ACS Publications. Most Trusted. Most Cited. Most Read
Illuminating Neuropeptide Y Y4 Receptor Binding: Fluorescent Cyclic Peptides with Subnanomolar Binding Affinity as Novel Molecular Tools
More

OR SEARCH CITATIONS

My Activity
Publications

Figure 1Loading Img
Download Hi-Res ImageDownload to MS-PowerPointCite This:ACS Pharmacol. Transl. Sci. 2024, 7, 4, 1142-1168
  • Open Access
Article

Illuminating Neuropeptide Y Y4 Receptor Binding: Fluorescent Cyclic Peptides with Subnanomolar Binding Affinity as Novel Molecular Tools
Click to copy article linkArticle link copied!

  • Jakob Gleixner
    Jakob Gleixner
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Jakob Gleixner
    Orcidhttps://orcid.org/0000-0002-8488-870X
  • Sergei Kopanchuk
    Sergei Kopanchuk
    Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    More by Sergei Kopanchuk
    Orcidhttps://orcid.org/0000-0003-1756-9327
  • Lukas Grätz
    Lukas Grätz
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Lukas Grätz
    Orcidhttps://orcid.org/0000-0001-6755-0742
  • Maris-Johanna Tahk
    Maris-Johanna Tahk
    Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    More by Maris-Johanna Tahk
    Orcidhttps://orcid.org/0000-0002-4566-9192
  • Tõnis Laasfeld
    Tõnis Laasfeld
    Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    More by Tõnis Laasfeld
  • Santa Veikšina
    Santa Veikšina
    Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    More by Santa Veikšina
  • Carina Höring
    Carina Höring
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Carina Höring
  • Albert O. Gattor
    Albert O. Gattor
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Albert O. Gattor
    Orcidhttps://orcid.org/0000-0001-5166-2168
  • Laura J. Humphrys
    Laura J. Humphrys
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Laura J. Humphrys
    Orcidhttps://orcid.org/0000-0003-4019-5538
  • Christoph Müller
    Christoph Müller
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Christoph Müller
    Orcidhttps://orcid.org/0000-0001-6121-6292
  • Nataliya Archipowa
    Nataliya Archipowa
    Institute of Biophysics and Physical Biochemistry, Faculty of Biology and Preclinical Medicine, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    More by Nataliya Archipowa
  • Johannes Köckenberger
    Johannes Köckenberger
    Department of Chemistry and Pharmacy, Molecular and Clinical Pharmacy, Friedrich-Alexander-University Erlangen-Nürnberg, Nikolaus-Fiebiger-Straße 10, D-91058 Erlangen, Germany
    More by Johannes Köckenberger
  • Markus R. Heinrich
    Markus R. Heinrich
    Department of Chemistry and Pharmacy, Molecular and Clinical Pharmacy, Friedrich-Alexander-University Erlangen-Nürnberg, Nikolaus-Fiebiger-Straße 10, D-91058 Erlangen, Germany
    More by Markus R. Heinrich
    Orcidhttps://orcid.org/0000-0001-7113-2025
  • Roger Jan Kutta
    Roger Jan Kutta
    Institute of Physical and Theoretical Chemistry, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93053 Regensburg, Germany
    More by Roger Jan Kutta
  • Ago Rinken*
    Ago Rinken
    Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    *Email: [email protected]. Tel: (+372) 7375-249.
    More by Ago Rinken
    Orcidhttps://orcid.org/0000-0002-7238-749X
  • Max Keller*
    Max Keller
    Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    *Email: [email protected]. Tel: (+49) 941-9433329.
    More by Max Keller
    Orcidhttps://orcid.org/0000-0002-8095-8627
Open PDFSupporting Information (2)

ACS Pharmacology & Translational Science

Cite this: ACS Pharmacol. Transl. Sci. 2024, 7, 4, 1142–1168
Click to copy citationCitation copied!
https://doi.org/10.1021/acsptsci.4c00013
Published March 20, 2024

Copyright © 2024 The Authors. Published by American Chemical Society. This publication is licensed under

CC-BY 4.0 .

Abstract

Click to copy section linkSection link copied!
High Resolution Image
Download MS PowerPoint Slide

The neuropeptide Y (NPY) Y4 receptor (Y4R), a member of the family of NPY receptors, is physiologically activated by the linear 36-amino acid peptide pancreatic polypeptide (PP). The Y4R is involved in the regulation of various biological processes, most importantly pancreatic secretion, gastrointestinal motility, and regulation of food intake. So far, Y4R binding affinities have been mostly studied in radiochemical binding assays. Except for a few fluorescently labeled PP derivatives, fluorescence-tagged Y4R ligands with high affinity have not been reported. Here, we introduce differently fluorescence-labeled (Sulfo-Cy5, Cy3B, Py-1, Py-5) Y4R ligands derived from recently reported cyclic hexapeptides showing picomolar Y4R binding affinity. With pKi values of 9.22–9.71 (radioligand competition binding assay), all fluorescent ligands (16–19) showed excellent Y4R affinity. Y4R saturation binding, binding kinetics, and competition binding with reference ligands were studied using different fluorescence-based methods: flow cytometry (Sulfo-Cy5, Cy3B, and Py-1 label), fluorescence anisotropy (Cy3B label), and NanoBRET (Cy3B label) binding assays. These experiments confirmed the high binding affinity to Y4R (equilibrium pKd: 9.02–9.9) and proved the applicability of the probes for fluorescence-based Y4R competition binding studies and imaging techniques such as single-receptor molecule tracking.

This publication is licensed under

CC-BY 4.0 .
  • cc licence
  • by licence
Copyright © 2024 The Authors. Published by American Chemical Society

Subjects

what are subjects

Keywords

what are keywords
In humans, four functional neuropeptide Y (NPY) receptors (Y1R, Y2R, Y4R, Y5R), all members of the superfamily of G-protein-coupled receptors, mediate the action of the neuropeptides NPY, peptide YY (PYY), and pancreatic polypeptide (PP). (1) Within the family of these linear 36-amino-acid peptides, PP exhibits a clear preference for the Y4R and is thus considered the primary activator of Y4R. (2) PP and Y4R are involved in the regulation of food intake, pancreatic secretion, gastrointestinal motility, and anxiety. (3−13) Therefore, the Y4R represents a potential target for the treatment of obesity and depression. (12−15)
Development processes aiming for new Y4R ligands require appropriate binding assays to determine Y4R affinities. So far, this has been primarily accomplished by radioligand competition binding studies using 3H- or 125I-labeled peptidic Y4R ligands. Although radiochemical binding assays represent powerful methods, in particular with respect to sensitivity and quantification of bound and free labeled ligand, several drawbacks are associated with the use of radioligands: special safety precautions, the need for specialized laboratories, permits for radioisotope handling, and the high cost of radiolabeled probes. These are some of the reasons for the continuously growing use of fluorescence-based techniques to study receptor–ligand binding. Moreover, most fluorescence-based binding assays allow, in contrast to radiochemical assays, investigations under homogeneous conditions, i.e., there is no need to separate free (unbound) ligand from receptor-bound ligand prior to measurement. (16−24) In particular, this is advantageous for kinetic studies. Another factor promoting luminescence-based assays is the availability of instruments such as multimode plate readers allowing high-throughput measurements. A bottleneck with respect to the development and use of fluorescence-based binding assays is the limited availability of fluorescent ligands exhibiting, all at once, high receptor affinity, favorable physicochemical and photophysical properties, appropriate binding kinetics (reversible binding), and adequate chemical stability as well as photostability.
For the Y4R, few fluorescently labeled ligands have been reported, Sulfo-Cy5-labeled [K4]hPP, (25) Sulfo-Cy5-labeled [K4,Nle17,30]hPP (1), (26) 5-TAMRA-labeled [K18,Nle17,30]hPP (2), (27) and the UR-KK236 (28)-derived Sulfo-Cy5.5-labeled hexapeptide 3 (29) (for structures of 1–3 see Figure 1A). With a Kd value of 5.6 nM, (25) only Sulfo-Cy5-[K4]hPP shows a dissociation constant <10 nM among these probes (Kd of 1 and 2: 11 and 26 nM, respectively; Ki of 3: 33 nM). Compared to the PP derivatives Sulfo-Cy5-[K4]hPP, 1 and 2, fluorescent ligand 3 exhibits a considerably lower molecular weight, which is considered favorable. However, with a Ki value of 33 nM, compound 3 exhibits only moderate Y4R binding affinity for application as a molecular tool.

Figure 1

Figure 1. (A) Structures and Y4R affinities of reported Y4R fluorescent ligands. 1 (26) and 2 (27) represent derivatives of the endogenous Y4R ligand hPP labeled with sulfo-Cy5 (S0223) and 5-TAMRA, respectively. Compound 3 (29) represents a derivative of the hexapeptide UR-KK236 (28) labeled with Sulfo-Cy5.5 (lumiprobe, ref no. 7330). (B) Structures of the reported cyclic Y4R ligands 4–7 showing high binding affinity to Y4R (pKi > 10). (30,31)

High Resolution Image
Download MS PowerPoint Slide
The present study aimed to design, synthesize, and characterize fluorescent Y4R ligands with low molecular weight and higher affinity to Y4R compared to reported probes. To achieve this, we exploited the recent discovery of the cyclic hexapeptides 4 and 5 showing two-digit picomolar Y4R affinities (Figure 1B). (30) Modification of peptide 4 resulted in the amine-functionalized peptide 6 (UR-JG93), its propionylated congener UR-JG102 (7) (Figure 1B) and the radiolabeled analogue [3H]UR-JG102, all showing very high Y4R affinity comparable to that of 4 and 5. (31)
The same approach was followed for the synthesis of fluorescent Y4R ligands, accessible by conjugation of fluorescent dyes to precursor peptide 6 (Figure 2, approach 1). Additionally, a second approach was explored by replacing Arg1 in peptide 4 by an alkyne-functionalized arginine enabling conjugation to a fluorescent dye by click chemistry (Figure 2, approach 2). The synthesized fluorescent ligands were studied with respect to Y4R binding (radiochemical competition binding assay) and Y4R agonistic activity (functional assays). Moreover, Y4R binding of selected fluorescent ligands was investigated using different luminescence-based methods (flow cytometry, fluorescence anisotropy (FA), NanoBRET assay, confocal microscopy, wide-field epifluorescence, and TIRF microscopy with single-particle tracking).

Figure 2

Figure 2. Study design of the present work: synthesis and characterization of fluorescent probes with high Y4R binding affinity derived from recently reported cyclic hexapeptides (6, (31) 4 (30)).

High Resolution Image
Download MS PowerPoint Slide

Results and Discussion

Click to copy section linkSection link copied!

Synthesis and Chemical Stability

In addition to the previously described amino-functionalized peptide 6, (31) an alkyne-functionalized precursor peptide (11) was prepared for fluorescence labeling. The cyclic peptide 11 was prepared via the N-terminally succinylated linear peptide 10, which was synthesized by solid-phase peptide synthesis (SPPS) involving the reported Nω-carbamoylated arginine building blocks 8 (32) (position 3) and 9 (29) (position 1) (structures of 8 and 9 shown in Figure 3).

Figure 3

Figure 3. Structures of the reported Nω-carbamoylated arginines 8 (32) and 9 (29) used in SPPS for the preparation of precursor peptide 11.

High Resolution Image
Download MS PowerPoint Slide
The amino-functionalized arginine derived from building block 8 is required for peptide cyclization, and the incorporation of 9 provides the alkyne functional group (Scheme 1). The fully deprotected peptide 10 was cyclized in solution via the succinyl carboxylic group and the primary amino group of the carbamoylated arginine in position 3 (coupling reagents: HOBt, PyBOP, DIPEA), yielding peptide 11 in 21% yield. To note, the synthesis of the alkyne-functionalized peptide 11 is more laborious compared to the preparation of the reported amine-functionalized precursor peptide 6, (31) as the synthesis of 11 requires two different Nω-carbamoylated arginines. The major purpose for the synthesis of peptide 11 and a fluorescent dye conjugate derived from 11 was to explore how strongly this structural modification, including the attachment of a fluorescent dye by click chemistry, affects binding to Y4R.

Scheme 1

Scheme 1. Synthesis of the Cyclic Peptide 11 via SPPSa
High Resolution Image
Download MS PowerPoint Slide

aReagents and conditions: (a) Fmoc amino acid/HOBt/HBTU/DIPEA (5/5/4.9/10 equiv), DMF/NMP 8:2 v/v, 38 °C, 2 × 45 min (“double” coupling); Fmoc deprotection (following amino acid coupling): 20% piperidine in DMF/NMP 8:2 v/v, rt, 2 × 10 min; (b) building block 8 or 9/HOBt/HBTU/DIPEA (3/3/2.9/6 equiv), DMF/NMP 8:2 v/v, 38 °C, 16 h (single coupling); Fmoc deprotection (following amino acid coupling): as under (a); (c) succinic anhydride/DIPEA (10/10 equiv), DMF/NMP 8:2 v/v, 38 °C, 45 min; (d) (1) TFA/CH2Cl2 1:3 v/v, rt, 2 × 20 min; (2) TFA/H2O 95:5 v/v, rt, 5 h; overall yield: 37%; (e) peptide cyclization: HOBt/PyBOP/DIPEA (3/2.9/6 equiv), DMF/NMP 8:2 v/v, rt, 16 h, 21%.

For the preparation of the fluorescent peptides, different fluorescent dyes with various reactive groups were used (Scheme 2): the indolinium-type dyes Cy3B and Sulfo-Cy5 (S0223), used as succinimidyl esters (compounds 12 and 13), the pyrylium dye Py-1 (14, yielding a pyridinium-type cyanine dye after reaction with primary amines), and the azido-functionalized pyridinium-type cyanine dye 15, which was obtained from the pyrylium dye Py-5 and 3-azidopropane-1-amine (Scheme S1, Supporting Information). The fluorescently labeled ligands 16–18 were prepared from precursor 6 and the activated fluorescent dyes 12, 13, and 14, respectively, using DIPEA as a base and N,N-dimethylformamide (DMF) as solvent. 16–18 were obtained in 34–69% yield. Fluorescent ligand 19 was synthesized from 11 and 15 via a copper(I)-catalyzed “click-reaction” in 27% yield.

Scheme 2

Scheme 2. Synthesis of the Fluorescent Y4R Ligands 16–19a
High Resolution Image
Download MS PowerPoint Slide

aReagents and conditions: (a) DIPEA, DMF, rt, 2 h, 34–69%; (b) CuSO4, sodium ascorbate, H2O/NMP 1:1 v/v, rt, 2 h, 27%.

The chemical stability of 16–18 was investigated in phosphate-buffered saline (PBS, pH 7.4) at room temperature over 48 h. The Cy3B- and Sulfo-Cy5 labeled compounds 16 and 17 showed excellent stability (Figure S1A,B, Supporting Information). The Py-1 labeled ligand 18 showed a slow decomposition (Figure S1C, Supporting Information). However, for at least up to 6 h, the degradation was marginal allowing an investigation of this fluorescent ligand in cellular assays used in this study.

Investigation of YR Binding in Radiochemical Binding Assays

Y1, Y2, Y4, and Y5 receptor binding of 11 and 16–19 was determined using reported whole-cell radioligand competition binding assays (Y1: Keller et al., (33) Y2: Konieczny et al., (34) Y4: Konieczny et al., (30) Y5: Kuhn et al. (35)). With pKi values >9, all studied compounds showed high Y4R affinities (Table 1, competition binding curves shown in Figure S2, Supporting Information). Since the Ki values were at least 500-fold lower compared to the Ki determined at Y1, Y2, and Y5 receptors, 11 and 16–19 also exhibit pronounced Y4R selectivity.
Table 1. Y Receptor Binding Data of hPP, 4–6, 11, and 16–19
 pKi ± SEM/Ki [nM]
compd.hY1RahY2RbhY4RchY5Rd
hPP6.4/440e<5.5/>3000e10.02 ± 0.06/0.10f7.8/17e
4<5.5/>3000g<5/>10000g10.36 ± 0.11/0.048g<5.5/>3000g
5<5/>10000g<5/>10000g10.48 ± 0.04/0.033g<5.5/>3000g
6<6/>1000h6.04 ± 0.07/950h10.04 ± 0.04/0.093h<6/>1000h
11<5/>10000<5/>100009.38 ± 0.04/0.42<5.5/>3000
166.91 ± 0.01/120<6/>10009.71 ± 0.09/0.216.32 ± 0.04/480
17<6/>1000<6/>10009.48 ± 0.09/0.35<6/>1000
18<6/>1000<6/>10009.22 ± 0.03/0.616.08 ± 0.05/840
19<6/>1000<6/>10009.22 ± 0.06/0.62<6/>1000
a

Determined by competition binding at SK-N-MC neuroblastoma cells using [3H]UR-MK299 (Kd = 0.054 nM, c = 0.15 nM) as radioligand.

b

Determined by competition binding with [3H]propionyl-pNPY (Kd = 0.14 nM, (34) c = 0.5 nM) at CHO-hY2R cells.

c

Determined by competition binding at CHO-hY4R-Gqi5-mtAEQ cells using [3H]UR-KK200 (Kd = 0.67 nM, (35) c = 1 nM) as radioligand.

d

Determined by competition binding at HEC-1B-hY5R cells using [3H]propionyl-pNPY (Kd = 11 nM, (26) c = 5 nM) as radioligand.

e

Berlicki et al. (reported Ki values were converted to pKi values). (36)

f

Wirth et al. (37)

g

Konieczny et al. (30)

h

Gleixner et al. (31) Data represent mean values ± SEM (pKi) or mean values (Ki) from 3 to 4 independent experiments performed in triplicate.

Consequently, incorporation of the alkyne-functionalized carbamoylated arginine instead of Arg1 in the parent compound 4 (compound 11) and coupling to a fluorescent dye (19) only slightly affects Y4R binding (Table 1). Likewise, the conjugation of fluorescent dyes to precursor peptide 6 did not alter Y4R binding, underlining the addressed position in 6 as favorable for the attachment of bulky moieties.

Functional Studies at Y4R

Y4R agonistic activities of 11 and 16–19 were investigated in a Ca2+ aequorin assay, (25,34) measuring the increase in cytosolic Ca2+, and a miniGsi recruitment assay, (37) detecting binding of an artificial G-protein to the Y4R. Additionally, compounds 16 and 17 were studied in a cAMP CAMYEN assay (31) to measure changes in cytosolic cAMP levels. The CAMYEN assay uses a Nanoluciferase as the BRET donor in place of the “Renilla” luciferase found in the traditional CAMYEL BRET assay, while retaining the rest of the sensor. Due to the increased brightness of the Nanoluciferase compared to the “Renilla” luciferase, the CAMYEN biosensor has an increased bioluminescence signal readout, as well as a bigger window in the signal-to-baseline of the cAMP responses, reducing saturation of the sensor. This allows for easier and faster detection of CAMYEN sensor activation by plate readers and a greater potential for determining ligand efficacy (i.e., partial agonism) when compared to the CAMYEL assay.
To note, control experiments with hPP in the absence and presence of dummy fluorescent ligands showed that the readout of the aequorin (Ca2+-assay) and Nanoluciferase (Nluc, miniGsi assay) luminescence is only slightly affected by the fluorophore at high fluorescent ligand concentrations (Figure S6, Supporting Information).
In the Ca2+ and mini Gsi assays, the studied peptides displayed partial agonism with efficacies ranging from 56 to 71 and 43 to 72%, respectively (Table 2, concentration–response curves shown in Figures S3 and S4, Supporting Information).
Table 2. Y4R Agonistic Activities of hPP, 4–6, 11, and 16–19a
 Ca2+-aequorinminiGsi recruitmentCAMYEN cAMP
cmpd.pEC50 ± SEM/EC50 [nM]Emax ± SEM/%pEC50 ± SEM/EC50 [nM]Emax ± SEM/%pEC50 ± SEM/EC50 [nM]Emax ± SEM/%
hPP7.90 ± 0.2/17b100b8.94 ± 0.01/1.1b100b9.85 ± 0.09/0.15b100b
48.57 ± 0.03/2.7c81 ± 1cn.d.n.d.9.79 ± 0.1/0.17b113 ± 9b
59.00 ± 0.07/0.99c84 ± 2c8.74 ± 0.04/1.861 ± 2n.d.n.d.
67.76 ± 0.05/18b69 ± 3b8.60 ± 0.03/2.5b62 ± 2bn.d.n.d.
117.01 ± 0.01/9856 ± 37.2 ± 0.1/7362 ± 1n.d.n.d.
167.8 ± 0.1/1966 ± 27.4 ± 0.1/4172 ± 99.58 ± 0.06/0.2693 ± 5
177.41 ± 0.05/4071 ± 37.07 ± 0.09/9370 ± 99.65 ± 0.05/0.2290 ± 3
187.3 ± 0.1/6561 ± 58.15 ± 0.01/7.144 ± 2n.d.n.d.
197.25 ± 0.07/5864 ± 27.38 ± 0.02/4243 ± 1n.d.n.d.
a

Agonistic potencies (pEC50, EC50) and efficacies Emax (relative to the maximum effect elicited by 1 μM hPP, Emax = 100%) determined in a Ca2+-aequorin assay (CHO-hY4R-Gqi5-mtAEQ cells), a miniGsi recruitment assay (HEK293T-NlucN-mGsi/Y4R-NlucC cells) and in a CAMYEN cAMP assay (HEK293T-CAMYEN-hY4R cells).

b

Gleixner et al. (31)

c

Konieczny et al. (30) Data represent mean values ± SEM (pEC50, Emax) or mean values (EC50) from three or four independent experiments performed in triplicate. n.d. = not determined.

As previously observed for peptidic Y4R agonists, (31) the potencies (pEC50) obtained from the Ca2+ and miniGsi assay were consistently lower than the respective binding affinities (pKi values; Tables 1 and 2), which can be attributed to the nonequilibrium conditions in the case of the functional assays. In contrast, the pEC50 values of 16 and 17, determined in the cAMP CAMYEN assay, were in good agreement with the pKi values from the radiochemical competition binding assay, which is explainable by a downstream signal amplification for this type of functional assay.

Fluorescence Characterization

The excitation and emission spectra of 16–19 and the emission quantum yield were recorded in PBS and PBS supplemented with 1% bovine serum albumin (BSA, spectra shown in Figure S7, Supporting Information). The Cy3B-labeled ligand 16 showed the highest quantum yield with 67–69% (Table 3). The small spectral shifts of the maxima of the excitation and emission spectra in the presence of BSA may indicate some unspecific interactions to protein surfaces. However, as the fluorescence quantum yield is not altered in the presence of BSA, these interactions have no significant impact on the general photophysics of the Cy3B dye. Interestingly, comparison to the Cy3B derivative, which was obtained by preparation of an amide from succinimidyl ester 12 (Cy3B-SE, cf. Scheme 2) and 2-aminoethanol, (38) reveals that the peptide moiety in fluorescent ligand 16 mediates an increase in fluorescence quantum yield by ca. 10%.
Table 3. Maxima of the Excitation and Emission Spectra and Fluorescence Quantum Yields of 16–19, Determined in PBS (pH = 7.4) and PBS Containing 1% BSA
  λex [nm]/λem [nm]/Δ [eV]Φ [%]
compd.dyePBSPBS with 1% BSAPBSPBS with 1% BSA
16Cy3B571/584/0.048572/586/0.0526967
17Sulfo-Cy5648/665/0.049657/670/0.0372633
18py-1517/633/0.439506/595/0.367236
19py-5496/692/0.708515/644/0.482424
For the Sulfo-Cy5 labeled compound 17, the bathochromic shift is more pronounced and a small increase in fluorescence quantum yield is observed in the presence of BSA, which was also previously observed for peptidic neurotensin receptor ligands. (39) In the case of the pyridinium-type cyanine dye-labeled ligands 18 and 19, a hypsochromic shift of the first electronic absorption and a considerably higher fluorescence quantum yield in the presence of BSA is observed (Table 3). This phenomenon, also reported for other Py-1- and Py-5-labeled receptor ligands, (40−42) can be explained by strongly reduced degrees of freedom in configurational space of the fluorophore due to binding interactions with amino acid residues on the BSA surface, which is evidenced by the marked reduction in the Stokes shift observed for 18 and 19. In contrast to the Cy3B dye in 16, the conformationally less restricted dyes in 17–19 show a Stokes shift reduction and enhancement of the fluorescence quantum yield in the presence of BSA. It is tempting that in the dyes with higher flexibility (as in 17–19) the excitation energy is rapidly released via pronounced geometric changes favoring internal conversion rather than fluorescence and that rigidification due to binding to BSA blocks these deactivation channels making fluorescence a competing process. Currently, detailed mechanistic studies are conducted in our laboratories to elucidate the excited state deactivation of the pyridinium-type cyanine dyes in 18 to 19 on a molecular level.

