253D&md5=5b6a978ea5c5f2f110db1e00ac841671Micromechanical detection of proteins using aptamer-based receptor moleculesSavran, Cagri A.; Knudsen, Scott M.; Ellington, Andrew D.; Manalis, Scott R.Analytical Chemistry (2004), 76 (11), 3194-3198CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)We report label-free protein detection using a microfabricated cantilever-based sensor that is functionalized with DNA aptamers to act as receptor mols. The sensor utilizes two adjacent cantilevers that constitute a sensor/ref. pair and allows direct detection of the differential bending between the two cantilevers. One cantilever is functionalized with aptamers selected for Taq DNA polymerase while the other is blocked with single-stranded DNA. We have found that the polymerase-aptamer binding induces a change in surface stress, which causes a differential cantilever bending that ranges from 3 to 32 nm depending on the ligand concn. Protein recognition on the sensor surface is specific and has a concn. dependence that is similar to that in soln.
- 9Ueyama, H.; Takagi, M.; Takenaka, S. A novel potassium sensing in aqueous media with a synthetic oligonucleotide derivative. Fluorescence resonance energy transfer associated with guanine quartet-potassium ion complex formation. J. Am. Chem. Soc. 2002, 124, 14286– 14287, DOI: 10.1021/ja026892f[ACS Full Text], [CAS], Google Scholar9https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD38XosVCgtLc%253D&md5=7536c6e47b1d3385b1ca0155901ba556A novel potassium sensing in aqueous media with a synthetic oligonucleotide derivative. fluorescence resonance energy transfer associated with guanine quartet-potassium ion complex formationUeyama, Hiroyuki; Takagi, Makoto; Takenaka, ShigeoriJournal of the American Chemical Society (2002), 124 (48), 14286-14287CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)A novel potassium sensing oligonucleotide (PSO) was constructed by attaching fluorophores 6-FAM and 6-TAMRA to the 5'- and 3'-termini of d(GGG TTA GGG TTA GGG TTA GGG), resp. The affinity of PSO for K+ was 43 000 times greater than that for Na+, high enough selectivity enabling quantitation of K+ specifically in the presence of excess Na+. Fluorescence resonance energy transfer (FRET) to 6-TAMRA from 6-FAM of PSO was obsd. only in the presence of K+. This phenomenon is based on the approxn. of the two fluorophores upon formation of a guanine quartet mediated by K+. Furthermore, the fluorescent color of PSO changes from yellow to red upon formation of the complex, thereby enabling visualization of K+ in aq. media.
- 10Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. Light-switching excimer probes for rapid protein monitoring in complex biological fluids. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 17278, DOI: 10.1073/pnas.0508821102[Crossref], [PubMed], [CAS], Google Scholar10https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXhtlSqtLfP&md5=e117da837df74f10cd711db7ca9b2287Light-switching excimer probes for rapid protein monitoring in complex biological fluidsYang, Chaoyong James; Jockusch, Steffen; Vicens, Marie; Turro, Nicholas J.; Tan, WeihongProceedings of the National Academy of Sciences of the United States of America (2005), 102 (48), 17278-17283CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Quant. protein bioanal. in complex biol. fluids presents considerable challenges in biol. studies and disease diagnosis. The major obstacles are the background signals from both the probe and the biol. fluids where the proteins reside. The authors have molecularly engineered light-switching excimer aptamer probes for rapid and sensitive detection of a biomarker protein, platelet-derived growth factor (PDGF). Labeled with one pyrene at each end, the aptamer switches its fluorescence emission from ≈400 nm (pyrene monomer) to 485 nm (pyrene excimer) upon PDGF binding. This fluorescence wavelength change from monomer to excimer emission is a result of aptamer conformation rearrangement induced by target binding. The excimer probe is able to effectively detect picomolar PDGF in homogeneous solns. Because the excimer has a much longer fluorescence lifetime (≈40 ns) than that of the background (≈5 ns), time-resolved measurements were used to eliminate the biol. background. The authors thus were able to detect PDGF in a cell sample quant. without any sample pretreatment. This mol. engineering strategy can be used to develop other aptamer probes for protein monitoring. Combined with lifetime-based measurements and mol. engineering, light-switching excimer aptamer probes hold great potential in protein anal. for biomedical studies.
- 11Stojanovic, M. N.; de Prada, P.; Landry, D. W. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 2001, 123, 4928– 4931, DOI: 10.1021/ja0038171[ACS Full Text], [CAS], Google Scholar11https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXjtFGqsro%253D&md5=490c17b48056c3dfe513b32c5276a3e3Aptamer-Based Folding Fluorescent Sensor for CocaineStojanovic, Milan N.; de Prada, Paloma; Landry, Donald W.Journal of the American Chemical Society (2001), 123 (21), 4928-4931CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)We adapted in two steps a deoxyribonucleotide-based aptamer to signal the recognition of cocaine: an instability was engineered in one stem of a three-way junction that forms the cocaine-binding pocket and the resulting short stem was end labeled with a fluorophore and a quencher. In the absence of cocaine, two stems are open, but in its presence they close and the three-way junction forms. This major structural change brings fluorophore and quencher together thereby signaling the presence and concn. of ligand. The sensor is selective for cocaine over its metabolites, can operate in serum, and is useful for the screening of cocaine hydrolases.
- 12Liu, J.; Lee, J. H.; Lu, Y. Quantum dot encoding of aptamer-linked nanostructures for one-pot simultaneous detection of multiple analytes. Anal. Chem. 2007, 79, 4120– 4125, DOI: 10.1021/ac070055k[ACS Full Text], [CAS], Google Scholar12https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXkvVymur4%253D&md5=cf36d80fb34287f6405d2deb08a30ef5Quantum Dot Encoding of Aptamer-Linked Nanostructures for One-Pot Simultaneous Detection of Multiple AnalytesLiu, Juewen; Lee, Jung Heon; Lu, YiAnalytical Chemistry (Washington, DC, United States) (2007), 79 (11), 4120-4125CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)One major challenge in anal. chem. is multiplex sensing of a no. of analytes with each analyte displaying a different signal. To meet such a challenge, quantum dots that emit at 525 and 585 nm are used to encode aptamer-linked nanostructures sensitive to adenosine and cocaine, resp. In addn. to quantum dots, the nanostructures also contain gold nanoparticles that serve as quenchers. Addn. of target analytes disassembles the nanostructures and results in increased emission from quantum dots. Simultaneous colorimetric and fluorescent detection and quantification of both mols. in one pot is demonstrated.
- 13Liu, J.; Lu, Y. Fast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticles. Angew. Chem., Int. Ed. 2006, 45, 90, DOI: 10.1002/anie.200502589[Crossref], [CAS], Google Scholar13https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhslKgtQ%253D%253D&md5=8038b410625aa97ca2e0d53e1ea8216cFast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticlesLiu, Juewen; Lu, YiAngewandte Chemie, International Edition (2006), 45 (1), 90-94CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)DNA aptamers have been used to assemble DNA-functionalized gold nanoparticles to produce highly sensitive and selective colorimetric sensors with an instantaneous color response on addn. of a substrate. The general method has been shown for adenosine and cocaine, but should be applicable to any aptamer of choice.
- 14Lu, C. H.; Yang, H. H.; Zhu, C. L.; Chen, X.; Chen, G. N. A graphene platform for sensing biomolecules. Angew. Chem., Int. Ed. 2009, 48, 4785– 4787, DOI: 10.1002/anie.200901479[Crossref], [PubMed], [CAS], Google Scholar14https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXntlOitb4%253D&md5=60952d44796a7b63706a2225a19f4729A Graphene Platform for Sensing BiomoleculesLu, Chun-Hua; Yang, Huang-Hao; Zhu, Chun-Ling; Chen, Xi; Chen, Guo-NanAngewandte Chemie, International Edition (2009), 48 (26), 4785-4787CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)The use of graphene oxide (GO) as a platform for the sensitive and selective detection of DNA and proteins is presented. The interaction of GO and dye-labeled single-stranded DNA leads to quenching of the dye fluorescence. Conversely, the presence of a target DNA or protein leads to the binding of the dye-labeled DNA and target, releasing the DNA from GO, thereby restoring the dye fluorescence.
- 15Peyrin, E. Nucleic acid aptamer molecular recognition principles and application in liquid chromatography and capillary electrophoresis. J. Sep. Sci. 2009, 32, 1531– 1536, DOI: 10.1002/jssc.200900061[Crossref], [PubMed], [CAS], Google Scholar15https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmvFCmt74%253D&md5=eae0c26d0f022ffc9e8ac915c215ef66Nucleic acid aptamer molecular recognition principles and application in liquid chromatography and capillary electrophoresisPeyrin, EricJournal of Separation Science (2009), 32 (10), 1531-1536CODEN: JSSCCJ; ISSN:1615-9306. (Wiley-VCH Verlag GmbH & Co. KGaA)A review. Nucleic acid aptamers isolated from the systematic evolution of ligands by exponential enrichment (SELEX) have the capacity to recognize various classes of target mols. with high affinity and specificity. In this context, the development of aptamer-based mol. recognition tools has become a very interesting and promising anal. strategy during the last few years. In this review, the mol. recognition features of aptamers as well as the key factors for their practical applicability to the chromatog. and capillary electrophoretic fields are summarized.
- 16Yu, F.; Zhao, Q.; Zhang, D.; Yuan, Z.; Wang, H. Affinity interactions by capillary electrophoresis: binding, separation, and detection. Anal. Chem. 2019, 91, 372– 387, DOI: 10.1021/acs.analchem.8b04741[ACS Full Text], [CAS], Google Scholar16https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVyju7fJ&md5=cfa143cb4653e5ff791901f327206822Affinity Interactions by Capillary Electrophoresis: Binding, Separation, and DetectionYu, Fangzhi; Zhao, Qiang; Zhang, Dapeng; Yuan, Zheng; Wang, HailinAnalytical Chemistry (Washington, DC, United States) (2019), 91 (1), 372-387CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A review. Affinity interactions between mols. constitute this amazing and mysterious world of the human-living earth. At the level of individuals, affinity interactions are fundamental for the paramount functions and exquisite architectures of all organisms in life, for the occurrence and development of diseases, for the therapy-assocd. diagnosis, pharmaceutics and medicine (and cutting-edge regenerative medicine), and for the environment-life interplayed sphere. At the level of cells, affinity interactions function critically throughout every facet of every cells (e.g., division, differentiation, and motility), between cells (e.g., communication, aggregation, immune response), during organogenesis and organ maintenance. At the level of mol. events, affinity interactions allow the cells to make DNA package (nucleosome, chromosome), to perform precise DNA replication and timely DNA repair, transcription, translation, mRNA splicing, and to modify proteins and nucleic acids (typically in epigenetics). In essence, all mols. within and outside the cells, such as proteins, nucleic acids, hormones, and nutrients play vital roles through affinity interaction network in regulating fundamental life processes.
- 17Šmuc, T.; Ahn, I.-Y.; Ulrich, H. Nucleic acid aptamers as high affinity ligands in biotechnology and biosensorics. J. Pharm. Biomed. Anal. 2013, 81-82, 210– 217, DOI: 10.1016/j.jpba.2013.03.014[Crossref], [PubMed], [CAS], Google Scholar17https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXotlGmsbo%253D&md5=cb33a9d7caf3208889015185fd8a31bbNucleic acid aptamers as high affinity ligands in biotechnology and biosensoricsSmuc, Tina; Ahn, Il-Young; Ulrich, HenningJournal of Pharmaceutical and Biomedical Analysis (2013), 81-82 (), 210-217CODEN: JPBADA; ISSN:0731-7085. (Elsevier B.V.)A review. Aptamers are small nucleic acid mols. capable of binding to a wide range of target mols. with high affinity and specificity. They have been developed and widely used not only as research tools, but also as biosensors, specific antagonists, and diagnostic markers and as protein purifn. platform for many pharmaceutical and clin. applications. Here, the authors will explore biochem. aspects of aptamer-target interactions and show why aptamers rival antibodies in target recognition and purifn. procedures. This review will focus on strategies of using aptamers as affinity ligands for mols. of therapeutic and pharmaceutical interest including applications in chromatog. and capillary electrophoresis for protein and small mol. purifn. Moreover, the authors will also discuss aptamers whose binding parameters can be controlled on demand for diagnostic approaches and used as sensitive receptors in biosensorics. Aptamers have opened up exciting fields in basic and applied research of pharmaceutical and biotechnol. interest.
- 18Cai, S.; Yan, J.; Xiong, H.; Liu, Y.; Peng, D.; Liu, Z. Investigations on the interface of nucleic acid aptamers and binding targets. Analyst 2018, 143, 5317– 5338, DOI: 10.1039/C8AN01467A[Crossref], [PubMed], [CAS], Google Scholar18https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVKmsbzM&md5=8a7f0354ca9a1ad38377a1948b89278aInvestigations on the interface of nucleic acid aptamers and binding targetsCai, Shundong; Yan, Jianhua; Xiong, Hongjie; Liu, Yanfei; Peng, Dongming; Liu, ZhenbaoAnalyst (Cambridge, United Kingdom) (2018), 143 (22), 5317-5338CODEN: ANALAO; ISSN:0003-2654. (Royal Society of Chemistry)A review. Nucleic acid aptamers are single-stranded DNA or RNA of 20-100 nucleotides in length that have attracted substantial scientific interest due to their ability to specifically bind to target mols. via the formation of three-dimensional structures. Compared to traditional protein antibodies, aptamers have several advantages, such as their small size, high binding affinity, specificity, flexible structure, being chem. synthesizable and modifiable, good biocompatibility, high stability and low immunogenicity, which all contribute to their widely applications in the biomedical field. To date, much progress has been made in the study and applications of aptamers, however, detailed information on how aptamers bind to their targets is still scarce. Over the past few decades, many methods have been introduced to investigate the aptamer-target binding process, such as measuring the main kinetic or thermodn. parameters, detecting the structural changes of the binding complexes, etc. Apart from traditional physicochem. methods, various types of mol. docking programs have been applied to simulate the aptamer-target interactions, while these simulations also have limitations. To facilitate the further research on the interactions, herein, we provide a brief review to illustrate the recent advances in the study of aptamer-target interactions. We summarize the binding targets of aptamers, such as small mols., macromols., and even cells. Their binding consts. (KD) are also summarized. Methods to probe the aptamer-target binding process, such as surface plasmon resonance (SPR), CD spectroscopy (CD), isothermal titrn. calorimetry (ITC), footprinting assay, truncation and mutation assay, NMR spectroscopy (NMR), X-ray crystallog. and mol. docking simulation are indicated. The binding forces mediating the aptamer-target interactions, such as hydrogen bonding, electrostatic interaction, the hydrophobic effect, π-π stacking and van der Waals forces are summarized. The challenges and future perspectives are also discussed.