Flow Cytometric Y4R Binding Studies

Y4R binding of 16–18 was investigated in flow cytometry-based binding experiments using CHO-hY4R-Gqi5-mtAEQ cells, (25) which were also used for radiochemical binding assays and the Ca2+ aequorin assay. Saturation binding with the Cy3B-labeled ligand 16 was performed in a sodium-free buffer (buffer I, composition see the Experimental Section) and in sodium-containing (137 mM Na+) DPBS (Figure 4A). This comparison was of interest as previous studies revealed marked differences in Y4R affinities of Y4R (partial) agonists depending on the presence or absence of sodium in the binding buffer (up to 20-fold lower affinity in the presence of Na+ at a physiological concentration). (26,31,35) As receptor binding studies should generally be performed under physiological-like conditions, i.e., in sodium-containing buffers, 17 and 18 were only studied in DPBS. The flow cytometric investigation of the cell viability by propidium-based live/dead staining revealed that in sodium-free buffer (buffer I) the major fraction of CHO-hY4R-Gqi5-mtAEQ cells was nonviable already after 15 min of incubation at 22 °C (Figure S8A, Supporting Information). Over time (followed up to 6 h), the fraction of intact cells further decreased. In contrast, CHO-hY4R-Gqi5-mtAEQ cells suspended in DPBS were largely intact even after 6 h of incubation (Figure S8B, Supporting Information). As the dissociation of 16 from CHO-hY4R-Gqi5-mtAEQ cells was followed over 6 h in buffer I (see below), a data analysis based on the intact cell population was not reasonable for the whole experiment. Therefore, for all flow cytometric binding experiments performed with 16 in buffer I (saturation binding, association and dissociation kinetics, competition binding), data analysis was performed based on the nonviable cell population (corresponds to population P2 in Figure S8A, Supporting Information).

Figure 4

Figure 4. Flow cytometric saturation binding of 16 (A), 17 (B), and 18 (C) at whole CHO-hY4R-Gqi5-mtAEQ cells at 22 ± 2 °C. (A) Representative saturation isotherms (red circle) of 16 from experiments performed in sodium-free buffer (buffer I) and sodium-containing buffer (DPBS, 137 mM Na+). (B, C) Representative saturation isotherms (red circle) of 17 (B) and 18 (C) from experiments performed in sodium-containing buffer (DPBS). Unspecific binding (blue squares) was determined in the presence of 1 μM hPP (A–C). Total and unspecific binding data represent mean values ± SEM. Specific binding, representing calculated values ± propagated error, were fitted according to an equation describing a hyperbolic isotherm (binding-saturation: one site-specific binding, GraphPad Prism 5).

High Resolution Image
Download MS PowerPoint Slide
Saturation binding studies with fluorescent ligand 16 gave a slightly lower Kd value for buffer I (Kd: 0.30 nM) compared to DPBS (Kd: 0.70 nM). Notably, analysis of the saturation binding data based on the intact cell population (performed as a control), yielded the same Kd values as obtained from the analysis based on the nonviable cell population, showing that the loss of cell integrity had no or only little impact on Y4R binding of 16 (cf. Figure S9, Supporting Information). With Kd values <1 nM, fluorescent ligand 16 showed higher Y4R binding affinity compared to previously reported fluorescently labeled Y4R ligands. (25−27,29) Saturation binding with 17 and 18 yielded Kd values of 0.93 and 0.51 nM, respectively (Table 4 and Figure 4B,C) indicating that the type of fluorophore has almost no effect on Y4R binding.
Table 4. Parameters Characterizing Y4R Binding of 16–18 Determined in Flow Cytometric Binding Assays at 22 ± 2 °C Using CHO-hY4R-Gqi5-mtAEQ Cells
  saturation bindingbinding kinetics
cmpd.bufferpKd/Kd [nM]akobs(mono) [min–1]bkobs(bi,fast) [min–1]ckobs(bi,slow) [min–1]ckoff [min–1]dkon(mono) [nM–1 min–1]ekon(bi,fast) [nM–1 min–1]e kon(bi,slow) [nM–1 min–1]eKd(kin) [nM]f
16buffer I (Na+-free)9.56 ± 0.09/0.300.13 ± 0.02n.a.0.0069 ± 0.00060.41 ± 0.07n.a.0.017 ± 0.004
16DPBS (137 mM Na+)9.16 ± 0.05/0.700.18 ± 0.041.0 ± 0.20.012 ± 0.0010.24 ± 0.051.3 ± 0.3with kon(mono): 0.05 ± 0.02
0.048 ± 0.0030.050 ± 0.006with kon(bi,fast): 0.009 ± 0.002
with kon(bi,slow): 0.25 ± 0.05
17DPBS (137 mM Na+)9.03 ± 0.02/0.930.15 ± 0.011.89 ± 0.050.026 ± 0.0020.12 ± 0.011.87 ± 0.05with kon(mono): 0.21 ± 0.03
0.071 ± 0.0080.045 ± 0.009with kon(bi,fast): 0.007 ± 0.001
with kon(bi,slow): 0.29 ± 0.07
18DPBS (137 mM Na+)9.3 ± 0.1/0.510.10 ± 0.020.7 ± 0.10.010 ± 0.0010.18 ± 0.041.3 ± 0.2with kon(mono): 0.06 ± 0.02
0.034 ± 0.0010.048 ± 0.004with kon(bi,fast): 0.008 ± 0.002
with kon(bi,slow): 0.20 ± 0.05
a

Equilibrium dissociation constant expressed as pKd (mean values ± SEM) and Kd (mean values) obtained from at least three independent experiments (performed in triplicate).

b

Observed association rate constant obtained by monophasic fitting (exponential rise to a maximum); mean values ± SEM from three independent experiments (performed in duplicate).

c

Observed association rate constant obtained by biphasic fitting; mean values ± SEM from three or four independent experiments (performed in duplicate).

d

Dissociation rate constant obtained from three-parameter monophasic fits (exponential decline); mean values ± SEM from three or four independent experiments (performed in duplicate).

e

Association rate constant ± propagated error calculated from kobs(mono), kobs(bi,fast), or kobs(bi,slow) values, the respective koff value, and the ligand concentration used for the association experiments.

f

Kinetically derived dissociation constant ± propagated error calculated from koff and kon values. n.a.: not applicable

All data obtained from association binding experiments in DPBS correspond better to a biphasic than to a monophasic curve (Figure 5A,C), as supported by a statistical extra sum-of-squares F-test (one-phase association vs two-phase association, GraphPad Prism 5) giving P values <0.002. In contrast, the association of 16 in sodium-free buffer was monophasic (F-test derived P-value: 0.55) (Figure 5A). For all studied fluorescent ligands (16–18), association experiments indicated that equilibrium is reached after approximately 1 h (Figure 5A,C). Worth mentioning, the structurally related radioligand [3H]UR-JG102 ([3H]7), also studied at CHO-hY4R-Gqi5-mtAEQ cells in sodium-free (buffer I) and sodium-containing (DPBS) buffer, showed similar kinetics being monophasic in buffer I and biphasic in DPBS. However, compared to 16–18, the biphasic character of the association curve of [3H]7 in DPBS was considerably more pronounced. (31) As described for [3H]7, the first (fast) association phase could represent association to a subpopulation of receptors that are sodium-bound. (31) It is well known that sodium stabilizes the inactive receptor conformation of GPCRs, (43) presumably being better accessible for receptor agonists due to a more open passage to the ligand binding pocket. (43,44) The second (slow) association could represent binding to a population of nonsodium-bound receptors (note: at 150 mM sodium a GPCR population is not necessarily saturated with sodium (44)), which are prone to adapt the active receptor conformation. At first sight, this disagrees with the observed proportions of the initial (fast) and the second (slow) association phase, which varied considerably for the fluorescent ligands 16–18 (values given in the caption of Figure 5). However, as the receptor conformation also depends on the coupling to the G-protein and as G-protein binding may influence ligand binding, (45) the inconsistency of the proportions could be explained by a ligand bias with respect to the G-protein coupling efficiency of the agonist-bound receptor and in terms of G-protein modulated ligand affinity. This is in accordance with the monophasic association of 16 observed in the FA assay using Y4R displaying BBVs instead of whole cells (see below). It should also be kept in mind that during the association process, dissociation takes place, which codetermines the result of an association experiment. Furthermore, provided that the receptor populations are interconvertible and that equilibria among different receptor conformations can be modulated by the ligand, (46) a readjustment of the equilibrium between distinct receptor populations may occur upon ligand binding, which can be differently pronounced for different ligands.

Figure 5

Figure 5. Binding kinetics of 16–18 determined by flow cytometry at whole CHO-hY4R-Gqi5-mtAEQ cells at 22 ± 2 °C. (A) Association of 16 to the hY4R under sodium-free conditions (buffer I) and in sodium-containing buffer (DPBS, 137 mM Na+). Concentration of 16: 0.3 and 0.7 nM, respectively. Proportion of the initial fast association (two-phase association fit, GraphPad Prism 5): 38 ± 4% (mean ± SEM). (B) Dissociation of 16 from the hY4R determined in buffer I and DPBS. The dissociation was initiated after 1.5 h of preincubation with 16 (c = 1.5 nM (Na+-free) and 3.5 nM (137 mM Na+)) by the addition of an excess of hPP (1000-fold) and 5 (100-fold). Plateau values of the three-parameter fits (monophasic exponential decline): 13% (Na+-free), 22% (137 mM Na+). (C) Association of 17 (c = 1 nM) and 18 (c = 0.5 nM) to the hY4R determined in DPBS (137 mM Na+). Proportion of the initial fast association (two-phase association fit, GraphPad Prism 5): 74 ± 1% (17), 29 ± 3% (18) (mean values ± SEM). (D) Dissociation of 17 and 18 from the hY4R in DPBS. The dissociation was initiated after 1.5 h of preincubation with 17 (c = 5 nM) or 18 (c = 2.5 nM) by the addition of an excess of hPP (1000-fold) and 5 (100-fold). Plateau values of the three-parameter fits (monophasic exponential decline): 13% (17), 22% (18). Data (A–D) represent mean values ± SEM from three independent experiments performed in duplicate.

High Resolution Image
Download MS PowerPoint Slide
The dissociation of 16 was monophasic for the sodium-free and sodium-containing buffer (Figure 5B). As also observed for the radioligand [3H]7, the dissociation of 16 from Y4R was incomplete (plateau significantly higher than zero, P < 0.05, t test). The minor component of long-lived Y4R binding may be explained by a conformational readjustment of the receptor protein upon ligand binding (47) or by an increased rebinding capability due to simultaneous interaction with more than one binding site. (48) Moreover, as 16 is a Y4R partial agonist, the incomplete dissociation could also be caused by ligand-induced receptor internalization. The Sulfo-Cy5 labeled compound 17 and the Py-1 labeled probe 18 showed a monophasic dissociation comparable to that of 16 in terms of koff values and the minor component of long-lived Y4R binding (Figure 5D and Table 4).
The kinetically derived dissociation constants Kd(kin) of 16–18 obtained in DPBS were calculated from koff and kon(bi,fast), koff, and kon(bi,slow), and additionally from koff and kon(mono), as the latter represents the whole association process and also with regard to the fact that the biphasic character of the association was only weakly pronounced. The Kd(kin) values were consistently lower than the equilibrium Kd values obtained from saturation binding experiments. For all three fluorescent ligands, the lowest discrepancy between Kd(kin) and the equilibrium Kd (factor 2.6–3.2) is obtained when kon(bi,slow) is used for the calculation (Table 4). This indicates that Y4R binding of 16–18 in DPBS largely proceeds according to the law of mass action for an incubation time of approximately 1 h. Flow cytometric Y4R competition binding studies in buffer I and DPBS using 16 as labeled ligand are discussed below.

Fluorescence Anisotropy-Based Y4R Binding Studies

As Cy3B exhibits a fluorescence lifetime (τ(PBS) = 2.27 ns, τ(PBS + 1% BSA) = 2.74 ns (38)) compatible with FA measurements, the Cy3B-labeled fluorescent ligand 16 was investigated in FA-based Y4R binding assays. For these experiments, Y4R displaying budded baculovirus particles (BBVs) were used. With a uniform size of approximately 300 nm × 50 nm (length × diameter), BBVs are well suited for FA measurements. (19) To note, techniques that are not based on the use of polarized light (e.g., radiochemical, flow cytometric, and NanoBRET binding assays), require a large excess of the labeled probe relative to the amount of receptor used. In contrast, FA measurements require approximately equal concentrations of the labeled ligand and receptor. Accordingly, ligand depletion must be taken into account for FA data analysis.
For Y4R binding studies, two batches of Y4R displaying BBVs were prepared in SF9 insect cells: the Y4R was either expressed alone or in combination with enzymes catalyzing a mammalian-like receptor glycosylation (so-called “SweetBac” system (49)). In the present article, the term Y4Rnonglyco is used for the former approach, precluding a mammalian-like glycosylation of Y4R, and the term Y4RSwBac is used for the latter (we do not use the term Y4Rglyco as glycosylation was not proven).
All FA binding experiments with 16 were performed in DPBS (137 mM Na+). Equilibrium binding involving two different concentrations of 16 yielded Kd values of 0.60 nM (Y4Rnonglyco) and 0.14 nM (Y4RSwBac) (Figure 6A and Table 5), essentially being in agreement with the equilibrium Kd value of 16 obtained from flow cytometric saturation binding studies in DPBS (0.70 nM). These experiments also provide information about the Y4R concentration of the BBV stocks (plotted at the abscissa in Figure 6A, values provided in the figure caption).

Figure 6

Figure 6. Binding of 16 to hY4R displaying BBVs studied by FA measurement at 27 °C. (A) Binding isotherms of 16 obtained from experiments using fixed concentrations of 16 (0.5 or 2 nM) and increasing amounts of Y4R. Total binding is represented by filled symbols and unspecific binding (determined in the presence of 1 μM hPP) is represented by open symbols. Depicted data (mean values ± SEM from a representative experiment performed in duplicate) represent snapshots at 90 min incubation. Y4R concentrations displayed on the abscissa were calculated after global analysis of the data from three or four individual experiments by a modified version of a model described by Veiksina et al., (19) affording the estimated binding site (Y4R) concentration of the applied BBV stock which amounted to 6 ± 1 nM (Y4Rnonglyco, mean value ± SEM, n = 3) or 2.1 ± 0.1 nM (Y4RSwBac, mean value ± SEM, n = 4). (B) Association and dissociation of 16 (0.5 nM) determined in real time for three different Y4R concentrations (green, blue, and red symbols). Total binding is represented by filled symbols and unspecific binding (determined in the presence of 1 μM hPP) is represented by open symbols. Data represent mean values ± SEM from a representative experiment performed in duplicate.

High Resolution Image
Download MS PowerPoint Slide
Table 5. Parameters Characterizing Y4R Binding of 16 Determined in Fluorescence Anisotropy-Based Binding Assays at 27 °C Using Y4Rnonglyco and Y4RSwBac Displaying BBVs
 saturation bindingbinding kinetics
BBVpKd/Kd [nM]akon [nM–1 min–1]bkoff [min–1]cKd(kin) [nM]d
Y4Rnonglyco9.2 ± 0.1/0.600.015 ± 0.0040.0012 ± 0.00010.11 ± 0.03
Y4RSwBac9.9 ± 0.1/0.140.021 ± 0.0020.00098 ± 0.000030.052 ± 0.006
a

Equilibrium dissociation constant expressed as pKd (mean values ± SEM) and Kd (mean value) obtained from three independent experiments (performed in duplicate).

b

Association rate constant ± SEM obtained from global analysis (19) of data from three individual experiments (performed in duplicate) each involving two different concentrations of 16 (0.5 and 7.0, or 0.5 and 2.0 nM).

c

Dissociation rate constants obtained from three-parameter monophasic fits (exponential decline). Mean values ± SEM from three independent experiments (performed in triplicate).

d

Kinetically derived dissociation constants ± SEM calculated from the mean koff value and individual kon values.

Association and dissociation experiments with 16 were performed with six different receptor concentrations and 2–3 different fluorescent ligand concentrations. The association and dissociation curves obtained for a ligand concentration of 0.5 nM are shown for three selected receptor concentrations in Figure 6B. For both Y4R batches, the association and dissociation curves were monophasic and the dissociation was nearly complete with plateau values <12%.
Notably, the association of 16 to Y4R was faster compared to flow cytometric and BRET-based kinetic binding studies, reaching a plateau after about 10 min (Figures 5A,C, 6B, and 7B), regardless of minor differences in assay temperatures (flow cytometry: 22 °C, FA: 27 °C, BRET: 25 °C). This could be attributed to the different expression systems (mammalian vs Sf9 insect cells). Y4Rs displayed by BBVs (FA assay) are highly unlikely to couple with insect cell Gαi-like proteins, (50) thus a ternary complex, which would affect agonist receptor affinity, cannot be formed. As in the case of flow cytometric kinetic binding studies, the kinetically derived Kd value of 16 was lower than the equilibrium Kd (ca. a factor of 6 and 3 for Y4Rnonglyco and Y4RSwBac, respectively) (Table 5). Concerning the two variants of Y4R preparations (nonglycosylated vs putatively glycosylated), no marked differences in Y4R binding were observed. FA-based Y4R competition binding studies using 16 as a labeled ligand are discussed below.

Figure 7

Figure 7. Characterization of Y4R binding of fluorescent ligand 16 in a NanoBRET-based binding assay at 25 °C using intact HEK293T-hY4R-NLuc(intraECL2) cells. (A) Representative saturation isotherm (specific binding) from saturation binding experiments. Unspecific binding was determined in the presence of 1 μM 5. Total and unspecific binding data represent mean values ± SEM. Specific binding data represent calculated values ± propagated error. (B) Association of 16 (c = 1 nM) to Y4R. Mean values ± SEM from three independent experiments performed in triplicate. (C) Dissociation of 16 from Y4R. The dissociation was initiated after 1.5 h of preincubation with 16 (c = 3.5 nM) by the addition of a 1000-fold excess of 5. Mean values ± SEM from three independent experiments performed in duplicate. Plateau value of the three-parameter fit describing a monophasic exponential decline: 6% (note: for the biphasic fit the plateau value was not different from zero, see discussion).

High Resolution Image
Download MS PowerPoint Slide

NanoBRET Y4R Binding Studies

To establish a Y4R NanoBRET binding assay, HEK293T cells were stably transfected with two different hY4R-Nluc fusion constructs, either with N-terminally fused Nluc (HEK293T-Nluc-hY4R cells) or with the Nluc inserted in the extracellular loop (ECL) 2 of the receptor (HEK293T-hY4R-Nluc(intraECL2) cells). Recently, BRET-based Y1R binding of a fluorescently labeled ligand at different Nluc-Y1R constructs was described. In these studies, the N-terminal fusion construct produced no BRET signal, whereas the intraECL2 construct gave high signals allowing the determination of equilibrium Kd values and kinetic data. (51) Binding experiments with 16 at HEK293T-Nluc-hY4R cells and HEK293T-hY4R-Nluc(intraECL2) cells also resulted in considerably lower BRET signals for the former compared to the latter (data not shown), which can most likely be attributed to a higher distance between the Nluc and the Y4R ligand binding pocket with the N-terminal fusion construct. Therefore, the binding studies with 16 were performed with the HEK293T-hY4R-Nluc(intraECL2) cells using coelenterazine h or furimazine as the Nluc substrate and 5 for the determination of unspecific binding instead of hPP (used to block Y4R in radiochemical, flow cytometric and FA-based assays). This was necessary as the insertion of Nluc into ECL2 hampers Y4R binding of the large endogenous ligand hPP (see competition binding studies below, Figure 8).

Figure 8

Figure 8. Determination of Y4R affinities of Y4R reference ligands (hPP, 5, 7, UR-MK188, UR-MEK388, UR-KK200) in different fluorescence-based assays by competition binding with 16. (A) Displacement curves based on data from flow cytometric competition binding experiments performed with intact CHO-hY4R-Gqi5-mtAEQ cells in sodium-free buffer (buffer I) and sodium-containing buffer (DPBS, 137 mM Na+). (B) Displacement curves from fluorescence anisotropy-based competition binding experiments performed with Y4RSwBac-displaying BBVs in DPBS. (C) Displacement curves from NanoBRET-based competition binding experiments performed with intact HEK293T-hY4R-NLuc(intraECL2) cells in L15-HEPES (140 mM Na+). Data (A–C), representing mean values ± SEM from three to five independent experiments performed in duplicate (B) or triplicate (A, C), were fitted according to a four-parameter logistic model.

High Resolution Image
Download MS PowerPoint Slide
Saturation binding with 16 at HEK293T-hY4R-Nluc(intraECL2) cells yielded a Kd value of 0.94 nM in good agreement with the Kd values obtained from flow cytometry and FA-based saturation binding assays (Tables 4–6 and Figure 7A).
Table 6. Parameters Characterizing Y4R Binding of 16 Determined in a NanoBRET Binding Assay at 25 °C
saturation bindingbinding kinetics
pKd/Kd [nM]akobs [min–1]bkoff [min–1]ckon [nM–1min–1]dKd(kin) [nM]e
9.02 ± 0.04/0.94mono: 0.18 ± 0.04mono: 0.06 ± 0.01mono: 0.18 ± 0.07mono: 0.3 ± 0.2
bi, fast: 0.58 ± 0.02bi, fast: 0.34 ± 0.03bi, fast: 0.24 ± 0.05bi, fast: 1.4 ± 0.4
bi, slow: 0.095 ± 0.005bi, slow: 0.016 ± 0.002bi, slow: 0.078 ± 0.008bi, slow: 0.21 ± 0.05
a

Equilibrium dissociation constant expressed as pKd (mean values ± SEM) and Kd (mean value) obtained from three independent experiments (performed in triplicate).

b

Observed association rate constants obtained by monophasic and biphasic fitting. Mean values ± SEM from four independent experiments (performed in triplicate).

c

Dissociation rate constants obtained from three-parameter monophasic (Y0 constrained to 100%) and five-parameter biphasic (Y0 constrained to 100%, plateau constrained to zero) fits (exponential decline). Mean values ± SEM from three independent experiments (performed in triplicate).

d

Association rate constant ± propagated error calculated from kobs, koff, and the ligand concentration used for the association studies.

e

Kinetically derived dissociation constants ± propagated error calculated from various koff and kon values.