- 19Win, M. N.; Klein, J. S.; Smolke, C. D. Codeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assay. Nucleic Acids Res. 2006, 34, 5670– 5682, DOI: 10.1093/nar/gkl718[Crossref], [PubMed], [CAS], Google Scholar19https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xht1SrtL%252FE&md5=ef0c207f41faa5278bfb985088abf5edCodeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assayWin, Maung Nyan; Klein, Joshua S.; Smolke, Christina D.Nucleic Acids Research (2006), 34 (19), 5670-5682CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)RNA aptamers that bind the opium alkaloid codeine were generated using an iterative in vitro selection process. The binding properties of these aptamers, including equil. and kinetic rate consts., were detd. through a rapid, high-throughput approach using surface plasmon resonance (SPR) anal. to measure real-time binding. The approach involves direct coupling of the target small mol. onto a sensor chip without utilization of a carrier protein. Two highest binding aptamer sequences, FC5 and FC45 with Kd values of 2.50 and 4.00 μM, resp., were extensively studied. Corresponding mini-aptamers for FC5 and FC45 were subsequently identified through the described direct coupling Biacore assays. These assays were also employed to confirm the proposed secondary structures of the mini-aptamers. Both aptamers exhibit high specificity to codeine over morphine, which differs from codeine by a Me group. Finally, the direct coupling method was demonstrated to eliminate potential non-specific interactions that may be assocd. with indirect coupling methods in which protein linkers are commonly employed. Therefore, in addn. to presenting the first RNA aptamers to a subclass of benzylisoquinoline alkaloid mols., this work highlights a method for characterizing small mol. aptamers that is more robust, precise, rapid and high-throughput than other commonly employed techniques.
- 20Lee, S. J.; Youn, B. S.; Park, J. W.; Niazi, J. H.; Kim, Y. S.; Gu, M. B. ssDNA aptamer-based surface plasmon resonance biosensor for the detection of retinol binding protein 4 for the early diagnosis of type 2 diabates. Anal. Chem. 2008, 80, 2867– 2873, DOI: 10.1021/ac800050a[ACS Full Text], [CAS], Google Scholar20https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXivV2gt7s%253D&md5=a7b8e06a7a3e62ab6f0dee2816b04321ssDNA Aptamer-Based Surface Plasmon Resonance Biosensor for the Detection of Retinol Binding Protein 4 for the Early Diagnosis of Type 2 DiabetesLee, Su Jin; Youn, Byung-Soo; Park, Ji Woo; Niazi, Javed H.; Kim, Yeon Seok; Gu, Man BockAnalytical Chemistry (Washington, DC, United States) (2008), 80 (8), 2867-2873CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)Retinol binding protein 4 (RBP4) is a useful biomarker in the diagnosis of type 2 diabetes since its level in the serum is higher in insulin-resistant states. Accurate measurement of the serum RBP4 levels is hampered by conventional immunol. methods, such as ELISA. In this study, therefore, the authors have developed an aptamer-based surface plasmon resonance (SPR) biosensor that can be used to sense for RBP4 in serum samples. A single-stranded DNA (ssDNA) aptamer that showed high affinity (Kd = 0.2±0.03 μM) and specificity to RBP4 was selected. This RBP4-specific aptamer was immobilized on a gold chip and used in a label-free RBP4 detection using SPR. Anal. of RBP4 in artificial serum using SPR was compared with ELISA and Western blot anal. The authors' results indicated that the RBP4-specific aptamer-based SPR biosensor gave better dose-dependent responses and was more sensitive than ELISA assays. As such, this RBP4 aptamer-based SPR biosensor can be potentially used to monitor the RBP4 levels within the serum as an indicator of type 2 diabetes.
- 21Gong, M.; Nikcevic, I.; Wehmeyer, K. R.; Limbach, P. A.; Heineman, W. R. Protein-aptamer binding studies using microchip affinity capillary electrophoresis. Electrophoresis 2008, 29, 1415– 1422, DOI: 10.1002/elps.200700777[Crossref], [PubMed], [CAS], Google Scholar21https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXlt1WktLs%253D&md5=b1180e4ca92bf43fb91bc4107b9fb3b7Protein-aptamer binding studies using microchip affinity capillary electrophoresisGong, Maojun; Nikcevic, Irena; Wehmeyer, Kenneth R.; Limbach, Patrick A.; Heineman, William R.Electrophoresis (2008), 29 (7), 1415-1422CODEN: ELCTDN; ISSN:0173-0835. (Wiley-VCH Verlag GmbH & Co. KGaA)The use of traditional CE [capillary electrophoresis] to detect weak binding complexes is problematic due to the fast-off rate resulting in the dissocn. of the complex during the sepn. process. Addnl., proteins involved in binding interactions often nonspecifically stick to the bare-silica capillary walls, which further complicates the binding anal. Microchip CE allows flexibly positioning the detector along the sepn. channel and conveniently adjusting the sepn. length. A short sepn. length plus a high elec. field enables rapid sepns. thus reducing both the dissocn. of the complex and the amt. of protein loss due to nonspecific adsorption during the sepn. process. Thrombin and a selective thrombin-binding aptamer were used to demonstrate the capability of microchip CE for the study of relatively weak binding systems that have inherent limitations when using the migration shift method or other CE methods. The rapid sepn. of the thrombin-aptamer complex from the free aptamer was achieved in less than 10 s on a single-cross glass microchip with a relatively short detection length (1.0 cm) and a high elec. field (670 V/cm). The dissocn. const. was detd. to be 43 nM, consistent with reported results. In addn., aptamer probes were used for the quantitation of std. thrombin samples by constructing a calibration curve, which showed good linearity over two orders of magnitude with an LOD for thrombin of 5 nM at a three-fold S/N.
- 22Miyagawa, A.; Harada, M.; Okada, T. Zeptomole biosensing of DNA with flexible selectivity based on acoustic levitation of a single microsphere binding gold nanoparticles by hybridization. ACS Sensors 2018, 3, 1870– 1875, DOI: 10.1021/acssensors.8b00748[ACS Full Text], [CAS], Google Scholar22https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsF2gs73L&md5=7e244ba99019fdbdcf911a24bc9b213cZeptomole Biosensing of DNA with Flexible Selectivity Based on Acoustic Levitation of a Single Microsphere Binding Gold Nanoparticles by HybridizationMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoACS Sensors (2018), 3 (9), 1870-1875CODEN: ASCEFJ; ISSN:2379-3694. (American Chemical Society)A novel scheme for DNA sensing at the zeptomole level is presented, based on the levitation of a single microsphere in a combined acoustic-gravitational (CAG) field. The levitation of a microsphere in the field is predominantly detd. by its d. Capture and reporter probe DNAs are anchored on poly(Me methacrylate) microsphere (PMMA) and gold nanoparticles (AuNPs), resp., and a target DNA induces the binding of AuNPs on PMMA. This interparticle sandwich DNA-hybridization induces d. increase in PMMA, which is detected as a shift in the levitation coordinate in the CAG field. The reporter DNAs are designed based on base-pair (bp) no. selectivity, which is evaluated using direct interparticle hybridization between DNA-bound PMMA and complementary DNA-anchored AuNPs. Interestingly, the bp-no. selectivity can be enlarged by lowering the reactant concns. Thus, the threshold bp, at which no d. change is detected, can be adjusted by controlling the reactant concns. This strategy is extended to the sensing of HIV-2 DNA and single nucleotide polymorphism (SNP) detection of the KRAS gene by sandwich hybridization. In SNP detection, the present method selectively distinguishes wild-type DNA from mutant DNA differing by one nucleotide in the 21-nucleotide sequence by optimizing the lengths of probe DNAs and particle concns. This approach allows the detection of 1000 DNA mols.
- 23Miyagawa, A.; Harada, M.; Okada, T. Multiple microRNA quantification based on acoustic levitation of single microspheres after one-pot sandwich interparticle hybridization. Anal. Chem. 2018, 90, 13729– 13735, DOI: 10.1021/acs.analchem.8b04143[ACS Full Text], [CAS], Google Scholar23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVKitbbI&md5=95a3beee6f19634750fb757041b2ea78Multiple MicroRNA Quantification Based on Acoustic Levitation of Single Microspheres after One-Pot Sandwich Interparticle HybridizationsMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2018), 90 (22), 13729-13735CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The authors propose a scheme for the sensitive quantification of multiple microRNAs (miRNAs) on the basis of the levitation coordinate change (Δz) of single microparticles of different sizes in a coupled acoustic-gravitational (CAG) field. This field transduces the d. change of a microparticle into Δz, which can be measured with high precision. The d. of a microparticle is induced by the binding of gold nanoparticles (AuNPs) on it through the sandwich DNA hybridization with miRNA. Different probe DNAs are anchored onto microparticles of different sizes, which are clearly distinguishable on a microscopic view. The target miRNAs are captured by these particles having complementary nucleotide sequences and then entrap reporter-anchored AuNPs. Thus, the densities of the microparticles are modified according to the concn. of individual target miRNAs. The interparticle hybridizations for multiple target miRNAs are conducted in one-pot reactions before the levitation of the microparticles is measured in the CAG field. This principle is successfully applied to the quantification of miR-21 and miR-122 in the total RNA extd. from liver cancer tissues.
- 24Miyagawa, A.; Harada, M.; Okada, T. Zeptomole detection scheme based on levitation coordinate measurements of a single microparticle in a coupled acoustic-gravitational field. Anal. Chem. 2018, 90, 2310– 2316, DOI: 10.1021/acs.analchem.7b04752[ACS Full Text], [CAS], Google Scholar24https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXnvVertg%253D%253D&md5=6bcbd263993c548d132ce5b1c412b772Zeptomole Detection Scheme Based on Levitation Coordinate Measurements of a Single Microparticle in a Coupled Acoustic-Gravitational FieldMiyagawa, Akihisa; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2018), 90 (3), 2310-2316CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The authors present a novel anal. principle in which an analyte (according to its concn.) induces a change in the d. of a microparticle, which was measured as a vertical coordinate in a coupled acoustic-gravitational (CAG) field. The d. change is caused by the binding of gold nanoparticles (AuNP's) on a polystyrene (PS) microparticle through avidin-biotin assocn. The d. of a 10-μm PS particle increases by 2% when 500,100-nm AuNP's are bound to the PS. The CAG can detect this d. change as a 5-10 μm shift of the levitation coordinate of the PS. This approach, which allows the authors to detect 700 AuNP's bound to a PS particle, was used to detect biotin in soln. Biotin is detectable at a picomolar level. The reaction kinetics plays a significant role in the entire process. The kinetic aspects are also quant. discussed based on the levitation behavior of the PS particles in the CAG field.
- 25Miyagawa, A.; Inoue, Y.; Harada, M.; Okada, T. Acoustic sensing based on density shift of microspheres by surface binding of gold nanoparticles. Anal. Sci. 2017, 33, 939– 944, DOI: 10.2116/analsci.33.939[Crossref], [PubMed], [CAS], Google Scholar25https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXptVOhtQ%253D%253D&md5=da827d3d9d7462171c0d1294a2ce7c88Acoustic sensing based on density shift of microspheres by surface binding of gold nanoparticlesMiyagawa, Akihisa; Inoue, Yoshinori; Harada, Makoto; Okada, TetsuoAnalytical Sciences (2017), 33 (9), 939CODEN: ANSCEN; ISSN:0910-6340. (Japan Society for Analytical Chemistry)There is no expanded citation for this reference.
- 26Kanazaki, T.; Hirawa, S.; Harada, M.; Okada, T. Coupled acoustic-gravity field for dynamic evaluation of ion exchange with a single resin bead. Anal. Chem. 2010, 82, 4472– 4478, DOI: 10.1021/ac100275p[ACS Full Text], [CAS], Google Scholar26https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXlvF2js7g%253D&md5=44e820383a49454bde1a01cc4c072827Coupled Acoustic-Gravity Field for Dynamic Evaluation of Ion Exchange with a Single Resin BeadKanazaki, Takahiro; Hirawa, Shungo; Harada, Makoto; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2010), 82 (11), 4472-4478CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A coupled acoustic-gravity field is efficient for entrapping a particle at the position detd. by its acoustic properties rather than its size. This field was applied to the dynamic observation of ion-exchange reactions occurring in a single resin bead. The replacement of counterions in an ion-exchange resin induces changes in its acoustic properties, such as d. and compressibility. Therefore, the authors can visually trace the advancement of an ion-exchange reaction as a time change in the levitation position of a resin bead entrapped in the field. Cation-exchange reactions occurring in resin beads with diams. of 40-120 μm are typically completed within 100-200 s. Ion-exchange equil. or kinetics is often evaluated with off-line chem. analyses, which require a batch amt. of ion exchangers. Measurements with a single resin particle allow one to evaluate ion-exchange dynamics and kinetics of ions including those that are difficult to measure by usual off-line analyses. The diffusion properties of ions in resins were successfully evaluated from the time change in the levitation positions of resin beads.
- 27Kanazaki, T.; Okada, T. Two-dimensional particle separation in coupled acoustic-gravity-flow field vertically by composition and laterally by size. Anal. Chem. 2012, 84, 10750– 10755, DOI: 10.1021/ac302637e[ACS Full Text], [CAS], Google Scholar27https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsleqtLjI&md5=b5ab14ccc0daca545d3c2003ad83fcebTwo-Dimensional Particle Separation in Coupled Acoustic-Gravity-Flow Field Vertically by Composition and Laterally by SizeKanazaki, Takahiro; Okada, TetsuoAnalytical Chemistry (Washington, DC, United States) (2012), 84 (24), 10750-10755CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A flow-based sepn. of particles usually relies on differences in their mobility in the flow direction, which are mostly produced by a phys. force. Various properties of particles, typically the size and compn., simultaneously affect their mobility and, therefore, often complicate the result of sepn. If these properties are distinguished on different sepn. axes, well-defined sepn. should be realized. Two-dimensional sepn. of particles was devised by a simple exptl. setup based on the acoustic radiation forces and the Stokes drag. A vertical acoustic-gravity field provides the d. resoln. better than 1%, and horizontal acoustic-flow field can also resolve particle sizes with the resoln. of < 1%. Two-dimensional sepn. based on the compns. and sizes of particles is demonstrated.