As in the case of flow cytometric association and dissociation studies, kinetic data from the BRET assay with 16 were analyzed by monophasic and biphasic fits (Figure 7B,C and Table 6). For both, association and dissociation experiments, the statistical Extra sum-of-squares F-test suggested that the data are better fitted by the biphasic fit compared to a monophasic analysis (two-phase association vs one-phase association and two-phase decay vs one-phase decay, GraphPad Prism 5) giving P values <0.0001. For the monophasic dissociation analysis, the plateau value was low (6%), but still significantly different from zero (P < 0.05, t test). In contrast, for the biphasic fit, the plateau value was not different from zero (P > 0.05, t test) indicating a complete dissociation of 16 from the Y4R (Figure 7B,C). Possible reasons for a biphasic association were discussed in the section describing flow cytometric binding studies (see above). Like the biphasic association, the biphasic dissociation may also be explained by the existence of different receptor states. (47) However, since a monophasic dissociation curve was obtained from flow cytometric dissociation experiments with 16 (cf. Figure 5B), the cell type (flow cytometry: CHO cells, NanoBRET: HEK293T cells) and/or the receptor variant (flow cytometry: wild-type Y4R, NanoBRET: Y4R-Nluc construct (Nluc inserted in ECL2)) seem to be relevant for the association. Recently, a metadynamics protocol for binding and unbinding of peptide ligands of class A GPCRs suggested that Y4R agonists also bind with high affinity to the vestibule-like binding site of Y4R, located on top of the orthosteric binding site. (52) Consequently, in the dissociation process, the ligand might be withheld by residing in the vestibule of the receptor. Depending on the receptor conformation and possibly additionally triggered by the presence of Nluc in the ECL2 of the Y4R, the residence time in the vestibule might vary, resulting in different dissociation rates as observed in the NanoBRET assay.
The Kd(kin) values of 16 were calculated from kon(bi,fast) and koff(bi,fast) as well as from kon(bi,slow) and koff(bi,slow), and additionally from kon(mono) and koff(mono) as the monophasic fits cover the whole association and dissociation process. Moreover, the biphasic character was generally weak (minor differences in k values, see Table 6). Interestingly, the Kd(kin) value derived from kon(bi,fast) and koff(bi,fast) was in good agreement with the Kd value from saturation binding studies. The Kd(kin) value obtained from kon(mono) and koff(mono) and the Kd(kin) calculated from kon(bi,slow) and koff(bi,slow) were similar and slightly lower (factor 3–5) compared to the Kd obtained from saturation binding experiments (Table 6). Consequently, irrespective of the weak biphasic nature of the association and dissociation, Y4R binding of 16 studied in the NanoBRET assay approximatively follows the law of mass action.
BRET-based saturation binding experiments at HEK293T-hY4R-Nluc(intraECL2) cells were also performed with the Py-1 labeled ligand 18. Although the excitation spectrum of the Py-1 conjugate 18 shows a higher overlap with the Nluc emission spectrum (λmax ca. 460 nm) (53) compared to the excitation spectrum of the Cy3B-labeled ligand 16 (cf. Table 3), considerably lower BRET signals compared to experiments carried out with 16 (data not shown) were obtained, which can be explained by the markedly higher fluorescence quantum yield of 16 compared to 18 (see Table 3). NanoBRET Y4R competition binding studies using 16 as labeled ligand are discussed below.

Fluorescence-Based Y4R Competition Binding

Using fluorescent ligand 16 as labeled probe, Y4R affinities of previously reported Y4R ligands (hPP, 5, 7 and UR-MEK388 or UR-MK188) were determined in flow cytometric, FA- and BRET-based binding assays (displacement curves shown in Figure 8). To note, the dimeric argininamide-type Y4R ligands UR-MEK388 and UR-MK188 represent enantiomers ((S,S)- and (R,R)-configuration, respectively) displaying almost equal Y4R affinity and Y4R antagonism (Ca2+ aequorin assay). (54) Additionally, the Y4R partial agonist UR-KK200 (35) was studied in the NanoBRET assay.
The obtained Y4R affinities of hPP were consistently lower than affinities determined in radiochemical assays (Table 7), with the lowest discrepancy (ca. one log unit) found in the case of the flow cytometric binding studies performed in DPBS. The lowest hPP affinity was determined in the NanoBRET-based competition binding assay, producing a shallow curve with a very low hill slope of −0.3 (Figure 8C). This shows that the insertion of Nluc into ECL2 affects the binding of hPP to Y4R. Similar to hPP, the obtained pKi values of the cyclic peptides 5 and 7 were lower by approximately 1 order of magnitude compared to reported pKi values determined in radioligand competition binding assays. The Y4R affinity of UR-KK200, determined in the NanoBRET assay, was in good agreement with the reported data (radiochemical assay). Y4R binding data, obtained for UR-MEK388 (flow cytometric and NanoBRET assays) were also in accordance with a reported pKi value determined in a flow cytometric competition binding assay using Sulfo-Cy5-labeled [K4]hPP as labeled ligand (Table 7). The Y4R affinity of UR-MK188, determined in the FA competition binding assay, was slightly higher compared to the reported binding data of UR-MK188. Generally, the lowest discrepancies between the determined and reported binding data of Y4R reference ligands were found for the NanoBRET assay. As 16 showed a complete dissociation from the Y4R only in the case of the NanoBRET assay, the incomplete dissociation observed in the flow cytometric and FA binding assay could be a reason for the observed discrepancies between reported Y4R affinities and binding data determined with 16 in flow cytometric and FA-based competition binding assays: to achieve a complete “displacement” of the fluorescent ligand 16, the competing ligand, incapable of displacing (pseudo)irreversibly bound 16 from the receptor, must be used at higher concentrations (compared to the situation where the labeled ligand shows full reversible binding), resulting in a higher receptor occupancy and thus effectively preventing binding of 16 to the receptor. This phenomenon was also clearly observed for radiolabeled muscarinic M2 receptor ligands showing different dissociation kinetics (reversible and (pseudo)irreversible binding): competition binding studies with reference ligands yielded consistently lower pKi values for the nonreversibly binding radioligand. (55)
Table 7. Overview of hY4R Binding Affinities of Y4R Reference Ligands Determined in Fluorescence-Based Competition Binding Assays Using 16 as Labeled Probe
 flow cytometryaFAbnanoBRETcliterature
 Na+ free137 mM Na+137 mM Na+140 mM Na+Na+ free137 mM Na+
cmpd.pKi
hPP8.5 ± 0.18.9 ± 0.18.0 ± 0.27.7 ± 0.110.02d10.1e
59.49 ± 0.079.15 ± 0.089.26 ± 0.048.89 ± 0.0610.48fn.a.
79.61 ± 0.068.8 ± 0.19.4 ± 0.19.07 ± 0.0710.5e9.79e
UR-KK200n.d.n.d.n.d.7.8 ± 0.18.92g7.99e
UR-MEK3886.29 ± 0.086.68 ± 0.09n.d.6.85 ± 0.056.58hn.a.
UR-MK188n.d.n.d.7.7 ± 0.1n.d.6.88h6.82g
6.18g
a

Determined at intact CHO-hY4R-Gqi5-mtAEQ cells; mean values ± SEM from three or four independent experiments performed in triplicate.

b

Determined at Y4RSwBac displaying BBVs; mean values ± SEM from three independent experiments performed in duplicate.

c

Determined at intact HEK293T-hY4R-NLuc(intraECL2) cells; mean values ± SEM from three or four independent experiments performed in triplicate.

d

Wirth et al. (37)

e

Gleixner et al. (31)

f

Konieczny et al. (30)

g

Kuhn et al. (reported Ki values were converted to pKi). (35)

h

Keller et al. (reported Ki values were converted to pKi). (54) Note: UR-MEK388 and UR-MK188 represent enantiomers exhibiting almost equal Y4R affinity. (54) n.a. not available.

Microscopy Studies

Y4R binding of 16 and 17 was visualized by confocal microscopy using intact CHO-hY4R-Gqi5-mtAEQ cells. Cellular uptake of both fluorescent probes was evident after already 10 min of incubation at 22 °C (Figure 9). After 30 min, the intracellular and plasma membrane-associated fluorescence was higher compared to 10 min after start of incubation, which is in agreement with the association kinetics determined by flow cytometry (Figure 5A). Notably, in the presence of an excess of hPP, almost no ligand′s fluorescence could be detected (unspecific binding, Figure 9). This indicates that the cellular uptake of the fluorescent ligands, which appear to be located in vesicles, is caused by Y4R-mediated endocytosis. Similar results were previously observed with the Sulfo-Cy5 labeled hPP derivative 1 studied with the same cells. (26)

Figure 9

Figure 9. Visualization of fluorescent ligand (16, 17) binding to CHO-hY4R-Gqi5-mtAEQ cells by confocal microscopy. Shown are representative images acquired after incubation of the cells with 16 or 17 (each 20 nM) at 22 °C for 10 and 30 min. Unspecific binding was determined in the presence of 1 μM hPP. Nuclei were stained with H33342 (2 μM). Fluorescence of 16 and 17 is shown in green and red, respectively. Fluorescence of H33342 is shown in blue. Scale bar: 10 μm.

High Resolution Image
Download MS PowerPoint Slide
Y4R binding of the Cy3B-labeled ligand 16 was also studied at transiently transfected SK-OV-3 cells using wide-field and TIRF microscopy. For these experiments, a lower concentration of 16 (1 nM), compared to confocal microscopy (20 nM), was used, resulting in a lower receptor occupancy. As also observed for binding of 16 to CHO-hY4R-Gqi5-mtAEQ cells (confocal microscopy), unspecific binding was very low (Figure 10A).

Figure 10

Figure 10. Visualization of binding of 16 to the hY4R transiently expressed by SK-OV-3 cells using wide-field and TIRF microscopy. (A) Wide-field fluorescence images acquired after incubation of the cells with 16 at 37 °C for 30 min. The two-color composite of individual focal planes after Z-stack deconvolution is shown with the green pseudocolor for 16 (561 nm excitation) and the blue pseudocolor for the nuclear stain channel (Hoechst 34580, 405 nm excitation). (B) Wide-field fluorescence and TIRF images of the same cells obtained after incubation of the cells with 16 (1 nM) at 37 °C for 30 min. Wide-field images were processed as under (A). In TIRF images, fluorescence of 16 is shown in white pseudocolor. Scale bar: 10 μm.

High Resolution Image
Download MS PowerPoint Slide
As an additional control, binding of 16 to nontransfected SK-OV-3 cells was investigated, also revealing very low unspecific binding. Thus, the fluorescence of 16 detected in the total binding samples represents ligand 16 bound to Y4R. The Y4R appeared to be largely associated with the plasma membrane of the cells (Figure 10A).
Using a higher magnification (60× objective), intracellular fluorescence could be detected (Figure 10B). In the TIRF images, also binding of the ligand to Y4R located in plasma membrane protrusions (filopodia) was visible. Notably, fluorescent ligand 16 proved to be sufficiently photostable and bright enough for single-molecule tracking studies by TIRF. This was demonstrated by binding of 16 to Y4R expressing SK-OV-3 cells using a low fluorescent ligand concentration of 0.1 nM (time lapse TIRF imaging sequence recorded at 30 Hz resolution; video, shown at double speed, is available as Supporting Information). Various diffusion modes could be observed along the particle tracks. Here, events of continuous confinement as well as transient confinement (when molecules diffused in a grid of impermeable barriers) were identified. The unconfined trajectories can be classified as having mostly random diffusion, except for the filopodia where directional diffusion with high linearity was observed. A deeper analysis of the trajectories is beyond the scope of this article.

Conclusions

Click to copy section linkSection link copied!
Conjugation of different fluorescent dyes to recently discovered small cyclic peptides, exhibiting high Y4R binding and selectivity, produced fluorescent Y4R ligands with unprecedented Y4R affinity (Ki, Kd < 1 nM). Notably, the cyclic peptides contained one or two Nω-carbamoylated arginines. These modified arginines were recently introduced as bioisosteric replacements of natural arginine in arginine-containing peptides enabling radio- and fluorescence labeling of bioactive peptides via arginine residues. (32,35,39,56,57) The present work further demonstrates the usefulness of Nω-carbamoylated arginines with respect to the design and preparation of labeled probes for peptidergic receptors. The study also suggests that a broad variety of fluorescent dyes and other bulky moieties can be attached to the cyclic peptides without marked impact on Y4R binding. Therefore, further tool compounds with high Y4R affinity and selectivity are conveniently accessible according to the presented strategy. The preparation of new fluorescent ligands might be of interest, for example, in improving the physicochemical properties (use of more polar fluorescent dyes) or an adjustment of the photophysical properties for the intended application. Nonetheless, the presented fluorescent probes are useful for the determination of Y4R binding affinities in fluorescence-based competition binding assays and, thus, could be used as tools in drug development programs aiming for therapeutics acting at Y4R.

Experimental Section

Click to copy section linkSection link copied!

Materials

The protected amino acids Fmoc-Tyr(tBu)–OH, Fmoc-Leu−OH, and Fmoc-Arg(Pbf)–OH were purchased from Carbolution Chemicals (St. Ingbert, Germany). HBTU, Fmoc-Sieber PS Resin, and PyBOP were obtained from Iris Biotech (Marktredwitz, Germany). Copper(II)sulfate pentahydrate, HOBt, sodium ascorbate, and Triton X-100 were from Sigma-Aldrich (Taufkirchen, Germany). NMP and DMF for peptide synthesis, anhydrous DMF, dichloromethane, piperidine, succinic anhydride, trifluoroacetic acid (TFA), and tetrahydrofuran were purchased from ACROS/Fisher Scientific (Schwerte, Germany). DIPEA was obtained from TCI (Eschborn, Germany). tert-Butyl (3-bromopropyl)carbamate (20) was from ABCR (Karlsruhe, Germany). Acetonitrile (high-performance liquid chromatography (HPLC) gradient grade) was from VWR (Ismaning, Germany). The fluorescent dye 13 (S0586, succinimidyl ester of S0223) was from FEW chemicals (Wolfen, Germany). Human pancreatic polypeptide (hPP) and porcine neuropeptide Y (pNPY) were purchased from Synpeptide (Shanghai, China). Bacitracin and bovine serum albumin (BSA) were obtained from Serva (Heidelberg, Germany). The Nluc substrate furimazine was purchased from Promega (Walldorf, Germany). Coelenterazine h was from BIOTREND (Köln, Germany). Zeocine and Puromycine were from Invivogen (San Diego, CA), Hygromycin B and propidium iodide were from Carl Roth (Karlsruhe, Germany) and Geneticine G418 was from Fisher Scientific (Schwerte, Germany). The Y2R antagonist BIIE0246 was obtained from Boehringer Ingelheim (Ingelheim, Germany). The syntheses of the Y1R antagonists BIBO3304 (41) and [3H]UR-MK299 (molar activity: 1.81 TBq/mmol), (33) and the synthesis of the Y4R ligands 4, (30) 5, (30) 6, (31) 7, (31) and [3H]UR-KK200 (molar activity: 0.98 TBq/mmol) (35) were described previously. [3H]Propionyl-pNPY (molar activity: 1.39 TBq/mmol) was prepared according to a previously reported procedure (33) with minor modifications that were described elsewhere. (40) Compounds 8 (32) and 9, (29) the fluorescent dyes 12 (Cy3B-SE), (38) 14 (Py-1), (58) and 22 (Py-5), (58) as well as the fluorescent dummy ligands 23 (38) and 24 (39) were prepared according to reported procedures. Millipore water was consistently used for the preparation of stock solutions, buffers, and aqueous eluents for HPLC. Polypropylene reaction vessels (1.5 and 2 mL) from Sarstedt (Nümbrecht, Germany) were used to keep stock solutions and for small-scale reactions (e.g., fluorescence labeling reactions and activation of Fmoc-protected amino acids for peptide synthesis).

NMR Spectroscopy

NMR spectra were recorded on a Bruker AVANCE 400 (1H, 400 MHz; 13C, 100 MHz) or on an AVANCE 600 instrument with cryogenic probe (1H: 600 MHz and 13C: 150 MHz) (Bruker, Karlsruhe, Germany). NMR spectra were calibrated based on the solvent residual peaks (1H NMR, DMSO-d6: δ = 2.50 ppm; 13C NMR: DMSO-d6: δ = 39.50 ppm), and data are reported as follows: 1H NMR: chemical shift δ in ppm (multiplicity [s = singlet, d = doublet, t = triplet, m = multiplet, and br s = broad singlet], integral, coupling constant J in Hz).

Mass Spectrometry

High-resolution mass spectrometry (HRMS) was performed with an Agilent 6540 UHD accurate-mass quadrupole time-of-flight (Q-TOF) liquid chromatography/mass spectrometry (LC/MS) system coupled to an Agilent 1290 analytical HPLC system (Agilent Technologies. Santa Clara, CA) using an ESI source and the following LC method: column: Luna Omega C18, 1.6 μm, 50 mm × 2.1 mm (Phenomenex, Aschaffenburg, Germany), column temperature: 40 °C, solvent/linear gradient: 0–4 min: 0.1% aqueous HCOOH/acetonitrile supplemented with 0.1% HCOOH 95:5–2:98, 4–5 min: 2:98, flow: 0.6 mL/min.

Preparative HPLC

Preparative HPLC was performed with a system from Knauer (Berlin, Germany) consisting of two K-1800 pumps and a K-2001 detector (in the following referred to as “system 1”) or with a Prep 150 LC system from Waters (Eschborn, Germany) comprising a Waters 2545 binary gradient module, a Waters 2489 UV/vis detector, and a Waters fraction collector III (in the following referred to as “system 2”). A Gemini NX-C18, 5 μm, 250 mm × 21 mm (Phenomenex) was used as a reversed-phase (RP) column at a flow rate of 20 mL/min using mixtures of 0.1% aqueous TFA and acetonitrile as the mobile phase. A detection wavelength of 220 nm was used throughout. Collected fractions were lyophilized using a Scanvac CoolSafe 100–9 freeze-dryer (Labogene, Allerød, Denmark) equipped with an RZ 6 rotary vane vacuum pump (Vacuubrand, Wertheim, Germany).

Analytical HPLC

Analytical HPLC analysis was performed with a system from Agilent Technologies composed of a 1290 Infinity binary pump equipped with a degasser, a 1290 Infinity autosampler, a 1290 Infinity thermostated column compartment, a 1260 Infinity diode array detector, and a 1260 Infinity fluorescence detector. A Kinetex-XB C18, 2.6 μm, 100 mm × 3 mm (Phenomenex) served as the stationary phase at a flow rate of 0.6 mL/min. Detection was performed at 220 nm, and the oven temperature was 25 °C. Mixtures of 0.04% aqueous TFA (A) and acetonitrile (B) were used as mobile phase. The following linear gradients were applied: for compounds 11 and 19: 0–14 min: A/B 90:10–70:30, 14–16 min: 70:30–5:95, 16–20 min: 5:95 (isocratic); for compounds 16–18: 0–14 min: A/B 90:10–65:35, 14–16 min: 65:35–5:95, 16–20 min: 5:95 (isocratic). The injection volume was 20 μL. Retention (capacity) factors k were calculated from the retention times tR according to k = (tR – t0)/t0 (t0 = dead time, 0.76 min for the system, column, and flow rate mentioned above).

Compound Characterization

The linear precursor peptide 10, synthesized by solid-phase peptide synthesis, was characterized by HRMS. Peptide 11 was characterized by HRMS, 1H NMR spectroscopy, and RP-HPLC. The azido-functionalized fluorescent dye 15 was characterized by HRMS and 1H NMR spectroscopy. The fluorescent ligands 16–19 were characterized by HRMS and RP-HPLC. HPLC purities of all target compounds were ≥95% (UV detection, 220 nm).