- 28Masudo, T.; Okada, T. Particle characterization and separation by a coupled acoustic-gravity field. Anal. Chem. 2001, 73, 3467– 3471, DOI: 10.1021/ac001354b[ACS Full Text], [CAS], Google Scholar28https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXktVyksr0%253D&md5=55f3952a530f1a0333bd29c7e8bd5db7Particle Characterization and Separation by a Coupled Acoustic-Gravity FieldMasudo, Takashi; Okada, TetsuoAnalytical Chemistry (2001), 73 (14), 3467-3471CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)A coupled acoustic-gravity field is proposed as a novel external field for particle sepn. and characterization. When a standing plane ultrasound wave is generated, particles move to the node of the wave along the ultrasound force gradient. If the particles also undergo a sedimentation force, they aggregate at the equil. position, where these two forces are balanced. The equil. position, which is detd. by the d. and compressibility of a medium and particles, characterizes the particles. The local ultrasound energy, which is necessary for quant. discussions, is evaluated by using a std. particle, the phys. parameters of which are unambiguously detd.; aluminum particles are used in the present study. The local ultrasound energy makes possible the detn. of the compressibility of unknown materials. Nonporous particles of inorg. and polymeric materials, the particle sizes of which range from 3 to 100 μm, follow a derived model, suggesting that the local ultrasound energy and a derived model be valid. The proposed external field can be used for sepn. of particles having different acoustic natures.
- 29Ge, S.; Nemiroski, A.; Mirica, K. A.; Mace, C. R.; Hennek, J. W.; Kumar, A. A.; Whitesides, G. M. Magnetic levitation in chemistry, materials science, and biochemistry. Angew. Chem., Int. Ed. 2019, DOI: 10.1002/anie.201903391
- 30Ma, C.; Lin, C.; Wang, Y.; Chen, X. DNA-based ATP sensing. TrAC, Trends Anal. Chem. 2016, 77, 226– 241, DOI: 10.1016/j.trac.2016.01.013[Crossref], [CAS], Google Scholar30https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhsl2qs70%253D&md5=b28a26db10d3573a689500971c5993d6DNA-based ATP sensingMa, Chunhua; Lin, Chunshui; Wang, Yiru; Chen, XiTrAC, Trends in Analytical Chemistry (2016), 77 (), 226-241CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)The detection of ATP is of great value due to its role in the regulation and integration of cellular metab. DNA has been developed as a promising recognition element in ATP sensing, among which ATP-binding aptamer (ABA) exhibits many advantages in terms of the simplicity of synthesis, ease of labeling and excellent stability. Moreover, progress in the development of nanomaterials and enzyme amplification provides ABA even more flexibility as an ATP recognition tool in the fields of fluorescence, electrochem. and colorimetric. In addn. to ABA, ATP dependent enzyme reaction (ATP-DER, T4 DNA ligase) using DNA as a substrate has been developed for ATP sensing with high sensitivity and selectivity. In this review, we summarize the recent advances in DNA-based ATP sensors and their applications in living cells, and also discuss their future development.
- 31Rajendran, M.; Dane, E.; Conley, J.; Tantama, M. Imaging adenosine triphosphate (ATP). Biol. Bull. 2016, 231, 73– 84, DOI: 10.1086/689592[Crossref], [PubMed], [CAS], Google Scholar31https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXltVSmsr0%253D&md5=ec572184105cf32f7ca3f46a8df77eafImaging adenosine triphosphateRajendran, Megha; Dane, Eric; Conley, Jason; Tantama, MathewBiological Bulletin (Woods Hole, MA, United States) (2016), 231 (1), 73-84CODEN: BIBUBX; ISSN:0006-3185. (Marine Biological Laboratory)ATP (ATP) is a universal mediator of metab. and signaling across unicellular and multicellular species. There is a fundamental interdependence between the dynamics of ATP and the physiol. that occurs inside and outside the cell. Characterizing and understanding ATP dynamics provide valuable mechanistic insight into processes that range from neurotransmission to the chemotaxis of immune cells. Therefore, we require the methodol. to interrogate both temporal and spatial components of ATP dynamics from the subcellular to the organismal levels in live specimens. Over the last several decades, a no. of mol. probes that are specific to ATP have been developed. These probes have been combined with imaging approaches, particularly optical microscopy, to enable qual. and quant. detection of this crit. mol. In this review, we survey current examples of technologies available for visualizing ATP in living cells, and identify areas where new tools and approaches are needed to expand our capabilities.
- 32Dong, J.; Zhao, M. In-vivo fluorescence imaging of adenosine 5′-triphosphate. TrAC, Trends Anal. Chem. 2016, 80, 190– 203, DOI: 10.1016/j.trac.2016.03.020[Crossref], [CAS], Google Scholar32https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XkvVertLs%253D&md5=1f177b37c0bcdbba1592d18b9d428a17In-vivo fluorescence imaging of adenosine 5'-triphosphateDong, Jiantong; Zhao, MeipingTrAC, Trends in Analytical Chemistry (2016), 80 (), 190-203CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)As a crit. and multifunctional nucleotide, ATP (ATP) is involved in many cellular metab. and signal transduction processes. Monitoring the level and dynamics of ATP in living organisms contributes to better understanding of basic cellular functions. Fluorescent indicators are distinctly superior in detecting ATP in vivo due to their advantages of high sensitivity, good selectivity, fast response and flexible manipulation. The current indicators including small org. fluorescent chemosensors, genetically encoded fluorescent reporters, artificially designed aptamers conjugated with nanomaterials, and fluorescent nanosensors based on ATP-dependent luciferase have successfully achieved imaging of ATP in living cells or organisms, providing valuable insights into exploring related physiol. actions. This article reviews the recent advances in the fluorescence anal. of ATP in vivo, describes their sensing mechanisms and characteristics, points out their applications in biol. research, and offers prospects of the developments in the future.
- 33Ng, S.; Lim, H. S.; Ma, Q.; Gao, Z. Optical aptasensors for adenosine triphosphate. Theranostics 2016, 6, 1683– 1702, DOI: 10.7150/thno.15850[Crossref], [PubMed], [CAS], Google Scholar33https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFersrzI&md5=5e94cc8ac9afbbbb1dc81aeab0d53a88Optical aptasensors for adenosine triphosphateNg, Stella; Lim, Hui Si; Ma, Qian; Gao, ZhiqiangTheranostics (2016), 6 (10), 1683-1702CODEN: THERDS; ISSN:1838-7640. (Ivyspring International Publisher)Nucleic acids are among the most researched and applied biomols. Their diverse two- and three-dimensional structures in conjunction with their robust chem. and ease of manipulation provide a rare opportunity for sensor applications. Moreover, their high biocompatibility has seen them being used in the construction of in vivo assays. Various nucleic acid-based devices have been extensively studied as either the principal element in discrete mol.-like sensors or as the main component in the fabrication of sensing devices. The use of aptamers in sensors - aptasensors, in particular, has led to improvements in sensitivity, selectivity, and multiplexing capacity for a wide verity of analytes like proteins, nucleic acids, as well as small biomols. such as glucose and ATP (ATP). This article reviews the progress in the use of aptamers as the principal component in sensors for optical detection of ATP with an emphasis on sensing mechanism, performance, and applications with some discussion on challenges and perspectives.