Synthesis of Peptide 11 and the Fluorescent Ligands 16–19

Nα-Succinyl-Nω[hex-5-ynylaminocarbonyl]-Arg-Tyr-Nω-[(aminobutyl)aminocarbonyl] Arg-Leu-Arg-Tyr-Amide Tetrakis(hydrotrifluoroacetate) (10)
Peptide 10 was synthesized on a Fmoc-Sieber PS resin (100 mg, 0.59 mmol/g) by manual Fmoc strategy SPPS using DMF/NMP (both anhydrous) 4:1 v/v as solvent. 5 mL NORM-JECT syringes (B. Braun Melsungen, Melsungen, Germany), equipped with a 35 μm polypropylene frit (Roland Vetter Laborbedarf, Ammerbuch, Germany), were used as reaction vessels. The resin was allowed to swell in solvent for 45 min at room temperature followed by initial Fmoc deprotection using a 20% piperidine solution in DMF/NMP 4:1 v/v (2 × 20 min at rt). The contained standard Fmoc amino acids (Tyr, Arg, Leu) were used in 5-fold excess and preactivated with HOBt/HBTU/DIPEA (5/4.9/10 equiv) in solvent (about 2.2 mL/mmol aa) for at least 5 min before addition to the resin. For the activation of building blocks 8 and 9, used in 3-fold excess, HBTU/HOBt/DIPEA (3/3/6 equiv) were used. Amino acid coupling was carried out on a shaker (Heidolph Multi Reax; Heidolph Instruments, Schwabach, Germany) covered with a thermostat-controlled (38 °C) box. In the case of standard (proteinogenic) amino acids, “double” coupling (2 × 45 min) was performed. Arginine derivatives 8 and 9 were attached by a single coupling procedure (16 h). After coupling, Fmoc deprotection was carried out using a 20% piperidine solution in DMF/NMP 4:1 v/v for 2 × 10 min at rt. The resin was washed 6 times with about 1 mL of solvent after Fmoc deprotection and 4 × 1 mL after amino acid coupling. After coupling of the last amino acid and subsequent Fmoc deprotection, the resin was treated with a solution of succinic anhydride (52.3 mg, 0.443 mmol) and DIPEA (77.1 μL, 0.443 mmol) in DMF/NMP 80:20 v/v (500 μL) at 35 °C for 30 min. The resin was washed with DMF/NMP 4:1 v/v (6×) and CH2Cl2 (3×), followed by cleavage off the resin. For this, a mixture of trifluoroacetic acid (TFA) and DCM (3:1 v/v) was added to the resin and the mixture was shaken for 20 min. The fluid was collected in a 100 mL round-bottom flask, and the procedure was repeated once. The resin was afterward washed 3 times with cleavage solution, and the volatiles were removed in vacuo. Full side-chain deprotection was carried out with 95% aq. TFA (2 mL) for 5 h at rt. The reaction mixture was concentrated in vacuo, then water (40 mL) was given to the mixture, followed by lyophilization. Purification by preparative HPLC (system 1, gradient: 0–18 min: 0.1% aq TFA/acetonitrile 95:5–55:45, tR = 15 min) yielded 10 as a white fluffy solid (37.65 mg, 37%). HRMS (ESI): m/z [M + 2H]2+ calcd. for [C58H93N19O13]2+ 631.8595, found: 631.8616. C58H91N19O13·C8H4F12O8 (1262.49 + 456.09).
(9S,12S,15S,E)-4-Amino-N-{(S)-1-[((S)-1-{[(S)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl]amino}-5-guanidino-1-oxopentan-2-yl)amino]-4-methyl-1-oxopentan-2-yl}-15-{3-[(E)-2-(hex-5-yn-1-ylcarbamoyl)guanidino]propyl}-12-(4-hydroxybenzyl)-2,11,14,17,20-pentaoxo-1,3,5,10,13,16,21-heptaazacyclopentacos-3-ene-9-carboxamide Tris(hydrotrifluoroacetate) (11)
Peptide 10 (8.89 mg, 7.13 μmol) was dissolved in anhydrous DMF (5.7 mL), a solution of HOBt (2.89 mg, 21.4 μmol) in DMF (0.6 mL) and DIPEA (7.5 μL, 42.8 μmol) were added and the mixture was stirred at rt for 5 min. A solution of PyBOP (11.1 mg, 21.4 μmol) in DMF (0.8 mL) was added dropwise and stirring was continued at rt for 16 h. 1% aqueous TFA (10 mL) was added and the product was purified by preparative HPLC (system 1, gradient: 0–18 min: 0.1% aq TFA/acetonitrile 95:5–55:45, tR = 16 min) to yield 11 as a white fluffy solid (2.39 mg, 21%) 1H NMR (600 MHz, DMSO-d6): δ (ppm) 0.82–0.91 (m, 6H), 1.33–1.49 (m, 12H), 1.49–1.59 (m, 7H), 1.59–1.70 (m, 3H), 1.70–1.79 (m, 1H), 2.15–2.2 (m, 2H), 2.29–2.41 (m, 3H), 2.68–2.74 (m, 1H), 2.74–2.81 (m, 2H), 2.81–2.89 (m, 2H), 2.89–2.97 (m, 1H), 3.02–3.08 (m, 3H), 3.09–3.14 (m, 3H), 3.17–3.21 (m, 3H), 3.28–3.32 (m, 3H), 4.05–4.12 (m, 1H), 4.16–4.23 (m, 1H), 4.25–4.42 (m, 4H), 6.44–6.59 (br s, 1H), 6.61–6.68 (m, 4H), 6.68–6.96 (br s, 2H), 6.95–7.03 (m, 4H), 7.04–7.07 (m, 1H), 7.09–7.48 (br s, 2H, interfering with the next listed signal), 7.35 (s, 1H), 7.50 (t, 1H, J 5.4 Hz), 7.54–7.62 (m, 2H), 7.75 (d, 1H, J 7.9 Hz), 7.83 (d, 1H, J 7.5 Hz), 7.87–7.94 (m, 2H), 7.97 (d, 1H, J 7.3 Hz), 8.05–8.11 (m, 1H), 8.11–8.21 (m, 1H), 8.23–8.6 (m, 3H), 8.95 (s, 1H), 9.09–9.25 (m, 3H), 9.85 (s, 1H), 10.0 (s, 1H). HRMS (ESI): m/z [M + 3H]3+ calcd. for [C58H92N19O12]3+ 415.5719, found: 415.5725 RP-HPLC (220 nm): 98% (tR = 10.7 min, k = 13.0). C58H89N19O12·C6H3F9O6 (1244.47 + 342.07).
24-{5-[(4-{[(9S,12S,15S,19R,E)-4-Amino-9-({(S)-1-[((S)-1-{[(S)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl]amino}-5-guanidino-1-oxopentan-2-yl)amino]-4-methyl-1-oxopentan-2-yl}carbamoyl)-15-(3-guanidinopropyl)-12-(4-hydroxybenzyl)-2,11,14,17,20-pentaoxo-1,3,5,10,13,16,21-heptaazacyclopentacos-3-en-19-yl]amino}-4-oxobutyl)amino]-5-oxopent-1-yn-1-yl}-5,5,27,27-tetramethyl-16-oxa-20-aza-12-azoniaheptacyclo[15.11.0.03,15.04,12.06,11.020,28.021,26]octacosa-1(28),2,4(12),6(11),7,9,21(26),22,24-nonaene-8-sulfonate Bis(hydrotrifluoroacetate) (16)
Peptide 6 (1.05 mg, 0.626 μmol) was dissolved in anhydrous DMF (100 μL) followed by the addition of DIPEA (0.88 μL, 5.00 μmol). A solution of 12 (0.49 mg, 0.626 μmol) in DMF (64 μL) was added, and the mixture was shaken at rt in the dark for 1.5 h. 100 μL of 1% aqueous TFA were added and the mixture was subjected to preparative HPLC (system 1, gradient: 0–20 min: 0.1% aq TFA/acetonitrile 90:10–50:50, tR = 11 min) to yield 16 as a purple fluffy solid (0.40 mg, 35%). HRMS (ESI): m/z [M + 2H]2+ calcd. for [C89H122N22O17S]2+ 901.9548, found: 901.9555 RP-HPLC (220 nm): 99% (tR = 10.4 min, k = 12.7). C89H120N22O17S·C4H2F6O4 (1802.14 + 228.04).
4-(2-{(1E,3E)-5-[(E)-1-(6-{[4-({(9S,12S,15S,19R,E)-4-Amino-9-[((S)-1-{[(S)-1-({(S)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl}amino)-5-guanidino-1-oxopentan-2-yl]amino}-4-methyl-1-oxopentan-2-yl)carbamoyl]-15-(3-guanidinopropyl)-12-(4-hydroxybenzyl)-2,11,14,17,20-pentaoxo-1,3,5,10,13,16,21-heptaazacyclopentacos-3-en-19-yl}amino)-4-oxobutyl]amino}-6-oxohexyl)-3,3-dimethyl-5-sulfoindolin-2-ylidene]penta-1,3-dien-1-yl}-3,3-dimethyl-3H-indol-1-ium-1-yl)butane-1-sulfonate Bis(hydrotrifluoroacetate) (17)
Peptide 6 (1.05 mg, 0.626 μmol) was dissolved in anhydrous DMF (100 μL) followed by the addition of DIPEA (0.88 μL, 5.00 μmol). A solution of 13 (0.50 mg, 0.626 μmol) in DMF (100 μL) was added, and the mixture was shaken at rt in the dark for 1.5 h. 100 μL of 1% aqueous TFA were added and the mixture was subjected to preparative HPLC (system 1, gradient: 0–20 min: 0.1% aq TFA/acetonitrile 90:10–50:50, tR = 12 min) affording 17 as a blue fluffy solid (0.82 mg, 70%). HRMS (ESI): m/z [M + 2H]2+ calcd. for [C90H132N22O19S2]2+ 944.4735, found: 944.4747. RP-HPLC (220 nm): 96% (tR = 11.6 min, k = 14.3). C90H130N22O19S2·C4H2F6O4 (1888.29 + 228.04).
1-{4-[((9S,12S,15S,19R,E)-4-Amino-9-{[(S)-1-({(S)-1-[((S)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl)amino]-5-guanidino-1-oxopentan-2-yl}amino)-4-methyl-1-oxopentan-2-yl]carbamoyl}-15-(3-guanidinopropyl)-12-(4-hydroxybenzyl)-2,11,14,17,20-pentaoxo-1,3,5,10,13,16,21-heptaazacyclopentacos-3-en-19-yl)amino]-4-oxobutyl}-2,6-dimethyl-4-[(E)-2-(2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yl)vinyl]pyridin-1-ium Bis(hydrotrifluoroacetate) Trifluoroacetate (18)
Peptide 6 (1.63 mg, 0.97 μmol) was dissolved in anhydrous DMF (150 μL) followed by the addition of DIPEA (1.1 μL, 6.31 μmol), the addition of a solution of 14 (0.47 mg, 1.16 μmol) in DMF (15 μL) and shaking of the mixture at rt in the dark for 2 h. 100 μL of 1% aqueous TFA were added, and the mixture was subjected to preparative HPLC (system 1, gradient: 0–20 min: 0.1% aq TFA/acetonitrile 90:10–50:50, tR = 14 min) to yield 18 as a red fluffy solid (0.61 mg, 34%). HRMS (ESI): m/z [M+ + 3H]4+ calcd. for [C76H113N21O12]4+ 377.9714, found: 377.9727. RP-HPLC (220 nm): 97% (tR = 13.1 min, k = 16.2). C76H110N21O12+·C6H2F9O6– (1508.86 + 341.06).
1-{3-[4-(4-{3-[(E)-Amino({3-[(9S,12S,15S,E)-4-amino-9-({(S)-1-[((S)-1-{[(S)-1-amino-3-(4-hydroxyphenyl)-1-oxopropan-2-yl]amino}-5-guanidino-1-oxopentan-2-yl)amino]-4-methyl-1-oxopentan-2-yl}carbamoyl)-12-(4-hydroxybenzyl)-2,11,14,17,20-pentaoxo-1,3,5,10,13,16,21-heptaazacyclopentacos-3-en-15-yl]propyl}amino)methylene]ureido}butyl)-1H-1,2,3-triazol-1-yl]propyl}-4-{(1E,3E)-4-[4-(dimethylamino)phenyl]buta-1,3-dien-1-yl}-2,6-dimethylpyridin-1-ium Bis(hydrotrifluoroacetate) Trifluoroacetate (19)
Peptide 11 (0.84 mg, 0.53 μmol) was dissolved in H2O (190 μL). A solution of copper(II)sulfate pentahydrate (0.2 mg, 0.64 μmol) in H2O (30 μL), a solution of sodium ascorbate (0.36 mg, 1.59 μmol) in H2O (30 μL) and a solution of 15 (0.25 mg, 0.53 μmol) in NMP (70 μL) were added followed by the addition of 180 μL of NMP to adjust the ratio of the solvents (H2O/NMP) to 1:1 v/v (final volume: ca. 500 μL). The mixture was shaken at rt in the dark for 2 h. 100 μL of 1% aqueous TFA were added, and the mixture was subjected to preparative HPLC (system 1, gradient: 0–20 min: 0.1% aq TFA/acetonitrile 80:20–50:50, tR = 9 min) to yield 19 as a red fluffy solid (0.29 mg, 27%). HRMS (ESI): m/z [M+ + 3H]4+ calcd. for [C80H120N24O12]4+ 402.2374, found: 402.2380. RP-HPLC (220 nm): 95% (tR = 13.7 min, k = 17.0). C80H117N24O12+·C6H2F9O6– (1606.97 + 341.06).

Chemical Stability

The chemical stability of the fluorescent ligands 16, 17, and 18 was investigated in PBS (adjusted to pH 7.4) at 22 °C. The incubation was started by the addition of 7.5 μL of a 2 mM stock solution (solvent: DMSO/H2O 1:1 v/v) to 142.5 μL of PBS (in the case of compound 18 supplemented with 10% DMSO due to solubility reasons) to yield a concentration of 100 μM. After time periods of 0, 6, and 48 h, an aliquot (25 μL) was withdrawn and added to 25 μL of acetonitrile/0.04% aq. TFA 1:9 v/v to obtain a peptide solution with a concentration of 50 μM. 20 μL of this solution were subjected to analytical RP-HPLC analysis using the same system and conditions as described under Analytical HPLC, but applying a different linear gradient: 0–14 min: A/B 90:10–45:55, 14–15 min: 45:55–5:95, 15–19 min: 5:95 (isocratic). A 1:1 mixture of PBS and acetonitrile/0.04% aq. TFA 1:9 v/v (20 μL) was analyzed to obtain the blank chromatogram.

Fluorescence Excitation and Emission Spectra

Excitation and emission spectra were recorded with a Cary Eclipse spectrofluorimeter (Varian, Mulgrave, Victoria, Australia) using polystyrene cuvettes (10 mm × 10 mm, reference 1961, Kartell, Noviglio, Italy). Sample solutions (2 mL) were prepared in the cuvettes. Spectra in PBS (pH 7.4) and PBS supplemented with 1% BSA were obtained for all fluorescent ligands (16–19) using the following concentrations: 6 μM for 19, 5 μM for 18 (in PBS), and 1 μM for 16, 17, and 18 (in PBS with 1% BSA). Excitation spectra (cf. Figure S7) were recorded with spectral bandwidths of 5 nm (excitation slit) and 10 nm (emission slit). The spectral bandwidth applied for the emission spectra was 10 nm (excitation slit) and 5 nm (emission slit). Net spectra were obtained by subtracting the respective reference spectrum of a vehicle sample.

Determination of Fluorescence Quantum Yields

The fluorescence quantum yield of compound 19 was determined following a reported procedure using the aforementioned Cary Eclipse spectrofluorimeter for the measurement of emission spectra and a Lambda 650 UV/vis spectrophotometer (PerkinElmer, Waltham, MA) for the measurement of absorption spectra. (41) The concentration of 19 was 6 μM and cresyl violet perchlorate (Acros Organics, Geel, Belgium) was used as reference compound (concentration: 2 μM). The excitation wavelength was set close to the absorption maximum (500 nm for 19 in PBS, 515 nm for 19 in PBS with 1% BSA). Emission spectra of cresyl violet perchlorate in EtOH were recorded at an excitation wavelength of 575 nm. Sample solutions (2 mL) were prepared in polystyrene cuvettes (10 mm × 10 mm), immediately followed by measurement of the emission spectra, transfer of the solutions into acryl cuvettes (10 mm × 10 mm, reference 67.755, Sarstedt), and measurement of the absorption spectra. Emission spectra were recorded for the spectral bandwidth settings (excitation/emission) of 10/5 and 10/10 nm. The obtained quantum yields were averaged.
The fluorescence quantum yield of compounds 16–18 was determined via an absolute method using an Ulbricht sphere with an inaccuracy of ca. 3% (Hamamatsu C9920–02 system equipped with a Spectralon integrating sphere) at room temperature (23 ± 1 °C). The optical density at the excitation wavelength of the sample was <0.1 (optical path length: 1 cm). Samples were measured in a 10 mm × 10 mm quartz cuvette.

Cell Culture

Cells were cultured in T75 or T175 tissue culture flasks (Sarstedt, Nümbrecht, Germany) in a humidified atmosphere (95% air, 5% CO2) at 37 °C. SK-N-MC neuroblastoma cells (obtained from the American Type Culture Collection, ATCC HTB-10) were maintained in EMEM (Sigma) supplemented with 5% FBS. CHO-hY2R cells (obtained from PerkinElmer, Rodgau, Germany) were cultured in Ham’s F-12 supplemented with 5% FBS and G418 (400 μg/mL). CHO-hY4-Gqi5-mtAEQ cells (25) were cultured in HAM’s F-12 (Sigma) supplemented with 10% FBS, hygromycin (400 μg/mL), zeocin (250 μg/mL) and G418 (400 μg/mL). HEC-1B-hY5R cells (59) were maintained in EMEM supplemented with 5% FBS and G418 (400 μg/mL). HEK293T-NlucN-mGsi/Y4R-NlucC cells (37) were cultured in DMEM (Sigma) supplemented with 10% FBS, puromycin (1 μg/mL), and G418 (600 μg/mL). HEK293T-CAMYEN-hY4R cells (31) were cultured in DMEM supplemented with 10% FBS, zeocin (100 μg/mL), and G418 (600 μg/mL). Human SK-OV-3 ovarian adenocarcinoma cells (obtained from the American Type Culture Collection, ATCC HTB-77) were maintained in McCoy’s 5A Medium (Corning) supplemented with 10% FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin.

Molecular Cloning

All enzymes and reagents used for cloning were obtained from New England Biolabs (Frankfurt am Main, Germany) unless stated otherwise. Plasmids were generated using standard restriction cloning techniques, in detail: the plasmid pcDNA3.1-Nluc-hY4R encoding the N-terminally Nanoluciferase-tagged human NPY Y4 receptor, was cloned by exchanging the receptor-encoding sequence in Nluc-hH4R (in pcDNA3.1) (60) with the sequence of the hY4R. Therefore, the nucleotide sequence for the hY4R was first amplified from pcDNA3.1-hY4R (obtained from Missouri cDNA Research Center, Rolla, MO) via polymerase chain reaction (PCR, using Phusion High Fidelity Polymerase according to the manufacturer’s instructions) attaching flanking BamHI and ApaI to the 5′ and 3′ ends, respectively. Sequences of the used primers were as follows: forward, CTGAGGATCCATGAACACCTCTCACCTC; reverse, GACTGGGCCCGAAATGGGATTGGACCTGCCAC. After a PCR purification step using the FastGene Gel/PCR Extraction Kit (Nippon Genetics, Düren, Germany), both the purified PCR product and the target plasmid Nluc-hH4R were subjected to a restriction digest using BamHI and ApaI restriction enzymes overnight at 37 °C. Restriction digests were gel purified, ligated using T4 DNA ligase at room temperature for 1 h, and transformed into Top10F′ Escherichia coli (made competent in house).
For the plasmid pcDNA3.1-hY4R-Nluc(intraECL2), which encodes the Y4R with Nluc in the second extracellular loop (inserted via short glycine-serine linkers after the leucine in position 195 (L195)), pcDNA3.1-hY4R served as a vector backbone and pcDNA3.1-Nluc-Y1R(Y192) (51) was used to extract the Nluc insert. First, pcDNA3.1-hY4R was linearized after L195 via PCR adding flanking BamHI (5′ end of the linearized vector) and SacI (3′ end of the linearized vector; note: the SacI restriction site was incorporated into a -SGGGGSS- linker sequence) restriction sites using the aforementioned Phusion polymerase. Sequences of the used primers were as follows: forward: GATCGGATCCGCAGATAAGGTGGTCTGTAC; reverse: GATCAGAGCTCCCTCCACCGCCACTCAGGAACTCCAGAGCCTTG. Next steps were performed as described above: After a PCR cleanup, the purified PCR product and the pcDNA3.1-Nluc-Y1R(Y192) (used to excise the Nluc insert) were subjected to a restriction digest using BamHI and SacI restriction enzymes at 37 °C overnight. Restriction digests were gel purified, ligated, and transformed into competent E. coli, as described above. Plasmids were extracted from bacterial overnight cultures (Miniprep Kit, Nippon Genetics, Düren, Germany) and all sequences were verified by Sanger Sequencing (Eurofins Genomics, Ebersberg, Germany).
Plasmids used to prepare MultiBac(Mam) baculoviruses, (61) were generated according to the ACEMBL technology concept. (62) Acceptor and donor plasmids, used to prepare multicomponent DNA constructs, were joined by the Cre-LoxP fusion reaction. The hY4R-Nluc sequence from pcDNA3.1-hY4R-NlucC (37) (note: NlucC, fused to the C-terminus of Y4R, stands for the C-terminal fragment of Nluc consisting of 11 amino acids) was recloned into the pIMACE-CMVintP10 vector. This vector was obtained by replacing the insect polyhedrin promoter in pACEBac1 (Geneva Biotech, Pregny-Chambésy, Switzerland) with dual-host (insect/mammalian) CMVintP10 promotor taken from pSPL-IM vector (Geneva Biotech). For this purpose, pACEBac1 and pSPL-IM were both digested with the FastDigest restriction enzymes Bsu15I and XmaJI (Thermo Fisher Scientific) according to the manufacturer’s instructions. Restriction digests were gel purified using the FavorPrep Gel/PCR Purification Kit (Favorgen, Vienna, Austria), ligated by T4 DNA ligase (Thermo Fisher Scientific) at 22 °C for 1 h, and transformed into DH5α E. coli (made competent in house). After selection with gentamycin (MP Biomedicals, Eschwege, Germany), plasmids were extracted from overnight bacterial cultures (FavorPrep Plasmid DNA Extraction Kit). The resulting pIMACE-CMVintP10 was digested with HindIII and ScaI and pcDNA3.1-hY4R-Nluc was digested with HindIII and MssI to obtain the acceptor plasmid pIMACE-CMVintP10-hY4R-Nluc after gel purification and ligation. Depending on the targets of further use (mammalian, insect, or insect with mammalian-like glycosylation expression system), the acceptor plasmid pIMACE-CMVintP10-hY4R-Nluc was subjected to different types of recombination.
To obtain baculoviruses used for hY4R transduction into human SK-OV-3 ovarian adenocarcinoma cells, the acceptor plasmid pIMACE-CMVintP10-hY4R-Nluc was recombined with the donor plasmid pIDC-VSVG using Cre recombinase (New England Biolabs) and the product was propagated in pirHC E. coli strain (Geneva Biotech) under selection pressure of gentamycin and chloramphenicol (Sigma). Pseudotyping of baculovirions with vesicular stomatitis virus G-protein (VSVG) has been reported to enhance the transduction efficiency of mammalian cells by these baculoviruses. The donor plasmid pIDC-VSVG was obtained by inserting VSVG from the pUCDM-VSVG vector (Geneva Biotech) into the pIDC vector (Geneva Biotech): pIDC was digested with RruI and XmaJI, and pUCDM-VSVG was digested with MssI and XmaJI. After the cre-recombination step, the resulting multicomponent construct pIMACE-CMVintP10-hY4R-Nluc × pIDC-VSVG was subjected to restriction analysis and used for transposition into baculovirus genomes presented as bacterial artificial chromosomes in E. coli cells (DH10MultiBac, Geneva Biotech) to generate baculovirus Y4RVSVG.
To create Y4R baculoviruses for the expression of hY4R in Sf9 insect cells, pIMACE-CMVintP10-hY4R-Nluc was directly used for transposition into DH10MultiBac. To mimic the mammalian-like pattern of protein glycosylation in Sf9 cells, another type of baculovirus, encoding for Y4RSwBac, was prepared. For this purpose, the acceptor plasmid pIMACE-CMVintP10-hY4R-Nluc was recombined with the donor plasmid pIDC-SweetBac. This plasmid was obtained by recloning the SweetBac module (49) from pUDCM-GntII-GalT plasmid (Geneva Biotech) into the pIDC backbone: pUDCM-GntII-GalT was digested with MssI and XmaJI, and pIDC was digested with RruI and XmaJI. As before, the generated multicomponent construct pIMACE-CMVintP10-hY4R-Nluc × pIDC-SweetBac was restriction analyzed and used for transposition into DH10MultiBac.

Generation of the Stable HEK293T-Nluc-hY4R and HEK293T-hY4R-Nluc(intraECL2) Cell Lines

HEK293T cells were seeded into a 6-well dish in DMEM supplemented with 10% FBS at 300,000 cells/mL. The following day, cells were transfected with 2 μg of pcDNA3.1-Nluc-hY4R or pcDNA3.1-hY4R-NLuc(intraL195) using the XtremeGene HP transfection reagent (Merck, Darmstadt, Germany) according to the manufacturer’s protocol. Cells were passaged after 48 h into a T175 culture flask and selected for 2 weeks at a high G418 concentration (1000 μg/mL). The culture medium was changed three times in this time period and the cells were regularly monitored for colonial growth. Starting with the observation of the latter, cells were cultured in DMEM supplemented with 10% FBS and 600 μg/mL G418 for maintained selection pressure.

Buffers and Media Used for Binding and Functional Assays

Buffer I (used for radiochemical (Y2R, Y4R) and flow cytometric (Y4R) binding experiments): a hypotonic sodium-free HEPES buffer (25 mM HEPES, 2.5 mM CaCl2, 1 mM MgCl2, adjusted to pH 7.4 using 25% ammonia in water) supplemented with 1% BSA (Serva, Heidelberg, Germany) and 0.1 mg/mL bacitracin (Serva).
Buffer II (used for binding experiments at the Y1R and Y5R): an isotonic sodium-containing HEPES buffer (10 mM HEPES, 150 mM NaCl, 25 mM NaHCO3, 2.5 mM CaCl2, 5 mM KCl, pH 7.4) supplemented with 1% BSA.
Buffer III (used for the Ca2+ aequorin assay): an isotonic sodium-containing HEPES buffer (25 mM HEPES, 120 mM NaCl, 1.5 mM CaCl2, 1 mM MgCl2, 5 mM KCl, 10 mM d-glucose, pH 7.4).
DPBS (used for flow cytometric and fluorescence anisotropy-based Y4R binding assays): Dulbecco’s phosphate-buffered saline with calcium and magnesium (1.8 mM CaCl2, 2.68 mM KCl, 1.47 mM KH2PO4, 3.98 mM MgSO4, 137 mM NaCl, 8.06 mM Na2HPO4, pH 7.4) supplemented with 1% BSA and 0.1 mg/mL bacitracin (flow cytometry) or with 0.1% Pluronic F-127 and cOmplete EDTA-free Protease Inhibitor Cocktail (fluorescence anisotropy).
L15-HEPES (used for miniGsi recruitment, cAMP CAMYEN and NanoBRET binding assays): Leibovitz’s L-15 medium (140 mM NaCl, 1.3 mM CaCl2, 1 mM MgCl2, various amino acids and vitamins) (Fisher Scientific, Schwerte, Germany) supplemented with 10 mM HEPES and additionally with 5% FBS (miniGsi recruitment and cAMP CAMYEN assays) or 1.5% BSA (NanoBRET). Before the addition of FBS and BSA, the pH was adjusted to 7.4.

Radioligand Binding Assays

All radioligand binding assays were performed at intact Y receptor expressing cells at 23 ± 2 °C. The radiochemical competition binding assays, used to study Y1, Y2, Y4, and Y5 receptor binding of peptide 11, and fluorescent ligands 16–19, were recently validated by the determination of binding affinities of the reference ligands pNPY (Y1R, Y2R, and Y5R) and hPP (Y4R), which were in good agreement with previously reported binding affinities (for determined and reference pKi or Ki values of pNPY (Y1R, Y2R, Y5R), see Konieczny et al.; (30) for determined and reference pKi values of hPP (hY4R), see Gleixner et al. (31)).

Y1R Binding

Competition binding assays at Y1R-expressing SK-N-MC neuroblastoma cells were performed as previously described using [3H]UR-MK299 as radioligand (concentration: 0.15 nM). (33) Due to low radioligand displacement, no curve fitting was performed for the investigated compounds 11 and 17–19 (studied at concentrations up to 10 μM for 11 and 3 μM for 17–19). For compound 16, binding data (dpm) were normalized (100% = bound radioligand in the absence of competitor; 0% = unspecific binding), plotted as % over log(concentration of competitor, M), and analyzed by a four-parameter logistic fit (log(inhibitor) vs response–variable slope; GraphPad Prism 5, GraphPad Software, San Diego, CA) to obtain pIC50 and IC50 values, which were converted to pKi and Ki values according to the Cheng–Prusoff equation (63) (logarithmic form in the case of pKi values).

Y2R Binding

Competition binding assays at CHO-hY2R cells were performed as previously described using [3H]propionyl-pNPY (Kd = 0.14 nM, concentration: 0.5 nM) as radioligand. (34) Due to low radioligand displacement, no curve fitting was performed for the investigated compounds 11 and 16–19 (studied at concentrations up to 10 μM for 11 and 3 μM for 16–19).

Y4R Binding

Competition binding experiments at CHO-hY4R-Gqi5-mtAEQ cells using [3H]UR-KK200 as radioligand (Kd = 0.67 nM, concentration: 1.0 nM) (35) were performed as previously described. (30) Binding data (dpm) were normalized (100% = bound radioligand in the absence of competitor; 0% = unspecific binding), plotted as % over log(concentration of competitor, M), and analyzed by a four-parameter logistic fit (log(inhibitor) vs response–variable slope; GraphPad Prism 5) to obtain pIC50 and IC50 values, which were converted to pKi and Ki values according to the Cheng–Prusoff equation (63) (logarithmic form in the case of pKi values).

Y5R Binding

Competition binding studies at HEC-1B-hY5R cells using [3H]propionyl-pNPY (Kd = 11 nM, (26) concentration: 5 nM) as radioligand were performed as previously reported. (35) Due to low radioligand displacement, no curve fitting was performed for the investigated compounds 11, 17, and 19 (studied at concentrations up to 10 μM for 11, 3 μM for 17, and 1 μM for 19). For compounds 16 and 18, binding data (dpm) were normalized (100% = bound radioligand in the absence of competitor; 0% = unspecific binding), plotted as % over log(concentration of competitor, M), and analyzed by a four-parameter logistic fit (log(inhibitor) vs response–variable slope; GraphPad Prism 5) to obtain pIC50 and IC50 values, which were converted to pKi and Ki values according to the Cheng–Prusoff equation (63) (logarithmic form in the case of pKi values).

Functional Y4R Assays

All functional assays were performed in agonist mode as all studied compounds exhibit Y4R agonistic activity.

Y4R Ca2+ Aequorin Assay

The assay was performed with live CHO-hY4R-Gqi5-mtAEQ cells as previously described (used buffer: buffer III). Measurements were carried out on a Tecan Infinite Lumi plate reader. Data analysis was performed as reported using GraphPad Prism 5 for the calculation of the area under the curve. Fractional luminescences, obtained by dividing the area of the initially occurring agonist-induced peak by the total area (sum of the areas of the agonist-induced peak and the subsequent lysis-induced peak), were normalized (100% = fractional luminescence obtained from 1 μM hPP, 0% = fractional luminescence obtained by vehicle addition (basal effect), GraphPad Prism 5). The normalized responses were plotted against log(concentration of agonist, M) and the data were fitted according to a four-parameter logistic equation (log(agonist) vs response–variable slope, GraphPad Prism 5) to obtain pEC50 values, which were converted to EC50 values. Efficacies Emax correspond to the upper plateaus of the normalized concentration–response curves.

Y4R miniGsi Recruitment Assay

The assay was performed with live HEK293T-NlucN-mGsi/Y4R-NlucC cells using a reported protocol with a minor modification: (37) on the day of the experiment, cells were not washed with FBS-free medium, i.e., the assay was performed in L15-HEPES supplemented with 5% FBS. Furimazine was used as nanoluciferase substrate. The original stock was diluted 1:1000 in L15-HEPES to obtain the feed solution for the assay. Data analysis was performed based on the areas under the curves (time window: 45 min starting with the agonist addition) using GraphPad Prism 5. Normalized responses (100% = response induced by 1 μM hPP, 0% = vehicle control) were plotted against log(concentration of agonist, M) and the data were fitted according to a four-parameter logistic equation (log(agonist) vs response–variable slope, GraphPad Prism 5) yielding pEC50 values, which were converted to EC50 values. Efficacies Emax correspond to the upper plateaus of the normalized concentration–response curves.

Y4R cAMP CAMYEN Assay

The assay was performed with live HEK293T-CAMYEN-hY4R cells applying a reported protocol. (31) Experiments were performed in triplicate. Data processing was performed with GraphPad Prism 9.0 as previously described. (31)

Flow Cytometric Y4R Binding Assays

Flow cytometry-based Y4R binding studies with the fluorescent ligands 16, 17, and 18 were performed at intact CHO-hY4R-Gqi5-mtAEQ cells with a FACSCantoII flow cytometer (Becton Dickinson), equipped with an argon laser (488 nm), a red diode laser (640 nm) and a BD High Throughput Sampler (HTS unit) for microtiter plates. The latter was used for injection of the samples of saturation and competition binding experiments. At least three individual experiments were performed in duplicate (kinetic experiments) or triplicate (saturation and competition binding). The following gain settings for forward and sideward scatter were applied throughout: FSC: 0 V, SSC: 252 V. Fluorescence was recorded using the following settings: compound 16, excitation at 488 nm, emission at 585 ± 21 nm (PE channel), gain: 470–500 V; compound 17, excitation at 640 nm, emission at 660 ± 10 nm (APC channel), gain: 450 V; compound 18, excitation at 488 nm, emission at >670 nm (PerCP-Cy5.5 channel), gain: 470–500 V, propidium (cell viability studies), excitation at 488 nm, emission at 585 ± 21 nm (PE channel), gain: 330 V. For measurements requiring the use of classical injection tubes (kinetic experiments), the medium flow rate (60 mL/min) was used. Measurements were stopped after counting of 2000–10000 gated events.
2 to 3 days prior to the experiment, cells were seeded in T75 or T175 culture flasks. On the day of the experiment, cells were detached by trypsinization, suspended in culture medium, and centrifuged. The cell pellet was resuspended in buffer I (binding studies with 16) or DPBS (binding studies with 16–18), and the cell density was adjusted to 1.5 × 105 (saturation binding) or 2 × 105 cells/mL (kinetic and competition binding experiments). All receptor ligands were added to the cell suspension as 100-fold concentrated (compared to the final concentration) solutions in DMSO/H2O 1:1 v/v (fluorescent ligands, all experiments; nonlabeled ligands, competition binding studies) or in 10 mM aq. HCl (nonlabeled ligands, saturation, and kinetic experiments).
For saturation binding experiments, the wells of a polypropylene round-bottom 96-well plate (Brand, Wertheim) were prefilled with 200 μL of cell suspension followed by the addition of 2 μL of 10 mM aq. HCl (samples for total binding) or 2 μL of a 100 μM solution of hPP (samples for unspecific binding). The final concentration of hPP was 1 μM. Incubation was started by adding 2 μL of a 100-fold concentrated fluorescent ligand solution followed by gentle shaking in the dark at 22 ± 2 °C for 2 h and subsequent measurement using the HTS unit (sample volume: 45 μL, injection speed: 1.5 μL/s). For the determination of autofluorescence, three ligand-free samples were prepared by the addition of 2 μL of 10 mM aq. HCl and 2 μL of DMSO/H2O 1:1 v/v to the cell suspension, followed by incubation and measurement.
For association experiments, polypropylene tubes (usable as injection tubes for the FACSContoII flow cytometer) were prefilled with 2000 μL of cell suspension and 20 μL of 10 mM aq. HCl (samples for total binding) or 20 μL of a 100 μM solution of hPP (samples for unspecific binding) were added. The association was started by the addition of 20 μL of a 30 nM (buffer I) or 70 nM (DPBS) solution of 16 (final concentrations: 0.3 and 0.7 nM, respectively), 20 μL of a 100 nM solution of 17 in DPBS (final concentration: 1.0 nM), or 20 μL of a 50 nM solution of 18 in DPBS (final concentration: 0.5 nM) to the cell suspension, followed by short mixing and gentle shaking under protection from light at 22 ± 2 °C. After different periods of time (0.5–120 min for all studied fluorescent ligands), sample aliquots were measured by placing the tube in the injection port of the cytometer.
For dissociation experiments, polypropylene tubes (usable as injection tubes for the FACSContoII flow cytometer) were prefilled with 2000 μL of cell suspension followed by the addition of 20 μL of 10 mM aq. HCl (samples for total binding) or 20 μL of a 100 μM solution of hPP (samples for unspecific binding). Preincubation was started by the addition of 20 μL of a 150 nM (buffer I) or 350 nM (DPBS) solution of 16 (final concentrations: 1.5 and 3.5 nM, respectively), 20 μL of a 500 nM solution of 17 in DPBS (final concentration: 5 nM) or a 250 nM solution of 18 in DPBS (final concentration: 2.5 nM). The samples were gently shaken in the dark at 22 ± 2 °C for 2 h. The dissociation was initiated by the addition of 20 μL of a solution of hPP and 5 (final concentrations: 1000-fold (hPP) and 100-fold (5) over the final concentration of the respective fluorescent ligand) prepared in the buffer used for the respective experiment (note: a combination of hPP and 5 was used to prevent rebinding of the labeled ligand more effectively). After different periods of time (16 in buffer I: 1–360 min, 16 in DPBS: 1–300 min, 17 in DPBS: 1–200 min, 18 in DPBS: 1–300 min), sample aliquots were measured by placing the tube in the injection port of the cytometer.
For competition binding experiments with 16, the wells of a polypropylene round-bottom 96-well plate were prefilled with cell suspension (200 μL) followed by the addition of 2 μL of a 100-fold concentrated solution of the competing (nonlabeled) ligand and gentle shaking in the dark for 5 min. 2 μL of the fluorescent ligand solution (100-fold concentrated) were added and shaking in the dark at 22 ± 2 °C was continued for 2 h. The final concentrations of 16 were 0.5 nM (buffer I) and 1 nM (DPBS). For the determination of unspecific binding and total binding in the absence of the studied competitor, 2 μL of a 100 μM solution of hPP (final concentration: 1 μM) and 2 μL of DMSO/water 1:1 v/v, respectively, were initially added instead of the competitor solution, followed by the addition of the fluorescent ligand after the preincubation period and further processing as described above.
Specific binding data were obtained by subtracting unspecific binding from total binding. Unspecific binding data shown in Figure 4 are autofluorescence corrected. Specific binding data from saturation binding experiments were analyzed by an equation describing a hyperbolic isotherm (binding-saturation: one site-specific binding, GraphPad Prism 5) yielding Kd values, which were converted to pKd values. Specific binding data from association experiments were analyzed by a three-parameter equation describing a monophasic exponential rise to a maximum (Y0 constrained to zero), yielding kobs(mono), and by a five-parameter equation describing a biphasic exponential rise to a maximum (Y0 constrained to zero) yielding kobs(bi,fast) and kobs(bi,slow) (GraphPad Prism 5). Specific binding data from dissociation experiments were analyzed by a two-parameter equation describing a monophasic exponential decline (GraphPad Prism 5) yielding koff. Association rate constants kon(mono), kon(bi,fast), and kon(bi,slow) were calculated from the observed association rate constants kobs(mono), kobs(bi,fast), and kobs(bi,slow) (mean values), the mean values of the corresponding dissociation rate constants koff (cf. Table 4), and the fluorescent ligand concentrations used for the association experiments (see above) according to the equation kon = (kobs – koff)/[fluorescent ligand]. The kinetically derived dissociation constants Kd(kin) were calculated from kon(mono) and the mean value of the dissociation rate constants koff (cf. Table 4) according to the equation Kd(kin) = koff/kon.
Total binding data from competition binding experiments were plotted as fluorescence intensity over log(competitor concentration, M) and analyzed by a four-parameter logistic equation [log(inhibitor) vs response-variable slope, GraphPad Prism 5] to obtain the TOP value (upper curve plateau), which was used for data normalization (100% = TOP value, 0% = average signal obtained from unspecific binding). The normalized data (%) were plotted over log(competitor concentration, M) and analyzed by a four-parameter logistic equation to obtain pIC50 values, which were converted to pKi values according to the Cheng–Prusoff equation (logarithmic form) using the following Kd values of 16: buffer I, Kd = 0.30 nM; DPBS, Kd = 0.70 nM (mean Kd values from three individual saturation binding experiments).
For cell viability studies, cell suspensions were prepared as for fluorescent ligand binding experiments, but with a higher cell density (3 × 105 cells/mL for buffer I and DPBS). The cell suspensions were shaken in 50 mL polypropylene vessels (VWR International, Radnor, PA) at 22 °C. For measurements, 250 μL aliquots were transferred into polystyrene measurement tubes. 2.5 μL of an aqueous solution of propidium iodide (200 μg/mL; final concentration: 2 μg/mL) were added followed by a short incubation period (1 min) and measurement. Measurements were stopped after counting of 20,000 gated events.

Fluorescence Anisotropy Y4R Binding Assays

Fluorescence anisotropy-based Y4R binding studies with fluorescent ligand 16 were performed at hY4R displaying budded baculovirus particles (termed BBVs below), which were obtained from Sf9 insect cells following the procedure described for the preparation of Y1R displaying BBVs. (40) Two types of MultiBac baculoviruses were used: one type encodes only for hY4R resulting in BBVs displaying Y4R devoid of a mammalian-like glycosylation (herein termed Y4Rnonglyco) and the second type additionally encodes for enzymes providing a mammalian-like glycosylation in Sf9 cells (herein termed Y4RSwBac; see also Section Molecular Cloning). The obtained viruses were collected by centrifugation at 1600g for 10 min, and the virus titer was determined with an image-based cell-size estimation assay as described elsewhere. (64) The viruses were amplified using a multiplicity of infection (MOI) between 0.01 and 0.1 until a high-titer baculovirus stock (virus concentration of at least 1.0 × 108 infectious viral particles/mL) was acquired. To produce BBV preparations with a high receptor density, Sf9 cells with a density of 1.9 × 106 cells/mL were infected with an MOI of 3 and the BBVs were collected by centrifugation 63 h after the infection, when the cell viability was <30%. The BBVs were concentrated 40-fold by centrifugation at 48,000g at 4 °C for 40 min, washed with ice-cold DPBS, resuspended, and homogenized using a 0.3 mm diameter needle (Sterican, B. Braun, Melsungen, Germany). Aliquots of the BBV preparations were stored at −90 °C until use.
FA measurements were carried out using a Synergy NEO multimode plate reader (BioTek, Winooski, VT) and black, half-area, flat-bottom polystyrene NBS (nonbinding surface) 96-well plates (Corning, Corning, NY, product no. 3993). Polarizing excitation (530 ± 15 nm) and dual emission (590 ± 17.5 nm) filters with a dichroic mirror were used, allowing the simultaneous detection of parallelly and perpendicularly polarized fluorescence emission. All measurements were performed at 27 °C. Saturation binding experiments, association and dissociation experiments, and competition binding experiments were performed in duplicate, following a previously reported protocol with minor modifications. (65) All ligand dilutions were prepared in DPBS at 4- or 5-fold concentrations compared to the final concentration in the assay. The final total volume per well was 100 μL. Frozen preparations of hY4R displaying BBVs were thawed and thoroughly resuspended using a 1 mL syringe (Norm-Ject-F, Braun Melsungen) with a 0.3 mm diameter needle (Sterican, B. Braun).
For equilibrium binding studies (saturation binding experiments), used for the determination of equilibrium Kd values and the Y4R concentration in the BBV preparations, 25 μL of a 4-fold concentrated solution of 16 (used at final concentrations of 0.5 and 2 nM) and 25 μL of DPBS were premixed in the 96-well plate followed by the addition of 50 μL of the BBV suspension (used in 6 or 12 different dilutions) to initiate total binding. To determine unspecific binding, the procedure was the same, but instead of neat binding buffer, 25 μL of a 4 μM solution of hPP (final concentration: 1 μM) were added. For blank measurements, 50 μL of the BBV suspension were added to 50 μL of DPBS. Experiments were performed with 6 or 12 different BBV dilutions. Measurements were started immediately after the addition of BBV suspension and were stopped after 90 min.
For association experiments, 20 μL of a 5-fold concentrated solution of 16 (used at final concentrations of 0.5 and 2 nM) and 20 μL of DPBS were premixed in the 96-well plate followed by the addition of 60 μL of the BBV suspension (used in six different dilutions) to initiate total binding. To determine unspecific binding, the procedure was the same, but instead of neat binding buffer, 20 μL of a 5 μM solution of hPP (final concentration: 1 μM) were added. For blank measurements, 60 μL of the BBV suspension were added to 40 μL of binding buffer. Note that due to the very fast association of 16 with the Y4R, measurements were not performed simultaneously for all BBV dilutions. Instead, to enable short time intervals between the readout cycles, individual measurements (for 10 min) were performed for all BBV concentrations. For each combination of receptor and ligand concentration, binding equilibrium was reached within this time period.
For dissociation experiments, the preincubation was set up as the association experiments (final concentrations of 16 of 0.5 or 2 nM, same BBV dilutions). Samples were incubated for 1 h, followed by starting the dissociation by the addition of 2 μL of a solution containing 50 μM hPP and 5 μM 5 (final concentrations: 1 μM and 100 nM, respectively) prepared in DPBS, and the FA signal was recorded for 2 h.
Note that in principle, association, equilibrium binding, and dissociation experiments can be performed simultaneously in one plate. However, as mentioned above, association experiments, requiring a higher data sampling rate than equilibrium binding and dissociation experiments, had to be performed consecutively for the various combinations of BBV and ligand concentrations. In contrast, in the case of equilibrium binding and dissociation experiments, all combinations were measured simultaneously.
For competition binding experiments (only performed with Y4RSwBac), 20 μL of a 5-fold concentrated solution of the competitive ligand (used at varying concentrations) and 20 μL of a 5-fold concentrated solution of 16 (final concentration: 0.5 nM) were premixed in the 96-well plate followed by the addition of 60 μL of the BBV suspension (final concentration of Y4RSwBac: 0.13 nM) to initiate total binding. To determine total binding in the absence of competitor and unspecific binding, the same procedure was used, but instead of the addition of competitive ligand, 20 μL of neat binding buffer and 20 μL of a 5 μM solution of hPP (final concentration: 1 μM), respectively, were added. FA signals were measured for 1.5 h.
Data processing for FA binding assays was assisted by the software Aparecium 2.0.20 developed in house (http://www.gpcr.ut.ee/software.html). Prior to the calculation of FA using eq 1, (19) the measured parallel [I∥(t)] and perpendicular [I⊥(t)] fluorescence intensities were blank-corrected on the basis of the values obtained from wells containing BBVs but no receptor ligand.
FA(t)=I∥(t)−I⊥(t)I∥(t)+2I⊥(t)
(1)
where I∥(t) and I⊥(t) are the blank-corrected parallel and perpendicular fluorescence intensities, respectively, measured at time t, and FA(t) is the calculated fluorescence anisotropy at time t. FA equilibrium binding data were globally fitted using a modified version of a previously described user-defined GraphPad Prism-compatible binding model (19) (for the detailed equation, see the Supporting Information), which takes ligand depletion into account and yields the dissociation constant Kd and simultaneously the Y4R concentration of the BBV stock. FA association binding data were globally fitted to obtain association rate constants kon and Kd(kin) values also using a previously presented user-defined GraphPad Prism-compatible binding model, which takes ligand depletion into account and requires the specification of the koff value (the mean koff value obtained from the dissociation experiments was used). (19) Individual association rate constants kon and individual pKd values, obtained from at least three independent FA association binding experiments using six different BBV concentrations and two different concentrations of 16, were averaged to obtain mean kon and mean pKd values ± SEM (cf. Table 5). Kinetically derived dissociation constants Kd(kin) were calculated from individual (n = 3) kon values and the mean koff value (cf. Table 5) according to the equation Kd(kin) = koff/kon, and averaged. The mean value ± SEM of the dissociation rate constant koff was calculated from individual koff values obtained from three independent FA dissociation experiments each using six different BBV concentrations and two different concentrations of 16 (GraphPad Prism 5). Data from FA competition binding experiments using 16 as the fluorescent probe (Kd = 0.14 nM, mean value from four individual FA equilibrium binding experiments) were analyzed by a four-parameter logistic equation (log(inhibitor) vs response–variable slope, GraphPad Prism 5) to obtain pIC50 values, which were converted to pKi values according to the Cheng–Prusoff equation (63) (logarithmic form) using the Kd value for 16 that is mentioned above.