- 34Sajid, M.; Nazal, M. K.; Mansha, M.; Alsharaa, A.; Jillani, S. M. S.; Basheer, C. Chemically modified electrodes for electrochemical detection of dopamine in the presence of uric acid and ascorbic acid: A review. TrAC, Trends Anal. Chem. 2016, 76, 15– 29, DOI: 10.1016/j.trac.2015.09.006[Crossref], [CAS], Google Scholar34https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFanu7%252FK&md5=d2db41933dbc8c56e7a510ce78ed2a01Chemically modified electrodes for electrochemical detection of dopamine in the presence of uric acid and ascorbic acid: A reviewSajid, Muhammad; Nazal, Mazen Khaled; Mansha, Muhammad; Alsharaa, Abdulnaser; Jillani, Shehzada Muhammad Sajid; Basheer, ChanbashaTrAC, Trends in Analytical Chemistry (2016), 76 (), 15-29CODEN: TTAEDJ; ISSN:0165-9936. (Elsevier B. V.)Dopamine (DA) is an important neurotransmitter and its abnormal concns. are assocd. with different diseases. Electrochem. detection of DA in real samples is challenging because of the presence of high concns. of electroactive interferents such as uric acid (UA) and ascorbic acid (AA). Chem. modified electrodes have been widely used to counter the problems of poor sensitivity and selectivity faced at bare electrodes. We have briefly reviewed the materials that have been extensively used to fabricate modified electrode surfaces for detection of DA. The characteristics of the materials that improve the electrocatalytic activity of the modified surfaces are discussed. The boundary of search was limited to the electrochem. methods dealing with the simultaneous detection of DA, UA, and AA levels or detection of only DA in the presence of UA and AA. Challenges assocd. with the quant. detn. of dopamine in real samples are critically reviewed and the possible solns. are described.
- 35Pandikumar, A.; How, G. T. S.; See, T. P.; Omar, F. S.; Jayabal, S.; Kamali, K. Z.; Yusoff, N.; Jamil, A.; Ramaraj, R.; John, S. A.; Lim, H. N.; Huang, N. M. Graphene and its nanocomposite material based electrochemical sensor platform for dopamine. RSC Adv. 2014, 4, 63296– 63323, DOI: 10.1039/C4RA13777A[Crossref], [CAS], Google Scholar35https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhvV2gtb%252FE&md5=a091dd571052f26a6534e810cf542f51Graphene and its nanocomposite material based electrochemical sensor platform for dopaminePandikumar, Alagarsamy; Soon How, Gregory Thien; See, Teo Peik; Omar, Fatin Saiha; Jayabal, Subramaniam; Kamali, Khosro Zangeneh; Yusoff, Norazriena; Jamil, Asilah; Ramaraj, Ramasamy; John, Swamidoss Abraham; Lim, Hong Ngee; Huang, Nay MingRSC Advances (2014), 4 (108), 63296-63323CODEN: RSCACL; ISSN:2046-2069. (Royal Society of Chemistry)A review. Dopamine (DA) is an important catecholamine neurotransmitter in the mammalian central nervous system that influences several physiol. functions. The impact of DA levels within the human body significantly affects the body functions. Maintaining DA level is essential and the electrochem. detection methods are often used to detect the DA level to regulate the body function. In this review, graphene (functionalized graphene and N-doped graphene) and its composites (metal, metal oxide, polymer, carbonaceous materials, clay, zeolite, and metal-org. framework based graphene composites) modified electrodes with their improved sensing performance towards DA along with several interfering species are described. Further, recent developments on the fabrication of various graphene based composite modified electrodes are also presented. Some important strategies to improve the selectivity and sensitivity towards DA with graphene based composite modified electrodes are also described.
- 36Rasheed, P. A.; Lee, J. S. recent advances in optical detection of dopamine using nanomaterials. Microchim. Acta 2017, 184, 1239– 1266, DOI: 10.1007/s00604-017-2183-6
- 37Mehlhorn, A.; Rahimi, P.; Joseph, Y. Aptamer-based biosensors for antibiotic detection: A review. Biosensors 2018, 8, 54, DOI: 10.3390/bios8020054[Crossref], [CAS], Google Scholar37https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvVahtrjF&md5=c64dbe18b3a5a5d262581b9252d0c258Aptamer-based biosensors for antibiotic detection: a reviewMehlhorn, Asol; Rahimi, Parvaneh; Joseph, YvonneBiosensors (2018), 8 (2), 54CODEN: BIOSHU; ISSN:2079-6374. (MDPI AG)Antibiotic resistance and, accordingly, their pollution because of uncontrolled usage has emerged as a serious problem in recent years. Hence, there is an increased demand to develop robust, easy, and sensitive methods for rapid evaluation of antibiotics and their residues. Among different anal. methods, the aptamer-based biosensors (aptasensors) have attracted considerable attention because of good selectivity, specificity, and sensitivity. This review gives an overview about recently-developed aptasensors for antibiotic detection. The use of various aptamer assays to det. different groups of antibiotics, like β-lactams, aminoglycosides, anthracyclines, chloramphenicol, (fluoro)quinolones, lincosamide, tetracyclines, and sulfonamides are presented in this paper.
- 38Shrivas, K.; Sahu, J.; Maji, P.; Sinha, D. Label-free selective detection of ampicillin drug in human urine samples using silver nanoparticles as a colorimetric sensing probe. New J. Chem. 2017, 41, 6685– 6692, DOI: 10.1039/C7NJ00448F[Crossref], [CAS], Google Scholar38https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhtVamsLnJ&md5=2e0f4159b1627f66ac8be8c322225393Label-free selective detection of ampicillin drug in human urine samples using silver nanoparticles as a colorimetric sensing probeShrivas, Kamlesh; Sahu, Jharna; Maji, Pathik; Sinha, DeepakNew Journal of Chemistry (2017), 41 (14), 6685-6692CODEN: NJCHE5; ISSN:1144-0546. (Royal Society of Chemistry)Stable citrate-capped silver nanoparticles (AgNPs) were developed as a colorimetric sensing probe for selective detection of ampicillin in urine samples. The method is based on the color change from yellow-to-pink and a red shift of localized surface plasmon resonance (LSPR) absorption band of AgNPs in UV-Vis region after the addn. of ampicillin into the NPs soln. This is due to the aggregation of AgNPs induced via the replacement of citrate stabilizing mols. from the surface of NPs by hydrolyzed product of ampicillin (penicillamine) formed at pH 4.0 through Ag-sulfur binding and electrostatic force of interactions. The control expts. were also carried out in those drugs that were not hydrolyzed and had no sulfur entity. They did not exhibit any color change and red shift of LSPR in UV-Vis region. The linear range for detn. of ampicillin was found in the range of 25-1200 ng mL-1 with their limit of detection being 10 ng mL-1. In comparison to conventional spectrophotometric and sophisticated anal. instruments, the proposed method was found to be simple, sensitive and cost effective for the detn. of ampicillin in urine samples.
- 39Huizenga, D. E.; Szostak, J. W. A DNA aptamer that binds adenosine and ATP. Biochemistry 1995, 34, 656– 665, DOI: 10.1021/bi00002a033[ACS Full Text], [CAS], Google Scholar39https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK2MXivFOqs7o%253D&md5=74cb35b81ca489f99b253c2c29ff6c99A DNA Aptamer That Binds Adenosine and ATPHuizenga, David E.; Szostak, Jack W.Biochemistry (1995), 34 (2), 656-65CODEN: BICHAW; ISSN:0006-2960. (American Chemical Society)We have used in vitro selection to isolate adenosine/ATP-binding DNA sequences from a pool of ≈2 × 1014 different random-sequence single-stranded DNA mols. One of these aptamers has been characterized and binds adenosine in soln. with a dissocn. const. of 6 ± 3 μM. Expts. with ATP analogs indicate that functional groups on both the base and the sugar of ATP are involved in the ligand/aptamer interaction. The binding domain of this aptamer was localized to a 42 base sequence by deletion anal. A pool of mutagenized versions of this sequence was then synthesized and screened for functional adenosine binding sequences; comparison of the selected variants revealed two highly conserved guanosine-rich regions, two invariant adenosine residues, and two regions of predominantly Watson-Crick covariation. This data led us to propose a model of the ATP-binding DNA structure which is based on a stable framework composed of two stacked G-quartets. The two highly conserved adenosine residues may stack between the top G-quartet and the two short stems, forming a pocket in which the adenosine or ATP ligand binds. Site-directed mutagenesis, base analog substitution studies, and the design of highly divergent but functional sequences provide support for this model.