NanoBRET Y4R Binding Assay

BRET-based Y4R binding studies with 16 (saturation binding, association, dissociation, displacement by Y4R reference ligands) were performed following a protocol reported for a NanoBRET Y4R binding assays using HEK293T cells stably expressing an N-terminally Nluc-tagged human Y4R. (51) One the day prior to the experiment, HEK293T-hY4R-Nluc(intraECL2) cells were detached from the culture flask by trypsinization, centrifuged (500g, 5 min), and resuspended in FBS-free L15-HEPES. The cell density was adjusted to 1.14 × 106 cells/mL, and the cells were seeded into white 96-well plates (Brand, Wertheim, Germany) (70 μL, 80,000 cells per well) and incubated overnight in a water-saturated atmosphere (only atmospheric CO2). On the day of the experiment, dilutions of 16, 5, and Y4R ligands studied in competition binding assays were prepared as 10-fold concentrated (compared to the final concentration) solutions in L15-HEPES supplemented with 5% BSA (in the following referred to as L15-HEPES-BSA). The addition of these feed solutions to the wells resulted in a 1:10 dilution and the final compound concentrations. The final BSA concentration in the assay was 1.5% (30 μL of a solution containing 5% BSA added to 70 μL of BSA-free medium, as outlined below).
All BRET measurements were performed at a temperature of 25 °C using a TECAN Infinite Lumi plate reader (Tecan, Crailsheim, Germany) equipped with an injection module. Bioluminescence of the nanoluciferase was detected using a 460/35 nm band-pass (460/35 BP) filter. The emission of the fluorescent ligands was detected through a 610 nm long-pass (610 LP) filter. For all experiments integration times were set as follows: 100 ms for the 460/35 BP channel and 1000 ms for the 610 LP filter to increase S/N.
For saturation binding experiments, 10 μL of L15-HEPES-BSA and 10 μL of the 10-fold concentrated solution of 16 (determination of total binding) or 10 μL of a 10 μM solution of 5 and 10 μL of the 10-fold concentrated solution of 16 (determination of unspecific binding) were added to the cells. After incubation under shaking in the dark at 22 ± 1 °C for 1.5 h, 10 μL of a 10 μM solution of the Nluc substrate coelenterazine h in L15-HEPES-BSA (obtained by a 1:200 dilution of a 2 mM stock solution in methanol) were added to each well, the plate was transferred to the preheated plate reader and luminescence signals were recorded for 15 min (5 cycles).
For association experiments, 10 μL of L15-HEPES-BSA (determination of total binding) or a 10 μM solution of 5 in L15-HEPES-BSA (determination of unspecific binding) were added to the cells followed by the addition of 10 μL of the feed solution of the Nluc substrate furimazine (obtained by diluting the furimazine stock 1:1000 with L15-HEPES-BSA). The plate was immediately transferred to the plate reader, luminescence was measured for one cycle (ca. 15 s) followed by the addition of 10 μL of a 10 nM solution of 16 (final concentration: 1 nM) to each well via the injector module and continued measurement for 60 min (300 cycles).
For dissociation experiments, 10 μL of L15-HEPES-BSA (determination of total binding) or 10 μL of a 10 μM solution of 5 in L15-HEPES-BSA (determination of unspecific binding) were added to the cells followed by the addition of 10 μL of a 35 nM solution of 16 in L15-HEPES-BSA and incubation under shaking in the dark at 22 ± 1 °C for 1.5 h. 10 μL of the feed solution of the Nluc substrate furimazine (obtained by diluting the furimazine stock 1:600 with L15-HEPES-BSA) were added to each well and the plate was immediately transferred to the plate reader. Luminescence was measured for five cycles (1.5 min) followed by the addition of 10 μL of a 10 μM solution of 5 in L15-HEPES-BSA to each well with a pipette and continued measurement of luminescence for 150 min (750 cycles). In order to take the time span between the addition of the 10 μM solution of 5 (initiation of the dissociation) and the start of the measurement into account for data analysis, this delay was determined with a stopwatch.
For competition binding experiments, 10 μL of a 10-fold concentrated solution of the competing ligand (determination of total binding in the presence of a competitor), 10 μL of L15-HEPES-BSA (determination of total binding in the absence of competitor), or 10 μL of a 10 μM solution of 5 in L15-HEPES-BSA (determination of unspecific binding) were added to the cells. After a short period of preincubation (5 min), 10 μL of a 15 nM solution of 16 in L15-HEPES-BSA were added followed by incubation under gentle shaking in the dark at 22 ± 2 °C for 1.5 h. 10 μL of the 10 μM feed solution of the Nluc substrate coelenterazine h in L15-HEPES-BSA (obtained as described above) were added, the plate was immediately transferred to the plate reader and luminescence was measured for 15 min (5 cycles).
BRET ratios were calculated by dividing the signal measured in the 610LP channel through the signal obtained from the 460/35 BP channel. Corrected BRET ratios were calculated by subtracting the BRET ratio obtained from a vehicle control sample (no receptor ligand added) from the BRET ratios obtained from samples containing fluorescent ligand. Specific binding data were obtained by subtracting unspecific binding from total binding. Specific binding data from saturation binding experiments were analyzed by an equation describing a hyperbolic isotherm (binding-saturation: one site-specific binding, GraphPad Prism 5) yielding Kd values, which were converted to pKd values. Specific binding data from association experiments were analyzed by a three-parameter equation describing a monophasic exponential rise to a maximum (Y0 constrained to zero) yielding kobs(mono) values, and by a five-parameter equation describing a biphasic exponential rise to a maximum (Y0 constrained to zero) affording kobs(bi,slow) and kobs(bi,fast) values (GraphPad Prism 5). Specific binding data from dissociation experiments were analyzed by a three-parameter equation describing a monophasic exponential decline (Y0 constrained to 100%) yielding koff(mono) values, and by a five-parameter equation describing a biphasic exponential decline (Y0 constrained to 100%, plateau constrained to zero) yielding koff(bi,fast) and koff(bi,slow) values (GraphPad Prism 5.0). Note: Dissociation data were initially analyzed with a variable plateau. As the plateau mean value was not significantly different from zero in the case of the biphasic analysis (P > 0.05, t test), data were reanalyzed with the plateau value constrained to zero.
The association rate constants kon(mono), kon(bi,fast), and kon(bi,slow) were calculated from the observed association rate constants kobs(mono), kobs(bi,fast), and kobs(bi,slow), respectively (mean values), the mean values of the dissociation rate constants koff(mono), koff(bi,fast), or koff(bi,slow) (cf. Table 6), and the fluorescent ligand concentration used for the association experiments (see above) according to the equation kon = (kobs – koff)/[fluorescent ligand]. The kinetically derived dissociation constants Kd(kin) were calculated from kon(mono), kon(bi,fast), or kon(bi,slow) and the mean values of the dissociation rate constants koff(mono), koff(bi,fast), or koff(bi,slow) (cf. Table 6) according to the equation Kd(kin) = koff/kon.
Total binding data from competition binding experiments were plotted as corrected BRET ratio over log(competitor concentration, M) and analyzed by a four-parameter logistic equation (log(inhibitor) vs response–variable slope, GraphPad Prism 5) to obtain the TOP value (upper curve plateau), which was used for data normalization (100% = TOP value, 0% = average of the corrected BRET ratio obtained from unspecific binding). The normalized data (%) were plotted over log(competitor concentration, M) and analyzed by a four-parameter logistic equation to obtain pIC50 values, which were converted to pKi values according to the Cheng–Prusoff equation (63) (logarithmic form) using the following Kd value for 16: Kd = 0.94 nM (mean value from three individual saturation binding experiments).

Confocal Microscopy

Confocal microscopy was performed with a Zeiss LSM 710 confocal laser scanning microscope (Zeiss). The objective was 63× magnification with oil (1.4 NA). One day prior to the experiment CHO-hY4R-Gqi5-mtAEQ cells were seeded in Nunc LabTekTM II cover glasses with 8 chambers (Thermo Fisher Scientific). On the day of the experiment, the confluency of the cells was 60–80%. The culture medium was removed, cells were washed with L15 medium (200 μL) and covered with L15 medium (100 μL) containing H33342 (2 μg/mL). L15 medium (100 μL) containing H33342 (2 μg/mL) and either compound 16 or 17 (final concentration: 20 nM) were added for total binding. For the determination of unspecific binding, L15 medium (100 μL) containing H33342 (2 μg/mL) and hPP (final concentration: 1 μM), and L15 medium (100 μL) containing H33342 (2 μg/mL) and either 16 or 17 (final concentration: 20 nM) were added. Images were acquired after an incubation period of 30 min (37 °C). The settings for compound 16 were: laser power/pinhole: 405 nm: 1.8%/1.97 airy units, 561 nm: 2%/1.32 airy units. The settings for compound 17 were: laser power/pinhole: 405 nm: 2.0%/1.90 airy units, 633 nm: 28%/1.35 airy units. Filter settings for fluorescence detection: 410–549 nm (H33342) (studies with 16), 410–585 nm (H33342) (studies with 17), 562–649 nm (16), and 638–759 nm (17).

Wide-Field Epifluorescence and TIRF Microscopy

For fluorescent ligand binding imaging experiments, human SK-OV-3 ovarian adenocarcinoma cells (ATCC HTB-77) were seeded at a density of 20,000 cells per well into eight-well CG imaging chambers (Zell Kontakt GmbH, Nörten-Hardenberg, Germany). After incubation for 24 h in McCoy’s 5A Medium (supplemented with 10% FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin) at 37 °C in a humidified atmosphere (95% air, 5% CO2), recombinant MultiBacMam baculoviruses of Y4RVSVG were added (cell confluency: approximately 70%) at an MOI of 3 and incubated for additional 24 h (medium was supplemented with 1 mM sodium butyrate). Native cells without the addition of Y4R baculovirus were used as a negative control. Prior to imaging, nuclei were stained with 2 mM (final concentration) Hoechst 34580 (Chemodex Ltd., St. Gallen, Switzerland) for 5 min. The culture medium was replaced by LiveLight MEMO imaging medium (Cell Guidance Systems, Cambridge, U.K.) (200 μL, supplemented with supplement A according to the manufacturer’s protocol). After incubation at 37 °C in a humidified atmosphere containing 5% CO2 for 1 h, compound 16 (final concentration 0.1 or 1 nM) was added. In the case of unspecific binding, hPP was additionally added at a final concentration of 10 μM. Cells were imaged after 30 min of incubation (37 °C, atmosphere with 5% CO2). Imaging was performed using a microscope setup as described previously. (66) Briefly, wide-field epifluorescence and TIRF imaging were performed using an inverted microscope based on a Till iMIC body (Till Photonics/FEI, Munich, Germany), equipped with a UPLSAPO 20× oil (NA 0.85) and TIRF APON 60× oil (NA 1.49) objectives (Olympus Co., Tokyo, Japan). The samples were alternately excited using a 405 nm (120 mW) PhoxX laser diode (Omicron-Laserage, Rodgau, Germany) for Hoechst 34580 or at 561 nm (106 mW) for compound 16. Lasers were combined in a SOLE-6 light engine (Omicron-Laserage) and their emission was coupled into a Yanus scan head, which, along with a Polytrope galvanometric mirror (Till Photonics/FEI), was used to position the laser beam for wide-field epifluorescence or TIRF (approximately 100 nm depth) illumination. Excitation and emission light were spectrally separated using an imaging filter cube containing a flat 2 mm beamsplitter zt 405/488/531/640rpc (Chroma Technology Co.) and a TIRF emission filter ZET 405/488/561/640 (Chroma Technology Co.). In addition, a bright-field channel was used to define cell boundaries. The electron-multiplying charge-coupled device Ultra 897 camera (Andor Technology, Belfast, U.K.) was mounted to the microscope via a TuCam adapter with 2× magnification (Andor Technology). The camera was cooled to −100 °C using an Oasis 160 liquid recirculating chiller (Solid State Cooling Systems, Wappingers Falls, NY). All measurements were performed in the eight-well CG imaging chambers, and at least 10 selected areas per well were recorded as 16-bit multicolor OME-TIFF Z-stacks (100 frames, with 200 nm piezo-focusing increment in the case of the 60× objective or 500 nm in case of 20× objective), with an exposure time of 100 ms and an EM gain of 300 in the case of wide-field epifluorescence imaging or one-color time stacks (1000 frames at 30 Hz) in the case of single-particle tracking TIRF imaging. For different conditions, the laser powers were varied to enable optimal signal levels (the absence of a detectable crosstalk signal in the channels was ensured). Wide-field epifluorescence Z-stacks were deconvolved using the EpiDEMIC plugin. (67) Single-particle time lapse tracking was performed in the Icy image analysis environment using the Spot Tracking (68) plugin and classified using Track Manager. Tracks longer than 150 frames were filtered out for video presentation.

Statistical Significance

For the applied statistical tests (F-test, t test), the significance level was set to P = 0.05.

Calculation of Propagated Errors

Propagated errors (applying to specifically bound fluorescent ligand (saturation binding), association rate constants kon, and kinetically derived dissociation constants Kd(kin) obtained from flow cytometric and NanoBRET assays) were calculated as described elsewhere. (31)

Supporting Information

Click to copy section linkSection link copied!

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsptsci.4c00013.

  • Preparation of the azido-functionalized Py-5 derivative 15; chromatograms of the investigation of the chemical stability of 16–18 in PBS pH 7.4 (Figure S1); radioligand displacement curves from competition binding experiments with [3H]UR-KK200 (Figure S2); concentration–response curves of hPP, 11 and 16–19 obtained from a hY4R Ca2+ aequorin assay (Figure S3); concentration–response curves of hPP, 5, 11, and 16–19 obtained from a hY4R mini-Gsi protein recruitment assay (Figure S4); concentration–response curves of hPP, 16 and 17 obtained from a hY4R CAMYEN cAMP assay (Figure S5); study of dummy fluorescent ligands in functional assays (Figure S6); excitation and emission spectra (Figure S7); viability of CHO-hY4R-Gqi5-mtAEQ cells (Figure S8); analyses of flow cytometric saturation binding data of 16 based on nonviable and viable cell populations (Figure S9); syntax of the equation used to fit FA equilibrium binding data (GraphPad Prism 5); RP-HPLC chromatograms of compounds 11 and 16–19; and 1H NMR spectra of compound 11 (PDF)

  • TIRF video sequence (recorded and shown at a 30 Hz resolution, shown at double speed) showing the interactions of 16 with the basal plasma membrane of adherent SK-OV-3-Y4R cells including single-particle tracking (magnified region) (AVI)

Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Author Information

Click to copy section linkSection link copied!
  • Corresponding Authors
  • Authors
    • Jakob Gleixner - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Orcidhttps://orcid.org/0000-0002-8488-870X
    • Sergei Kopanchuk - Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia;  Orcidhttps://orcid.org/0000-0003-1756-9327
    • Lukas Grätz - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Present Address: Section of Receptor Biology & Signaling, Department of Physiology & Pharmacology, Karolinska Institutet, S-17165 Stockholm, Sweden;  Orcidhttps://orcid.org/0000-0001-6755-0742
    • Maris-Johanna Tahk - Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia;  Orcidhttps://orcid.org/0000-0002-4566-9192
    • Tõnis Laasfeld - Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    • Santa Veikšina - Institute of Chemistry, University of Tartu, Ravila 14a, 50411 Tartu, Estonia
    • Carina Höring - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Present Address: Biontech SE, An der Goldgrube 12, 55131 Mainz, Germany
    • Albert O. Gattor - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Orcidhttps://orcid.org/0000-0001-5166-2168
    • Laura J. Humphrys - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Present Address: Monash Institute of Pharmaceutical Sciences, 399 Royal Parade, Parkville VIC 3052, Australia;  Orcidhttps://orcid.org/0000-0003-4019-5538
    • Christoph Müller - Institute of Pharmacy, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany;  Present Address: Axolabs GmbH, Fritz-Hornschuch-Straße 9, 95326 Kulmbach, Germany;  Orcidhttps://orcid.org/0000-0001-6121-6292
    • Nataliya Archipowa - Institute of Biophysics and Physical Biochemistry, Faculty of Biology and Preclinical Medicine, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg, Germany
    • Johannes Köckenberger - Department of Chemistry and Pharmacy, Molecular and Clinical Pharmacy, Friedrich-Alexander-University Erlangen-Nürnberg, Nikolaus-Fiebiger-Straße 10, D-91058 Erlangen, Germany;  Present Address: Department of Chemistry and Biochemistry, University of California, La Jolla, San Diego, California 92093, USA
    • Markus R. Heinrich - Department of Chemistry and Pharmacy, Molecular and Clinical Pharmacy, Friedrich-Alexander-University Erlangen-Nürnberg, Nikolaus-Fiebiger-Straße 10, D-91058 Erlangen, Germany;  Orcidhttps://orcid.org/0000-0001-7113-2025
    • Roger Jan Kutta - Institute of Physical and Theoretical Chemistry, Faculty of Chemistry and Pharmacy, University of Regensburg, Universitätsstraße 31, D-93053 Regensburg, Germany
  • Author Contributions

    J.G., C.M., J.K., and L.G. performed the syntheses. J.G. performed stability studies and radiochemical binding assays. J.G., A.O.G., C.H., and L.J.H. conducted functional Y4R assays. C.M., N.A., and R.J.K. characterized the fluorescent ligands with respect to excitation and emission maxima and quantum yields. J.G., M-J.T., S.K., and T.L. performed fluorescent anisotropy assays. S.K. performed TIRF microscopy. S.V. prepared the BBVs. L.G. and S.V. performed molecular cloning. C.H. and J.G. prepared the stably transfected HEK293T cell line. M.K. initiated and planned the project. M.K., M.R.H., A.R., and R.J.K. supervised the research. J.G. and M.K. with impact from all coauthors wrote the manuscript. All authors have given approval to the final version of the manuscript.

  • Notes
    The authors declare no competing financial interest.

Acknowledgments

Click to copy section linkSection link copied!

The authors thank Susanne Bollwein, Maria Beer-Krön, Brigitte Wenzl, Carmen Piirsalu, and Merve Gökalp for excellent technical assistance, and Sabrina Diwisch, Luise Liebig, and Tobias Spitzl for support with the flow cytometric assays. This work was funded by the Deutsche Forschungsgemeinschaft (DFG) (research grant KE 1857/1-3) and the Estonian Research Council grant PSG230 and was additionally supported by the Graduate Training Program GRK 1910 of the DFG.

Abbreviations Used

Click to copy section linkSection link copied!
Arg(carb)

Nω-carbamoylated arginine containing a tetramethylene spacer or a hexyne structure with a terminal alkyne group in the carbamoyl substituent (cf. Figure 3)

BSA

bovine serum albumin

CAMYEN

cAMP sensor using YFP-Epac-nanoluciferase

CHO

Chinese hamster ovary

Cy3B-SE

Cy3B succinimidyl ester

DIPEA

N,N-diisopropylethylamine

Emax

efficacy (maximum effect) of a receptor agonist determined in a functional assay

Epac

exchange protein activated by cAMP

EtOH

ethanol

FA

fluorescence anisotropy

FBS

fetal bovine serum

FL

fluorescent ligand

Fmoc amino acid

Nα-Fmoc-protected and side-chain-protected (if required) amino acid

HBTU

3-[bis(dimethylamino)methyliumyl]-3H-benzotriazol-1-oxide hexafluorophosphate

HEC

human endometrial cancer

HEPES

4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HOBt

hydroxybenzotriazole

hPP

human pancreatic polypeptide

hY4R

human Y4 receptor

k

retention (or capacity) factor (HPLC)

MeOH

methanol

Nluc

nanoluciferase

Pbf

2,2,4,6,7-pentamethyl-dihydrobenzofuran-5-sulfonyl

PBS

phosphate-buffered saline

pEC50

negative decadic logarithm of the half-maximal effective concentration (functional assays)

pKi

negative decadic logarithm of the dissociation constant Ki (in M) obtained from a competition binding experiment

pNPY

porcine neuropeptide Y

PS

polystyrene

PyBOP

benzotriazol-1-yl-oxytripyrrolidinophosphonium-hexafluorophosphate

PYY

peptide YY

RP

reversed phase

SEM

standard error of the mean

SPPS

solid-phase peptide synthesis

TFA

trifluoroacetic acid

TIRF

total internal reflection fluorescence

tR

retention time

YFP

yellow fluorescent protein

YR

NPY receptor

References

Click to copy section linkSection link copied!

This article references 68 other publications.