- 40Song, K. M.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal. Bioanal. Chem. 2012, 402, 2153– 2161, DOI: 10.1007/s00216-011-5662-3[Crossref], [PubMed], [CAS], Google Scholar40https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XjtFKisw%253D%253D&md5=b3483118b3925886f8dec0d8594ef017Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methodsSong, Kyung-Mi; Jeong, Euiyoung; Jeon, Weejeong; Cho, Minseon; Ban, ChangillAnalytical and Bioanalytical Chemistry (2012), 402 (6), 2153-2161CODEN: ABCNBP; ISSN:1618-2642. (Springer)A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (Kd, AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, resp.). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distd. water. Because these detection limits were below the max. residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addn., this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry. The dual fluorescence-colorimetric method for the detection of ampicillin using the AMP17 ssDNA aptamer. The FAM-AMP17 aptamer is quenched by adsorption onto the surface of the AuNPs. If ampicillin and salt (NaCl) are added to the soln., fluorescence is recovered and the AuNPs aggregate. Conversely, the AuNP soln. treated with only salt shows no obvious changes.
- 41Walsh, R.; DeRosa, M. C. retention of function in the DNA homolog of the RNA dopamine aptamer. Biochem. Biophys. Res. Commun. 2009, 388, 732– 735, DOI: 10.1016/j.bbrc.2009.08.084[Crossref], [PubMed], [CAS], Google Scholar41https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhtFajsbzO&md5=c8b2229a6203d1ebb3b99d32e63b2c6eRetention of function in the DNA homolog of the RNA dopamine aptamerWalsh, Ryan; De Rosa, Maria C.Biochemical and Biophysical Research Communications (2009), 388 (4), 732-735CODEN: BBRCA9; ISSN:0006-291X. (Elsevier B.V.)While it is generally accepted that the functional tertiary structures formed by RNA cannot be replicated by a deoxy version of the same sequence, here we demonstrate conservation of function for a DNA homolog of an RNA aptamer. Using fluorescence anisotropy expts., this work demonstrates that the all-DNA version of the RNA dopamine aptamer is able to bind dopamine with improved affinity and similar specificity relative to the RNA aptamer. Mutation studies suggest that the binding site is maintained in both structure types. These findings will help to elucidate what sequences and secondary structures allow for retention of function in both RNA and DNA.
- 42Baldrich, E.; Restrepo, A.; OˈSullivan, C. K. aptasensor development: Elucidation of critical parameters for optical aptamer performance. Anal. Chem. 2004, 76, 7053– 7063, DOI: 10.1021/ac049258o[ACS Full Text], [CAS], Google Scholar42https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2cXptVamsLs%253D&md5=f5837fd8f91b6bb333fb17fd6b133198Aptasensor Development: Elucidation of Critical Parameters for Optimal Aptamer PerformanceBaldrich, Eva; Restrepo, Alexandre; O'Sullivan, Ciara K.Analytical Chemistry (2004), 76 (23), 7053-7063CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)Aptamers are synthetic oligonucleotides specifically selected to bind a certain target. Thanks to their high affinity and sensitivity, aptamers appear as alternative candidates to antibodies for anal. devices and several assays have been reported. However, and contrary to what happens with DNA probes, the aptamers' ability to bind their targets depends on folding and 3-D structure, which may be affected by the incubation conditions and buffer compn. In this report, a systematic evaluation of the parameters with potential effect on the ELAA (Enzyme Linked Aptamer Assay) performance has been carried out. Addnl., diverse ELAA and mixed ELISA/ELAA formats exploiting the thrombin-binding aptamer have been optimized and their efficiencies compared. ELAA results have been confirmed using NMR, electrophoresis, and surface plasmon resonance. Our results indicate that parameters such as immobilization strategy, incubation time/temp., and buffer compn. should be optimized for each aptamer as they affect folding and, thus, binding efficiency. Among the studied assays, the mixed ELISA/ELAA sandwich formats showed the lowest limit of detection obsd. (<1 nM thrombin), while a competition ELAA appeared as the best assay in terms of high sensitivity (1.8 nM) and short assay time (1 h, 30 min). The elucidation of optimal parameters for assay performance reported here clearly indicates that aptamers are unique structures. Formation of the 3-D structures required for target binding is influenced by variable parameters, and unlike DNA/antibody based assays, there are no general recommendations, with each assay requiring individual optimization of parameters.
- 43Haq, I.; Lincoln, P.; Suh, D.; Norden, B.; Chowdhry, B. Z.; Chaires, J. B. Interaction of Δ- and Λ-[Ru(phen)2DPPZ]2+ with DNA: A colorimetric and Equilibrium binding study. J. B. J. Am. Chem. Soc. 1995, 117, 4788– 4796, DOI: 10.1021/ja00122a008[ACS Full Text], [CAS], Google Scholar43https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADyaK2MXlt1SrtLo%253D&md5=c293fdc027fa3a946a95198efe7e1c13Interaction of Δ- and Λ-[Ru(phen)2DPPZ]2+ with DNA: A Calorimetric and Equilibrium Binding StudyHaq, Ihtshamul; Lincoln, Per; Suh, Dongchul; Norden, Bengt; Chowdhry, Babur Z.; Chaires, Jonathan B.Journal of the American Chemical Society (1995), 117 (17), 4788-96CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)Fluorescence and absorption spectroscopy, isothermal titrn. calorimetry, and viscosity measurements have been used to characterize the interaction of Δ and Λ [Ru(phen)2DPPZ]2+ with calf thymus DNA. The method of continuous variations revealed two distinct binding stoichiometries for both Δ- and Λ-DPPZ, corresponding to 0.7 and 3 mol of base pair/mol of ligand. Binding isotherms were obtained for the two enantiomers, both of which show strong binding to DNA, with K = 3.2 × 106 M-1 bp and 1.7 × 106 M-1 bp for the Δ and Λ isomers, resp., at 25 °C in solns. contg. 50 mM NaCl. Titrn. calorimetry gave ΔH values of +0.3 kcal mol-1 for Δ-DPPZ and +2.9 kcal mol-1 for Λ-DPPZ for their interaction with DNA. These small pos. enthalpies, which were confirmed using thermal difference spectroscopy, indicated that the binding of these compds. to DNA is entropically driven. An enthalpy of +2.5 kcal mol-1 was obtained for the binding of the parent compd., tris(phenanthroline)Ru(II), to DNA. Titrn. of all three compds. into buffer gave a nonnegligible heat of diln. The salt dependence of the binding const. was examd. for both isomers. The slope SK = (δlogK/δlog[Na+]) was found to be 1.9 and 2.1 for the Δ and Λ isomers, resp. By using polyelectrolyte theory to interpret the obsd. salt dependence of the equil. const., it can be shown that there is a significant nonelectrostatic contribution to the binding const. Relative viscosity expts. showed that both Δ- and Λ-DPPZ increase the length of rod-like DNA, in a manner consistent with binding by classical intercalation. Fluorescence energy transfer expts. provided addnl. evidence for the intercalation of Δ- and Λ-[Ru(phen)2DPPZ]2+ into DNA.
- 44Munzar, J. D.; Ng, A.; Juncker, D. Duplexed aptamers: history, design, theory, and application to biosensing. Chem. Soc. Rev. 2019, 48, 1390– 1419, DOI: 10.1039/C8CS00880A[Crossref], [PubMed], [CAS], Google Scholar44https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXktVKktbs%253D&md5=e7d21ead990f43e31fe5bab82dd60628Duplexed aptamers: history, design, theory, and application to biosensingMunzar, Jeffrey D.; Ng, Andy; Juncker, DavidChemical Society Reviews (2019), 48 (5), 1390-1419CODEN: CSRVBR; ISSN:0306-0012. (Royal Society of Chemistry)Nucleic acid aptamers are single stranded DNA or RNA sequences that specifically bind a cognate ligand. In addn. to their widespread use as stand-alone affinity binding reagents in anal. chem., aptamers have been engineered into a variety of ligand-specific biosensors, termed aptasensors. One of the most common aptasensor formats is the duplexed aptamer (DA). As defined herein, DAs are aptasensors contg. two nucleic acid elements coupled via Watson-Crick base pairing: (i) an aptamer sequence, which serves as a ligand-specific receptor, and (ii) an aptamer-complementary element (ACE), such as a short DNA oligonucleotide, which is designed to hybridize to the aptamer. The ACE competes with ligand binding, such that DAs generate a signal upon ligand-dependent ACE-aptamer dehybridization. DAs possess intrinsic advantages over other aptasensor designs. For example, DA biosensing designs generalize across DNA and RNA aptamers, DAs are compatible with many readout methods, and DAs are inherently tunable on the basis of nucleic acid hybridization. However, despite their utility and popularity, DAs have not been well defined in the literature, leading to confusion over the differences between DAs and other aptasensor formats. In this review, we introduce a framework for DAs based on ACEs, and use this framework to distinguish DAs from other aptasensor formats and to categorize cis- and trans-DA designs. We then explore the ligand binding dynamics and chem. properties that underpin DA systems, which fall under conformational selection and induced fit models, and which mirror classical SN1 and SN2 models of nucleophilic substitution reactions. We further review a variety of in vitro and in vivo applications of DAs in the chem. and biol. sciences, including riboswitches and riboregulators. Finally, we present future directions of DAs as ligand-responsive nucleic acids. Owing to their tractability, versatility and ease of engineering, DA biosensors bear a great potential for the development of new applications and technologies in fields ranging from anal. chem. and mechanistic modeling to medicine and synthetic biol.
- 45Wang, J.; Jiang, Y.; Zhou, C.; Fang, X. Aptamer-based ATP assay using a luminescent light switching complex. Anal. Chem. 2005, 77, 3542– 3546, DOI: 10.1021/ac050165w[ACS Full Text], [CAS], Google Scholar45https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXjsFaiu7s%253D&md5=168ab63fd0dd0836d2b2776739d4e874Aptamer-Based ATP Assay Using a Luminescent Light Switching ComplexWang, Jun; Jiang, Yaxin; Zhou, Cuisong; Fang, XiaohongAnalytical Chemistry (2005), 77 (11), 3542-3546CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)With the increasing applications of nucleic acid aptamers as a new class of mol. recognition probes in bioanal. and biosensor development, the development of general and simple signaling strategies to transduce aptamer-target binding events to detectable signals is demanding. We have developed a new signaling method based on aptamers and a DNA mol. light switching complex, [Ru(phen)2(dppz)]2+, for sensitive protein detection. In this work, we have demonstrated the applicability of this signaling mechanism to small-mol. detection using ATP as a model target. Our results have shown that upon ATP binding to the folded aptamer where [Ru(phen)2(dppz)]2+ intercalated, the conformational change or distortion of the aptamer is large enough to cause a significant luminescence change of [Ru(phen)2(dppz)]2+. By monitoring the ATP-dependent luminescence intensity change, we have achieved ATP detection with high selectivity and high sensitivity down to 1 nM in homogeneous soln. The method is very simple without the needs for covalently labeling aptamers or using costly enzymes and multistep anal. as other reported fluorescence/luminescence assays for ATP. The successful detection of ATP indicates that using the signaling aptamers with [Ru(phen)2(dppz)]2+ is expected to be a general method for aptamer-based target detection.
- 46Jhaveri, S. D.; Kirby, R.; Conrad, R.; Maglott, E. J.; Bowser, M.; Kennedy, R. T.; Glick, G.; Ellington, A. D. Designed signaling aptamers that transduce molecular recognition to changes in fluorescence intensity. J. Am. Chem. Soc. 2000, 122, 2469– 2473, DOI: 10.1021/ja992393b[ACS Full Text], [CAS], Google Scholar46https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXhsValurc%253D&md5=125f40759f1a7d9306181764334bd80cDesigned Signaling Aptamers that Transduce Molecular Recognition to Changes in Fluorescence IntensityJhaveri, Sulay D.; Kirby, Romy; Conrad, Rick; Maglott, Emily J.; Bowser, Michael; Kennedy, Robert T.; Glick, Gary; Ellington, Andrew D.Journal of the American Chemical Society (2000), 122 (11), 2469-2473CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)We have engineered aptamers that contain fluorescent reporters and that signal the presence of cognate ligands in soln. Two different anti-adenosine "signaling aptamers", one made from RNA and one from DNA, can selectively signal the presence of adenosine in soln. Increases in fluorescence intensity reproducibly follow increases in adenosine concn., and can be used for quantitation. The facile methods we have developed can potentially be used for generating a wide variety of signaling aptamers for use in sensor arrays.
- 47Haiss, W.; Thanh, N. T. K.; Aveyard, J.; Fernig, D. G. Determination of size and concentration of gold nanoparticles from UV-vis spectra. Anal. Chem. 2007, 79, 4215– 4221, DOI: 10.1021/ac0702084[ACS Full Text], [CAS], Google Scholar47https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXksFCit7s%253D&md5=ecb11697688b35428cbb97d0e660c911Determination of Size and Concentration of Gold Nanoparticles from UV-Vis SpectraHaiss, Wolfgang; Thanh, Nguyen T. K.; Aveyard, Jenny; Fernig, David G.Analytical Chemistry (Washington, DC, United States) (2007), 79 (11), 4215-4221CODEN: ANCHAM; ISSN:0003-2700. (American Chemical Society)The dependence of the optical properties of spherical gold nanoparticles on particle size and wavelength were analyzed theor. using multipole scattering theory, where the complex refractive index of gold was cor. for the effect of a reduced mean free path of the conduction electrons in small particles. To compare these theor. results to exptl. data, gold nanoparticles in the size range of 5 to 100 nm were synthesized and characterized with TEM and UV-visible. Excellent agreement was found between theory and expt. The data produced here can be used to det. both size and concn. of gold nanoparticles directly from UV-visible spectra. Equations for this purpose are derived, and the precision of various methods is discussed. The major aim of this work is to provide a simple and fast method to det. size and concn. of nanoparticles.
Supporting Information
ARTICLE SECTIONSThe Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.9b03860.
Relationship between nAuNP/PMMA and Δz, LOD determination, relationship between log K1 and the number of AuNPs bound on a PMMA at rAuNP/PMMA = 10,000, relationships between the log c for ATP and the reaction ratio assuming 1:2 aptamer–ATP complexation, and experimental setup (PDF)
Terms & Conditions
Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.