  1. 1
    Michel, M. C.; Beck-Sickinger, A.; Cox, H.; Doods, H. N.; Herzog, H.; Larhammar, D.; Quirion, R.; Schwartz, T.; Westfall, T. XVI. International Union of Pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY, and pancreatic polypeptide receptors. Pharmacol. Rev. 1998, 50, 143– 150
    Google Scholar
    1
    XVI. International union of pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY, and pancreatic polypeptide receptors
    Michel, Martin C.; Beck-Sickinger, Annette; Cox, Helen; Doods, Henri N.; Herzog, Herbert; Larhammar, Dan; Quirion, Remi; Schwartz, Thue; Westfall, Thomas
    Pharmacological Reviews (1998), 50 (1), 143-150CODEN: PAREAQ; ISSN:0031-6997. (Williams & Wilkins)
    A review with ∼80 refs.
  2. 2
    Pedragosa-Badia, X.; Stichel, J.; Beck-Sickinger, A. G. Neuropeptide Y receptors: how to get subtype selectivity. Front. Endocrinol. 2013, 4, 5  DOI: 10.3389/fendo.2013.00005
    Google Scholar
    2
    Neuropeptide Y receptors: how to get subtype selectivity
    Pedragosa-Badia Xavier; Stichel Jan; Beck-Sickinger Annette G
    Frontiers in endocrinology (2013), 4 (), 5 ISSN:1664-2392.
    The neuropeptide Y (NPY) system is a multireceptor/multiligand system consisting of four receptors in humans (hY(1), hY(2), hY(4), hY(5)) and three agonists (NPY, PYY, PP) that activate these receptors with different potency. The relevance of this system in diseases like obesity or cancer, and the different role that each receptor plays influencing different biological processes makes this system suitable for the design of subtype selectivity studies. In this review we focus on the latest findings within the NPY system, we summarize recent mutagenesis studies, structure activity relationship studies, receptor chimera, and selective ligands focusing also on the binding mode of the native agonists.
  3. 3
    Ueno, N.; Inui, A.; Iwamoto, M.; Kaga, T.; Asakawa, A.; Okita, M.; Fujimiya, M.; Nakajima, Y.; Ohmoto, Y.; Ohnaka, M.; Nakaya, Y.; Miyazaki, J.-I.; Kasuga, M. Decreased food intake and body weight in pancreatic polypeptide-overexpressing mice. Gastroenterology 1999, 117, 1427– 1432,  DOI: 10.1016/S0016-5085(99)70293-3
    Google Scholar
    3
    Decreased food intake and body weight in pancreatic polypeptide-overexpressing mice
    Ueno N; Inui A; Iwamoto M; Kaga T; Asakawa A; Okita M; Fujimiya M; Nakajima Y; Ohmoto Y; Ohnaka M; Nakaya Y; Miyazaki J I; Kasuga M
    Gastroenterology (1999), 117 (6), 1427-32 ISSN:0016-5085.
    BACKGROUND & AIMS: Pancreatic polypeptide (PP) is a 36-amino acid hormone produced by F cells within the pancreatic islets and the exocrine pancreas. The definitive function of PP in mammalian physiology remains to be determined. This study examined the effects of chronic overexpression of PP through the development of PP transgenic mice. METHODS: PP transgenic mice were created by using mouse PP complementary DNA under the control of the cytomegalovirus immediate early enhancer-chicken beta-actin hybrid promoter (pCAGGS expression vector). RESULTS: A unique line of transgenic mice was created that overexpresses PP in the pancreatic islets with low levels of expression in other tissues including the brain. Plasma PP concentrations were more than 20 times higher than those of control littermates. However, PP overproduction led to postnatal lethality in half of the pups because of markedly decreased milk intake. The remaining PP transgenic mice gained less weight with specifically reduced food intake and fat mass compared with controls, a result that was more evident in male than in female mice. The transgenic mice exhibited a reduced rate of gastric emptying of a solid meal but had normal oxygen consumption and fasting leptin levels. Immunoneutralization with anti-PP antiserum reversed the phenotypic changes of transgenic animals. CONCLUSIONS: PP could be involved in feeding and body weight regulation partly through regulation of gastric emptying.
  4. 4
    Batterham, R. L.; Le Roux, C. W.; Cohen, M. A.; Park, A. J.; Ellis, S. M.; Patterson, M.; Frost, G. S.; Ghatei, M. A.; Bloom, S. R. Pancreatic polypeptide reduces appetite and food intake in humans. J. Clin. Endocrinol. Metab. 2003, 88, 3989– 3992,  DOI: 10.1210/jc.2003-030630
    Google Scholar
    4
    Pancreatic polypeptide reduces appetite and food intake in humans
    Batterham, R. L.; Le Roux, C. W.; Cohen, M. A.; Park, A. J.; Ellis, S. M.; Patterson, M.; Frost, G. S.; Ghatei, M. A.; Bloom, S. R.
    Journal of Clinical Endocrinology and Metabolism (2003), 88 (8), 3989-3992CODEN: JCEMAZ; ISSN:0021-972X. (Endocrine Society)
    Pancreatic polypeptide (PP) is a gut hormone released from the pancreas in response to ingestion of food. Plasma PP has been shown to be reduced in conditions assocd. with increased food intake and elevated in anorexia nervosa. In addn. peripheral administration of PP has been shown to decrease food intake in rodents. These findings suggest that PP may act as a circulating factor that regulates food intake. Therefore we investigated the effect of i.v. infusion of PP (10 pmol/kg/min) on appetite and food intake in a randomized double-blind placebo-controlled crossover study in ten healthy volunteers. Infusion of PP reduced appetite and decreased the energy intake at a buffet lunch two hours post-infusion by 21.8±5.7% (P < 0.01). More importantly the inhibition of food intake was sustained, such that energy intake, as assessed by food diaries, was significantly reduced both the evening of the study and the following morning. Overall PP infusion reduced cumulative 24-h energy intake by 25.3±5.8%. In conclusion our data demonstrates that PP causes a sustained decrease in both appetite and food intake.
  5. 5
    Schmidt, P. T.; Näslund, E.; Grybäck, P.; Jacobsson, H.; Holst, J. J.; Hilsted, L.; Hellström, P. M. A role for pancreatic polypeptide in the regulation of gastric emptying and short-term metabolic control. J. Clin. Endocrinol. Metab. 2005, 90, 5241– 5246,  DOI: 10.1210/jc.2004-2089
    Google Scholar
    5
    A role for pancreatic polypeptide in the regulation of gastric emptying and short-term metabolic control
    Schmidt, P. T.; Naeslund, E.; Grybaeck, P.; Jacobsson, H.; Holst, J. J.; Hilsted, L.; Hellstroem, P. M.
    Journal of Clinical Endocrinology and Metabolism (2005), 90 (9), 5241-5246CODEN: JCEMAZ; ISSN:0021-972X. (Endocrine Society)
    Context: Previous studies using pancreatic polypeptide (PP) infusions in humans have failed to show an effect on gastric emptying, glucose metab., and insulin secretion. This might be due to the use of nonhuman sequences of the peptide. Objective: The objective of this study was to use synthetic human PP to study gastric emptying rates of a solid meal and postprandial hormone secretion and glucose disposal as well as the gastric emptying rate of water. Design: This was a single-blind study. Setting: The study was performed at a university hospital. Participants: Fourteen healthy adult subjects were studied. Interventions: Infusion of saline or PP at 0.75 or 2.25 pmol/kg·min was given to eight subjects (gastric emptying of solid food), and infusion of saline or PP at 2.25 pmol/kg·min was given to six subjects (gastric emptying of water). Main Outcome Measures: The main outcome measures were gastric emptying of solids (scintigraphy), hunger ratings (visual analog scale), and plasma concns. of PP, insulin, glucagon, somatostatin, glucagon-like peptide 1, glucose, and gastric emptying of plain water (scintigraphy). Results: PP prolonged the lag phase and the half-time of emptying of the solid meal. The change in hunger rating, satiety, desire to eat after the meal, or prospective consumption was not affected. The postprandial rise in plasma glucose was prolonged by PP. The postprandial rise in insulin was also delayed by PP. PP had no significant effect on the emptying of water. Conclusions: PP inhibits gastric emptying of solid food and delays the postprandial rise in plasma glucose and insulin. PP is suggested to have a physiol. role in the pancreatic postprandial counter-regulation of gastric emptying and insulin secretion.
  6. 6
    Painsipp, E.; Wultsch, T.; Edelsbrunner, M. E.; Tasan, R. O.; Singewald, N.; Herzog, H.; Holzer, P. Reduced anxiety-like and depression-related behavior in neuropeptide Y Y4 receptor knockout mice. Genes, Brain Behav. 2008, 7, 532– 542,  DOI: 10.1111/j.1601-183X.2008.00389.x
    Google Scholar
    6
    Reduced anxiety-like and depression-related behavior in neuropeptide Y Y4 receptor knockout mice
    Painsipp E; Wultsch T; Edelsbrunner M E; Tasan R O; Singewald N; Herzog H; Holzer P
    Genes, brain, and behavior (2008), 7 (5), 532-42 ISSN:.
    Neuropeptide Y (NPY) acting through Y1 receptors reduces anxiety- and depression-like behavior in rodents, whereas Y2 receptor stimulation has the opposite effect. This study addressed the implication of Y4 receptors in emotional behavior by comparing female germ line Y4 knockout (Y4-/-) mice with control and germ line Y2-/- animals. Anxiety- and depression-like behavior was assessed with the open field (OF), elevated plus maze (EPM), stress-induced hyperthermia (SIH) and tail suspension tests (TST), respectively. Learning and memory were evaluated with the object recognition test (ORT). In the OF and EPM, both Y4-/- and Y2-/- mice exhibited reduced anxiety-related behavior and enhanced locomotor activity relative to control animals. Locomotor activity in a familiar environment was unchanged in Y4-/- but reduced in Y2-/- mice. The basal rectal temperature exhibited diurnal and genotype-related alterations. Control mice had temperature minima at noon and midnight, whereas Y4-/- and Y2-/- mice displayed only one temperature minimum at noon. The magnitude of SIH was related to time of the day and genotype in a complex manner. In the TST, the duration of immobility was significantly shorter in Y4-/- and Y2-/- mice than in controls. Object memory 6 h after initial exposure to the ORT was impaired in Y2-/- but not in Y4-/- mice, relative to control mice. These results show that genetic deletion of Y4 receptors, like that of Y2 receptors, reduces anxiety-like and depression-related behavior. Unlike Y2 receptor knockout, Y4 receptor knockout does not impair object memory. We propose that Y4 receptors play an important role in the regulation of behavioral homeostasis.
  7. 7
    Lin, S.; Shi, Y.-C.; Yulyaningsih, E.; Aljanova, A.; Zhang, L.; Macia, L.; Nguyen, A. D.; Lin, E.-J. D.; During, M. J.; Herzog, H.; Sainsbury, A. Critical role of arcuate Y4 receptors and the melanocortin system in pancreatic polypeptide-induced reduction in food intake in mice. PLoS One 2009, 4, e8488  DOI: 10.1371/journal.pone.0008488
    Google Scholar
    There is no corresponding record for this reference.
  8. 8
    Tasan, R. O.; Lin, S.; Hetzenauer, A.; Singewald, N.; Herzog, H.; Sperk, G. Increased novelty-induced motor activity and reduced depression-like behavior in neuropeptide Y (NPY)-Y4 receptor knockout mice. Neuroscience 2009, 158, 1717– 1730,  DOI: 10.1016/j.neuroscience.2008.11.048
    Google Scholar
    There is no corresponding record for this reference.
  9. 9
    Sainsbury, A.; Shi, Y. C.; Zhang, L.; Aljanova, A.; Lin, Z.; Nguyen, A. D.; Herzog, H.; Lin, S. Y4 receptors and pancreatic polypeptide regulate food intake via hypothalamic orexin and brain-derived neurotropic factor dependent pathways. Neuropeptides 2010, 44, 261– 268,  DOI: 10.1016/j.npep.2010.01.001
    Google Scholar
    9
    Y4 receptors and pancreatic polypeptide regulate food intake via hypothalamic orexin and brain-derived neurotropic factor dependent pathways
    Sainsbury, Amanda; Shi, Yan-Chuan; Zhang, Lei; Aljanova, Aygul; Lin, Zhou; Nguyen, Amy D.; Herzog, Herbert; Lin, Shu
    Neuropeptides (Oxford, United Kingdom) (2010), 44 (3), 261-268CODEN: NRPPDD; ISSN:0143-4179. (Elsevier Ltd.)
    Gut-derived peptides are known to regulate food intake by activating specific receptors in the brain, but the target nuclei and neurons influenced are largely unknown. Here we show that peripherally administered pancreatic polypeptide (PP) stimulates neurons in key nuclei of the hypothalamus crit. for appetite and satiety regulation. In the lateral hypothalamic area (LHA), also known as the feeding center, neurons expressing the orexigenic neuropeptide orexin colocalize with the early neuronal activation marker c-Fos upon i.p. injection of PP into mice. In the ventromedial hypothalamus (VMH), also known as the satiety center, neurons activated by PP, as indicated by induction of c-Fos immunoreactivity, express the anorexigenic brain-derived neurotrophic factor (BDNF). Activation of neurons in the LHA and VMH in response to PP occurs via a Y4 receptor-dependent process as it is not seen in Y4 receptor knockout mice. We further demonstrate that in response to i.p. PP, orexin mRNA expression in the LHA is down-regulated, with Y4 receptors being crit. for this effect as it is not seen in Y4 receptor knockout mice, whereas BDNF mRNA expression is up-regulated in the VMH in response to i.p. PP in the fasted, but not in the non-fasted state. Taken together these data suggest that PP can regulate food intake by suppressing orexigenic pathways by down-regulation of orexin and simultaneously increasing anorexigenic pathways by up-regulating BDNF.
  10. 10
    Li, J. B.; Asakawa, A.; Terashi, M.; Cheng, K.; Chaolu, H.; Zoshiki, T.; Ushikai, M.; Sheriff, S.; Balasubramaniam, A.; Inui, A. Regulatory effects of Y4 receptor agonist (BVD-74D) on food intake. Peptides 2010, 31, 1706– 1710,  DOI: 10.1016/j.peptides.2010.06.011
    Google Scholar
    10
    Regulatory effects of Y4 receptor agonist (BVD-74D) on food intake
    Li, Jiang-Bo; Asakawa, Akihiro; Terashi, Mutsumi; Cheng, Kai-Chun; Chaolu, Huhe; Zoshiki, Takahiro; Ushikai, Miharu; Sheriff, Sulaiman; Balasubramaniam, Ambikaipakan; Inui, Akio
    Peptides (New York, NY, United States) (2010), 31 (9), 1706-1710CODEN: PPTDD5; ISSN:0196-9781. (Elsevier)
    The objective of this study was to clarify the role of a novel agonist with high selectivity and affinity for Y4 receptors in the regulation of food intake. The Y4 receptor agonist BVD-74D was administered to C57BL/6J mice that were fed with a normal or high-fat diet, and to fatty liver Shionogi (FLS)-ob/ob mice; the food intake, water intake, and body wt. gain were measured in these mice. In the mice fed with a normal diet, the cumulative food intake significantly decreased at 20 min and 1 h after the administration of 1 mg/kg of BVD-74D and at 1, 2, 4, 8, and 24 h after the administration of 10 mg/kg of BVD-74D. Moreover, the cumulative water intake and body wt. gain significantly decreased in these mice. Among the mice that were fed with a high-fat diet, the cumulative food intake and water intake significantly decreased 1, 2, and 4 h after BVD-74D (10 mg/kg) administration. Furthermore, the cumulative food intake significantly decreased 2 and 4 h after BVD-74D (10 mg/kg) administration in the FLS-ob/ob mice. Thus, we propose that the novel Y4 receptor agonist BVD-74D has suppressive effects on food intake, water intake, and wt. gain in normal mice fed with normal diets and on food intake in normal mice fed with high-fat diets and in FLS-ob/ob mice. These findings indicate that the Y4 receptor and its agonist would be promising targets for obesity.
  11. 11
    Moriya, R.; Fujikawa, T.; Ito, J.; Shirakura, T.; Hirose, H.; Suzuki, J.; Fukuroda, T.; MacNeil, D. J.; Kanatani, A. Pancreatic polypeptide enhances colonic muscle contraction and fecal output through neuropeptide Y Y4 receptor in mice. Eur. J. Pharmacol. 2010, 627, 258– 264,  DOI: 10.1016/j.ejphar.2009.09.057
    Google Scholar
    There is no corresponding record for this reference.
  12. 12
    Brothers, S. P.; Wahlestedt, C. Therapeutic potential of neuropeptide Y (NPY) receptor ligands. EMBO Mol. Med. 2010, 2, 429– 439,  DOI: 10.1002/emmm.201000100
    Google Scholar
    12
    Therapeutic potential of neuropeptide Y (NPY) receptor ligands
    Brothers, Shaun P.; Wahlestedt, Claes
    EMBO Molecular Medicine (2010), 2 (11), 429-439CODEN: EMMMAM; ISSN:1757-4684. (Wiley-Blackwell)
    A review. Neuropeptide Y (NPY) is widely distributed in the human body and contributes to a vast no. of physiol. processes. Since its discovery, NPY has been implicated in metabolic regulation and, although interest in its role in central mechanisms related to food intake and obesity has somewhat diminished, the topic remains a strong focus of research concerning NPY signalling. In addn., a no. of other uses for modulators of NPY receptors have been implied in a range of diseases, although the development of NPY receptor ligands has been slow, with no clin. approved receptor therapeutics currently available. Nevertheless, several interesting small mol. compds., notably Y2 receptor antagonists, have been published recently, fueling optimism in the field. Herein we review the role of NPY in the pathophysiol. of a no. of diseases and highlight instances where NPY receptor signalling systems are attractive therapeutic targets.
  13. 13
    Verma, D.; Hörmer, B.; Bellmann-Sickert, K.; Thieme, V.; Beck-Sickinger, A. G.; Herzog, H.; Sperk, G.; Tasan, R. O. Pancreatic polypeptide and its central Y4 receptors are essential for cued fear extinction and permanent suppression of fear. Br. J. Pharmacol. 2016, 173, 1925– 1938,  DOI: 10.1111/bph.13456
    Google Scholar
    13
    Pancreatic polypeptide and its central Y4 receptors are essential for cued fear extinction and permanent suppression of fear
    Verma, D.; Hoermer, B.; Bellmann-Sickert, K.; Thieme, V.; Beck-Sickinger, A. G.; Herzog, H.; Sperk, G.; Tasan, R. O.
    British Journal of Pharmacology (2016), 173 (12), 1925-1938CODEN: BJPCBM; ISSN:1476-5381. (Wiley-Blackwell)
    Background and purpose : Avoiding danger and finding food are closely related behaviors that are essential for surviving in a natural environment. Growing evidence supports an important role of gut-brain peptides in modulating energy homeostasis and emotional-affective behavior. For instance, postprandial release of pancreatic polypeptide (PP) reduced food intake and altered stress-induced motor activity and anxiety by activating central Y4 receptors. Exptl. approach : We characterized [K30(PEG2)]hPP2-36 as long-acting Y4 receptor agonist and injected it peripherally into wildtype and Y4 receptor knockout (Y4KO) C57Bl/6NCrl mice to investigate the role of Y4 receptors in fear conditioning. Extinction and relapse after extinction was measured by spontaneous recovery and renewal. Key results : The Y4KO mice showed impaired cued and context fear extinction without affecting acquisition, consolidation or recall of fear. Correspondingly, peripheral injection of [K30(PEG2)]hPP2-36 facilitated extinction learning upon fasting, an effect that was long-lasting and generalized. Furthermore, peripherally applied [K30(PEG2)]hPP2-36 before extinction inhibited the activation of orexin-expressing neurons in the lateral hypothalamus in WT, but not in Y4KO mice. Conclusions and implications : Our findings suggests suppression of excessive arousal as a possible mechanism for the extinction-promoting effect of central Y4 receptors and provide strong evidence that fear extinction requires integration of vegetative stimuli with cortical and subcortical information, a process crucially depending on Y4 receptors. Importantly, in the lateral hypothalamus two peptide systems, PP and orexin, interact to generate an emotional response adapted to the current homeostatic state. Detailed investigations of feeding-relevant genes may thus deliver multiple intervention points for treating anxiety-related disorders.
  14. 14
    Zhang, L.; Bijker, M. S.; Herzog, H. The neuropeptide Y system: Pathophysiological and therapeutic implications in obesity and cancer. Pharmacol. Ther. 2011, 131, 91– 113,  DOI: 10.1016/j.pharmthera.2011.03.011
    Google Scholar
    14
    The neuropeptide Y system: Pathophysiological and therapeutic implications in obesity and cancer
    Zhang, Lei; Bijker, Martijn S.; Herzog, Herbert
    Pharmacology & Therapeutics (2011), 131 (1), 91-113CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)
    A review. The neuropeptide Y (NPY) system - comprising of neuropeptide Y, peptide YY, pancreatic polypeptide and the corresponding Y receptors through which they act (Y1, Y2, Y4, Y5 and y6) - is well known for its role in the regulation of energy homeostasis and assocd. processes. Dysfunctions of the system have been implicated in human diseases such as obesity and cancer, raising the possibility that correction of the system may provide therapeutic benefits for these diseases. In addn. to the regulation of appetite and satiety that has attracted most attention during the past years, insight has also been gained into the crit. role of NPY in the control of energy expenditure, oxidative fuel selection and bone metab. Studies using conditional knockout models further shed light on the central vs. peripheral, and hypothalamic vs. extra-hypothalamic mechanisms of these regulatory effects of NPY. Moreover, a role of NPY family peptides and Y receptors in modulating the growth of tumors has emerged. These findings provide the basis for novel NPY system-targeted strategies to treat obesity as well as cancer. Such strategies include modifying both sides of the energy balance equation - energy intake vs. energy expenditure - to achieve a greater wt./fat loss by particularly modulating peripheral Y receptor(s) to ameliorate metabolic conditions without interfering with central functions of Y receptors. In addn., targeting multiple Y receptors and/or multiple systems involved in the regulation of energy balance will have greater beneficial effects. However, long-term interference with the NPY system to target obesity or cancer related aspects needs to consider potential side effects on bone health.
  15. 15
    Yi, M.; Li, H.; Wu, Z.; Yan, J.; Liu, Q.; Ou, C.; Chen, M. A promising therapeutic target for metabolic diseases: Neuropeptide Y receptors in humans. Cell. Physiol. Biochem. 2018, 45, 88– 107,  DOI: 10.1159/000486225
    Google Scholar
    15
    A Promising Therapeutic Target for Metabolic Diseases: Neuropeptide Y Receptors in Humans
    Yi, Min; Li, Hekai; Wu, Zhiye; Yan, Jianyun; Liu, Qicai; Ou, Caiwen; Chen, Minsheng
    Cellular Physiology and Biochemistry (2018), 45 (1), 88-107CODEN: CEPBEW; ISSN:1015-8987. (S. Karger AG)
    Human neuropeptide Y (hNPY) is one of the most widely expressed neurotransmitters in the human central and peripheral nervous systems. It consists of 36 highly conserved amino acid residues, and was first isolated from the porcine hypothalamus in 1982. While it is the most recently discovered member of the pancreatic polypeptide family (which includes neuropeptide Y, gut-derived hormone peptide YY, and pancreatic polypeptide), NPY is the most abundant peptide found in the mammalian brain. In order to exert particular functions, NPY needs to bind to the NPY receptor to activate specific signaling pathways. NPY receptors belong to the class A or rhodopsin-like G-protein coupled receptor (GPCR) family and signal via cell-surface receptors. By binding to GPCRs, NPY plays a crucial role in various biol. processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Abnormal regulation of NPY is involved in the development of a wide range of diseases, including obesity, hypertension, atherosclerosis, epilepsy, metabolic disorders, and many cancers. Thus far, five receptors have been cloned from mammals (Y1, Y2, Y4, Y5, and y6), but only four of these (hY1, hY2, hY4, and hY5) are functional in humans. In this review, we summarize the structural characteristics of human NPY receptors and their role in metabolic diseases.
  16. 16
    Allen, M.; Reeves, J.; Mellor, G. High throughput fluorescence polarization: a homogeneous alternative to radioligand binding for cell surface receptors. J. Biomol. Screening 2000, 5, 63– 69,  DOI: 10.1177/108705710000500202
    Google Scholar
    16
    High throughput fluorescence polarization: a homogeneous alternative to radioligand binding for cell surface receptors
    Allen, Michael; Reeves, Julian; Mellor, Geoffrey
    Journal of Biomolecular Screening (2000), 5 (2), 63-69CODEN: JBISF3; ISSN:1087-0571. (Mary Ann Liebert, Inc.)
    High throughput fluorescence polarization (FP) assays are described that offer a nonradioactive, homogeneous, and low-cost alternative to radioligand binding assays for cell surface receptors (G protein-coupled receptors and ligand-gated ion channels). FP assays were shown to work across a range of both peptide (vasopressin V1a and δ-opioid) and nonpeptide (β1-adrenoceptor, 5-hydroxytryptamine3) receptors. Structure-activity relationships were investigated at β1-receptors and were found to be consistent with radioligand binding assays. FP was shown to tolerate up to 5% DMSO with no loss in sensitivity or signal window. From a random set of 1,280 compds., 1.9% were found to significantly interfere with FP measurement. If fluorescent or quenching compds. were eliminated (3% of all compds.), less than 0.4% of compds. were found to interfere with FP measurement. Assays could be run in 384-well plates with little loss of signal window or sensitivity compared to 96-well plate assays. New advances in FP measurement have therefore enabled FP to offer a high throughput alternative to radioligand binding for cell surface receptors.
  17. 17
    Leyris, J.-P.; Roux, T.; Trinquet, E.; Verdié, P.; Fehrentz, J.-A.; Oueslati, N.; Douzon, S.; Bourrier, E.; Lamarque, L.; Gagne, D. Homogeneous time-resolved fluorescence-based assay to screen for ligands targeting the growth hormone secretagogue receptor type 1a. Anal. Biochem. 2011, 408, 253– 262,  DOI: 10.1016/j.ab.2010.09.030
    Google Scholar
    17
    Homogeneous time-resolved fluorescence-based assay to screen for ligands targeting the growth hormone secretagogue receptor type 1a
    Leyris, Jean-Philippe; Roux, Thomas; Trinquet, Eric; Verdie, Pascal; Fehrentz, Jean-Alain; Oueslati, Nadia; Douzon, Stephanie; Bourrier, Emmanuel; Lamarque, Laurent; Gagne, Didier; Galleyrand, Jean-Claude; M'kadmi, Celine; Martinez, Jean; Mary, Sophie; Baneres, Jean-Louis; Marie, Jacky
    Analytical Biochemistry (2011), 408 (2), 253-262CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
    The growth hormone secretagogue receptor type 1a (GHS-R1a) belongs to class A G-protein-coupled receptors (GPCR). This receptor mediates pleiotropic effects of ghrelin and represents a promising target for dysfunctions of growth hormone secretion and energy homeostasis including obesity. Identification of new compds. which bind GHS-R1a is traditionally achieved using radioactive binding assays. Here we propose a new fluorescence-based assay, called Tag-lite binding assay, based on a fluorescence resonance energy transfer (FRET) process between a terbium cryptate covalently attached to a SNAP-tag fused GHS-R1a (SNAP-GHS-R1a) and a high-affinity red fluorescent ghrelin ligand. The long fluorescence lifetime of the terbium cryptate allows a time-resolved detection of the FRET signal. The assay was made compatible with high-throughput screening by using prelabeled cells in suspension under a 384-well plate format. Ki values for a panel of 14 compds. displaying agonist, antagonist, or inverse agonist properties were detd. using both the radioactive and the Tag-lite binding assays performed on the same batches of GHS-R1a-expressing cells. Compd. potencies obtained in the two assays were nicely correlated. This study is the first description of a sensitive and reliable nonradioactive binding assay for GHS-R1a in a format amenable to high-throughput screening.
  18. 18
    Emami-Nemini, A.; Roux, T.; Leblay, M.; Bourrier, E.; Lamarque, L.; Trinquet, E.; Lohse, M. J. Time-resolved fluorescence ligand binding for G protein–coupled receptors. Nat. Protoc. 2013, 8, 1307– 1320,  DOI: 10.1038/nprot.2013.073
    Google Scholar
    18
    Time-resolved fluorescence ligand binding for G protein-coupled receptors
    Emami-Nemini, Alexander; Roux, Thomas; Leblay, Marion; Bourrier, Emmanuel; Lamarque, Laurent; Trinquet, Eric; Lohse, Martin J.
    Nature Protocols (2013), 8 (7), 1307-1320, 14 pp.CODEN: NPARDW; ISSN:1750-2799. (Nature Publishing Group)
    G protein-coupled receptors (GPCRs) and their ligands are traditionally characterized by radioligand-binding expts. These expts. yield excellent quant. data, but have low temporal and spatial resoln. In addn., the use of radioligands presents safety concerns. Here we provide a general procedure for an alternative approach with high temporal and spatial resoln., based on Tb+-labeled fluorescent receptor ligands and time-resolved fluorescence resonance energy transfer (TR-FRET). This protocol and its design are detailed here for the parathyroid hormone receptor, a class B GPCR, and its fluorescently labeled 34-amino acid peptide ligand, but it can be easily modified for other receptors and their appropriately labeled ligands. We discuss three protocol options that use Tb+-labeled fluorescent ligands: a time-resolved fluorescence sepn. option that works on native receptors but requires sepn. of bound and unbound ligand; a TR-FRET option using SNAP-tag-labeled receptors for high-throughput screening; and a TR-FRET option that uses fluorescently labeled antibodies directed against an epitope engineered into the Flag-labeled receptors' N terminus. These protocol options can be used as std. procedures with very high signal-to-background ratios in order to characterize ligands and their receptors in living cells and in cell membranes via straightforward plate-reader measurements.
  19. 19
    Veiksina, S.; Kopanchuk, S.; Rinken, A. Budded baculoviruses as a tool for a homogeneous fluorescence anisotropy-based assay of ligand binding to G protein-coupled receptors: The case of melanocortin 4 receptors. Biochim. Biophys. Acta, Biomembr. 2014, 1838, 372– 381,  DOI: 10.1016/j.bbamem.2013.09.015
    Google Scholar
    19
    Budded baculoviruses as a tool for a homogeneous fluorescence anisotropy-based assay of ligand binding to G protein-coupled receptors: The case of melanocortin 4 receptors
    Veiksina, Santa; Kopanchuk, Sergei; Rinken, Ago
    Biochimica et Biophysica Acta, Biomembranes (2014), 1838 (1PB), 372-381CODEN: BBBMBS; ISSN:0005-2736. (Elsevier B.V.)
    We present here the implementation of budded baculoviruses that display G protein-coupled receptors on their surfaces for the investigation of ligand-receptor interactions using fluorescence anisotropy (FA). Melanocortin 4 (MC4) receptors and the fluorescent ligand Cy3B-NDP-α-MSH were used as the model system. The real-time monitoring of reactions and the high assay quality allow the application of global data anal. with kinetic mechanistic models that take into account the effect of nonspecific interactions and the depletion of the fluorescent ligand during the reaction. The receptor concn., affinity and kinetic parameters of fluorescent ligand binding as well as state anisotropies for different fluorescent ligand populations were detd. At low Cy3B-NDP-α-MSH concns., a one-site receptor-ligand binding model described the processes, whereas divergence from this model was obsd. at higher ligand concns., which indicated a more complex mechanism of interactions similar to those mechanisms that have been found in expts. with radioactive ligands. The information obtained from our kinetic expts. and the inherent flexibility of FA assays also allowed the estn. of binding parameters for several MC4 receptor-specific unlabeled compds. In summary, the FA assay that was developed with budded baculoviruses led the exptl. data to a level that would solve complex models of receptor-ligand interactions also for other receptor systems and would become as a valuable tool for the screening of pharmacol. active compds.
  20. 20
    Schiele, F.; Ayaz, P.; Fernández-Montalván, A. A universal homogeneous assay for high-throughput determination of binding kinetics. Anal. Biochem. 2015, 468, 42– 49,  DOI: 10.1016/j.ab.2014.09.007
    Google Scholar
    20
    A universal homogeneous assay for high-throughput determination of binding kinetics
    Schiele, Felix; Ayaz, Pelin; Fernandez-Montalvan, Amaury
    Analytical Biochemistry (2015), 468 (), 42-49CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
    There is an increasing demand for assay technologies that enable accurate, cost-effective, and high-throughput measurements of drug-target assocn. and dissocn. rates. Here the authors introduce a universal homogeneous kinetic probe competition assay (kPCA) that meets these requirements. The time-resolved fluorescence energy transfer (TR-FRET) procedure combines the versatility of radioligand binding assays with the advantages of homogeneous nonradioactive techniques while approaching the time resoln. of surface plasmon resonance (SPR) and related biosensors. The authors show application of kPCA for three important target classes: enzymes, protein-protein interactions, and G protein-coupled receptors (GPCRs). This method is capable of supporting early stages of drug discovery with large amts. of kinetic information.
  21. 21
    Antoine, T.; Ott, D.; Ebell, K.; Hansen, K.; Henry, L.; Becker, F.; Hannus, S. Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy. Anal. Biochem. 2016, 502, 24– 35,  DOI: 10.1016/j.ab.2016.02.017
    Google Scholar
    21
    Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy
    Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan
    Analytical Biochemistry (2016), 502 (), 24-35CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
    G protein-coupled receptors (GPCRs) mediate many important physiol. functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of exptl. approaches for screening compd. libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small mols., and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput detn. of receptor-ligand binding affinities and kinetic rate consts. for various therapeutically relevant GPCRs.
  22. 22
    Stoddart, L. A.; White, C. W.; Nguyen, K.; Hill, S. J.; Pfleger, K. D. Fluorescence- and bioluminescence-based approaches to study GPCR ligand binding. Br. J. Pharmacol. 2016, 173, 3028– 3037,  DOI: 10.1111/bph.13316
    Google Scholar
    22
    Fluorescence- and bioluminescence-based approaches to study GPCR ligand binding
    Stoddart, Leigh A.; White, Carl W.; Nguyen, Kim; Hill, Stephen J.; Pfleger, Kevin D. G.
    British Journal of Pharmacology (2016), 173 (20), 3028-3037CODEN: BJPCBM; ISSN:1476-5381. (Wiley-Blackwell)
    Ligand binding is a vital component of any pharmacologist's toolbox and allows the detailed investigation of how a mol. binds to its receptor. These studies enable the exptl. detn. of binding affinity of labeled and unlabeled compds. through kinetic, satn. (Kd) and competition (Ki) binding assays. Traditionally, these studies have used mols. labeled with radioisotopes; however, more recently, fluorescent ligands have been developed for this purpose. This review will briefly cover receptor ligand binding theory and then discuss the use of fluorescent ligands with some of the different technologies currently employed to examine ligand binding. Fluorescent ligands can be used for direct measurement of receptor-assocd. fluorescence using confocal microscopy and flow cytometry as well as in assays such as fluorescence polarization, where ligand binding is monitored by changes in the free rotation when a fluorescent ligand is bound to a receptor. Addnl., fluorescent ligands can act as donors or acceptors for fluorescence resonance energy transfer (FRET) with the development of assays based on FRET and time-resolved FRET (TR-FRET). Finally, we have recently developed a novel bioluminescence resonance energy transfer (BRET) ligand binding assay utilizing a small (19 kDa), super-bright luciferase subunit (NanoLuc) from a deep sea shrimp. In combination with fluorescent ligands, measurement of RET now provides an array of methodologies to study ligand binding. While each method has its own advantages and drawbacks, binding studies using fluorescent ligands are now a viable alternative to the use of radioligands.
  23. 23
    Stoddart, L. A.; Kilpatrick, L. E.; Hill, S. J. NanoBRET approaches to study ligand binding to GPCRs and RTKs. Trends Pharmacol. Sci. 2018, 39, 136– 147,  DOI: 10.1016/j.tips.2017.10.006
    Google Scholar
    23
    NanoBRET Approaches to Study Ligand Binding to GPCRs and RTKs
    Stoddart, Leigh A.; Kilpatrick, Laura E.; Hill, Stephen J.
    Trends in Pharmacological Sciences (2018), 39 (2), 136-147CODEN: TPHSDY; ISSN:0165-6147. (Elsevier Ltd.)
    Recent advances in the development of fluorescent ligands for G-protein-coupled receptors (GPCRs) and receptor tyrosine kinase receptors (RTKs) have facilitated the study of these receptors in living cells. A limitation of these ligands is potential uptake into cells and increased nonspecific binding. However, this can largely be overcome by using proximity approaches, such as bioluminescence resonance energy transfer (BRET), which localize the signal (within 10 nm) to the specific receptor target. The recent engineering of NanoLuc has resulted in a luciferase variant that is smaller and significantly brighter (up to tenfold) than existing variants. Here, we review the use of BRET from N-terminal NanoLuc-tagged GPCRs or a RTK to a receptor-bound fluorescent ligand to provide quant. pharmacol. of ligand-receptor interactions in living cells in real time.
  24. 24
    Iliopoulos-Tsoutsouvas, C.; Kulkarni, R. N.; Makriyannis, A.; Nikas, S. P. Fluorescent probes for G-protein-coupled receptor drug discovery. Expert Opin. Drug Discovery 2018, 13, 933– 947,  DOI: 10.1080/17460441.2018.1518975
    Google Scholar
    24
    Fluorescent probes for G-protein-coupled receptor drug discovery
    Iliopoulos-Tsoutsouvas, Christos; Kulkarni, Rohit N.; Makriyannis, Alexandros; Nikas, Spyros P.
    Expert Opinion on Drug Discovery (2018), 13 (10), 933-947CODEN: EODDBX; ISSN:1746-0441. (Taylor & Francis Ltd.)
    A review. G-protein-coupled receptors (GPCRs) mediate the effects of approx. 33% of all marketed drugs. The development of tools to study GPCR pharmacol. is urgently needed as it can lead to the discovery of safer and more effective medications. Fluorescent GPCR ligands represent highly sensitive and safe small-mol. tools for real-time exploration of the life of the receptor, cellular signaling, and ligand-/receptor-receptor interactions in cellulo and/or in vivo.: This review summarizes relevant information from published literature and provides crit. insights into the design of successful small-mol. fluorescent probes for Class A GPCRs as potential major targets for drug development.: Considering the rapid progress of fluorescence technologies, effective small-mol. fluorescent probes represent valuable pharmacol. tools for studying GPCRs. However, the design and development of such probes are challenging, largely due to the low affinity/specificity of the probe for its target, inadequate photophys. properties, extensive non-specific binding, and/or low signal-to-noise ratio. Generally speaking, fluorescent and luminescent small-mol. probes, receptors, and G proteins in combination with FRET and BRET technologies hold great promise for studying kinetic profiles of GPCR signaling.
  25. 25
    Ziemek, R.; Schneider, E.; Kraus, A.; Cabrele, C.; Beck-Sickinger, A. G.; Bernhardt, G.; Buschauer, A. Determination of affinity and activity of ligands at the human neuropeptide Y Y4 receptor by flow cytometry and aequorin luminescence. J. Recept. Signal Transduction 2007, 27, 217– 233,  DOI: 10.1080/10799890701505206
    Google Scholar
    25
    Determination of Affinity and Activity of Ligands at the Human Neuropeptide Y Y4 Receptor by Flow Cytometry and Aequorin Luminescence
    Ziemek, Ralf; Schneider, Erich; Kraus, Anja; Cabrele, Chiara; Beck-Sickinger, Annette G.; Bernhardt, Guenther; Buschauer, Armin
    Journal of Receptors and Signal Transduction (2007), 27 (4), 217-233CODEN: JRSTCT ISSN:. (Informa Healthcare)
    Fluorescence-labeled neuropeptide Y (NPY) has been used in flow cytometric binding assays for the detn. of affinity consts. of NPY Y1, Y2, and Y5 receptor ligands. Because the binding of fluorescent NPY is insufficient for competition studies at the human Y4 receptor (hY4R), the authors replaced Glu 4 in hPP with Lys for the derivatization with cyanine-5. Because cy5-[K4]hPP has high affinity (Kd 5.6 nM) to the hY4R, it was used as a probe in a flow cytometric binding assay. Specific binding of cy5-[K4]hPP to hY4R was visualized by confocal microscopy. The hY4R, the chimeric G protein Gqi5 and mitochondrially targeted apoaequorin were stably coexpressed in CHO cells. Aequorin luminescence was quantified in a microplate reader and by a CCD camera. By application of these methods 3-cyclohexyl-N-[(3-1H-imidazol-4-ylpropylamino)(imino)methyl]propanamide (UR-AK49)was discovered as the first nonpeptidic Y4R antagonist (pKi 4.17), a lead to be optimized in terms of potency and selectivity.
  26. 26
    Dukorn, S.; Littmann, T.; Keller, M.; Kuhn, K.; Cabrele, C.; Baumeister, P.; Bernhardt, G.; Buschauer, A. Fluorescence- and radiolabeling of [Lys4,Nle17,30]hPP yields molecular tools for the NPY Y4 receptor. Bioconjugate Chem. 2017, 28, 1291– 1304,  DOI: 10.1021/acs.bioconjchem.7b00103
    Google Scholar
    26
    Fluorescence- and Radiolabeling of [Lys4,Nle17,30]hPP Yields Molecular Tools for the NPY Y4 Receptor
    Dukorn, Stefanie; Littmann, Timo; Keller, Max; Kuhn, Kilian; Cabrele, Chiara; Baumeister, Paul; Bernhardt, Guenther; Buschauer, Armin
    Bioconjugate Chemistry (2017), 28 (4), 1291-1304CODEN: BCCHES; ISSN:1043-1802. (American Chemical Society)
    The neuropeptide Y (NPY) Y4 receptor (Y4R) is involved in energy homeostasis and considered a potential drug target for the treatment of obesity. Only a few mol. tools, i.e., radiolabeled and fluorescent ligands, for the investigation of the Y4R were reported. Previously, [Lys4]hPP proved to be an appropriate full-length PP analog to prep. a fluorescent ligand by derivatization at the ε-amino group. To preclude oxidn. upon long-term storage, the authors replaced the two methionine residues in [Lys4]hPP by norleucine and prepd. the corresponding [3H]propionylated ([3H]12) and cyanine labeled (13) peptides, which were characterized and compared with a set of ref. compds. in binding (Y1, Y2, Y4, and Y5 receptors) and functional (luciferase gene reporter, beta-arrestin-1,2) Y4R assays. Both mol. probes proved to be useful in radiochem. and flow cytometric satn. and competition Y4R binding expts. Most strikingly, there was a different influence of the compn. of buffer on equil. binding and kinetics: [3H]12 affinity (Kd in Na+-free buffer: 1.1 nM) clearly decreased with increasing sodium ion concn., whereas dissocn. and Y4R-mediated internalization of 13 (Kd in Na+-free buffer: 10.8 nM) were strongly affected by the osmolarity of the buffer as demonstrated by confocal microscopy. Displacement of [3H]12 and 13 revealed a tendency to higher apparent affinities for a set of ref. peptides in hypotonic (Na+-free) compared to isotonic buffers. The differences were negligible in the case of hPP but up to 270-fold in the case of GW1229 (GR231118). By contrast, no relevant influence of Na+ on Y5R affinity became obvious, when the radioligands [H]12 and [3H]propionyl-pNPY were investigated in satn. binding and competition binding.
  27. 27
    Tang, T.; Tan, Q.; Han, S.; Diemar, A.; Löbner, K.; Wang, H.; Schüß, C.; Behr, V.; Mörl, K.; Wang, M.; Chu, X.; Yi, C.; Keller, M.; Kofoed, J.; Reedtz-Runge, S.; Kaiser, A.; Beck-Sickinger, A. G.; Zhao, Q.; Wu, B. Receptor-specific recognition of NPY peptides revealed by structures of NPY receptors. Sci. Adv. 2022, 8, eabm1232  DOI: 10.1126/sciadv.abm1232
    Google Scholar
    There is no corresponding record for this reference.
  28. 28
    Kuhn, K. K.; Littmann, T.; Dukorn, S.; Tanaka, M.; Keller, M.; Ozawa, T.; Bernhardt, G.; Buschauer, A. In search of NPY Y4R antagonists: Incorporation of carbamoylated arginine, aza-amino acids, or D-amino acids into oligopeptides derived from the C-termini of the endogenous agonists. ACS Omega 2017, 2, 3616– 3631,  DOI: 10.1021/acsomega.7b00451
    Google Scholar
    28
    In Search of NPY Y4R Antagonists: Incorporation of Carbamoylated Arginine, Aza-Amino Acids, or D-Amino Acids into Oligopeptides Derived from the C-Termini of the Endogenous Agonists
    Kuhn, Kilian K.; Littmann, Timo; Dukorn, Stefanie; Tanaka, Miho; Keller, Max; Ozawa, Takeaki; Bernhardt, Guenther; Buschauer, Armin
    ACS Omega (2017), 2 (7), 3616-3631CODEN: ACSODF; ISSN:2470-1343. (American Chemical Society)
    The crosslinked pentapeptides (2R,7R)-diaminooctanedioyl-bis(Tyr-Arg-Leu-Arg-Tyr-amide) ((2R,7R)-BVD-74D, (2R,7R)-1) and octanedioyl-bis(Tyr-Arg-Leu-Arg-Tyr-amide) (2) as well as the pentapeptide Ac-Tyr-Arg-Leu-Arg-Tyr-amide (3) were previously described as neuropeptide Y Y4 receptor (Y4R) partial agonists. Here the authors report on a series of analogs of (2R,7R)-1 and 2 in which Arg2, Leu3 or Arg4 were replaced by the resp. aza-amino acids. The replacement of Arg2 in 3 with a carbamoylated arginine building block and the extension of the N-terminus by an addnl. arginine led to the high-affinity hexapeptide Ac-Arg-Tyr-Nω-[(4-aminobutyl)aminocarbonyl]Arg-Leu-Arg-Tyr-amide that was used as a precursor for a D-amino acid scan. The target compds. were investigated for Y4R functional activity in assays with complementary readouts: aequorin Ca2+ and β-arrestin 1 or β-arrestin 2 assays. In contrast to the parent compds., which are Y4R agonists, several ligands were able to suppress the effect elicited by the endogenous ligand pancreatic polypeptide and therefore represent a novel class of peptide Y4R antagonists.
  29. 29
    Spinnler, K.; von Krüchten, L.; Konieczny, A.; Schindler, L.; Bernhardt, G.; Keller, M. An alkyne-functionalized arginine for solid-phase synthesis enabling “bioorthogonal” peptide conjugation. ACS Med. Chem. Lett. 2020, 11, 334– 339,  DOI: 10.1021/acsmedchemlett.9b00388
    Google Scholar
    29
    An alkyne-functionalized arginine for solid-phase synthesis enabling "bioorthogonal" peptide conjugation
    Spinnler, Katrin; von Kruechten, Lara; Konieczny, Adam; Schindler, Lisa; Bernhardt, Guenther; Keller, Max
    ACS Medicinal Chemistry Letters (2020), 11 (3), 334-339CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)
    Lately, amino-functionalized Nω-carbamoylated arginines were introduced as arginine surrogates enabling peptide labeling. However, this approach is hardly compatible with peptides also contg. lysine or cysteine. Here, we present the synthesis of an alkyne-functionalized, Nω-carbamoylated arginine building block, which is compatible with Fmoc-strategy solid-phase peptide synthesis. The alkynylated arginine was incorporated into three biol. active linear hexapeptides and into a cyclic pentapeptide. Peptide conjugation to an azido-functionalized fluorescent dye via "click" chem. was successfully demonstrated. In the case of a peptide also contg. lysine besides the alkyne-functionalized arginine, this was feasible in a "bioorthogonal" manner.
  30. 30
    Konieczny, A.; Conrad, M.; Ertl, F. J.; Gleixner, J.; Gattor, A. O.; Grätz, L.; Schmidt, M. F.; Neu, E.; Horn, A. H. C.; Wifling, D.; Gmeiner, P.; Clark, T.; Sticht, H.; Keller, M. N-terminus to arginine side-chain cyclization of linear peptidic neuropeptide Y Y4 receptor ligands results in picomolar binding constants. J. Med. Chem. 2021, 64, 16746– 16769,  DOI: 10.1021/acs.jmedchem.1c01574
    Google Scholar
    30
    N-Terminus to arginine side-chain cyclization of linear peptidic neuropeptide Y Y4 receptor ligands results in picomolar binding constants
    Konieczny, Adam; Conrad, Marcus; Ertl, Fabian J.; Gleixner, Jakob; Gattor, Albert O.; Graetz, Lukas; Schmidt, Maximilian F.; Neu, Eduard; Horn, Anselm H. C.; Wifling, David; Gmeiner, Peter; Clark, Timothy; Sticht, Heinrich; Keller, Max
    Journal of Medicinal Chemistry (2021), 64 (22), 16746-16769CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    The family of neuropeptide Y (NPY) receptors comprises four subtypes (Y1R, Y2R, Y4R, Y5R), which are addressed by at least three endogenous peptides, i.e., NPY, peptide YY, and pancreatic polypeptide (PP), the latter showing a preference for Y4R. A series of cyclic oligopeptidic Y4R ligands were prepd. by applying a novel approach, i.e., N-terminus to arginine side-chain cyclization. Most peptides acted as Y4R partial agonists, showing up to 60-fold higher Y4R affinity compared to the linear precursor peptides. Two cyclic hexapeptides (I) [cyclo[succinyl-Arg-Tyr-Arg(CO-NH-(CH2)4-NH)]-Leu-Arg-Tyr-NH2] and (II) [cyclo[succinyl-Arg-Trp-Arg(CO-NH-(CH2)4-NH)]-Leu-Arg-Tyr-NH2] showed higher Y4R potency (Ca2+ aequorin assay) and, with pKi values >10, also higher Y4R affinity compared to human pancreatic polypeptide (hPP). Compds. such as I and II exhibiting considerably lower mol. wt. and considerably more pronounced Y4R selectivity than PP and previously described dimeric peptidic ligands with high Y4R affinity, represent promising leads for the prepn. of labeled tool compds. and might support the development of drug-like Y4R ligands.
  31. 31
    Gleixner, J.; Gattor, A. O.; Humphrys, L. J.; Brunner, T.; Keller, M. 3H]UR-JG102 - a radiolabeled cyclic peptide with high affinity and excellent selectivity for the neuropeptide Y Y4 receptor. J. Med. Chem. 2023, 66, 13788– 13808,  DOI: 10.1021/acs.jmedchem.3c01224
    Google Scholar
    There is no corresponding record for this reference.
  32. 32
    Keller, M.; Kuhn, K. K.; Einsiedel, J.; Hübner, H.; Biselli, S.; Mollereau, C.; Wifling, D.; Svobodová, J.; Bernhardt, G.; Cabrele, C.; Vanderheyden, P. M. L.; Gmeiner, P.; Buschauer, A. Mimicking of arginine by functionalized Nω-carbamoylated arginine as a new broadly applicable approach to labeled bioactive peptides: high affinity angiotensin, neuropeptide Y, neuropeptide FF, and neurotensin receptor ligands as examples. J. Med. Chem. 2016, 59, 1925– 1945,  DOI: 10.1021/acs.jmedchem.5b01495
    Google Scholar
    32
    Mimicking of Arginine by Functionalized Nω-Carbamoylated Arginine As a New Broadly Applicable Approach to Labeled Bioactive Peptides: High Affinity Angiotensin, Neuropeptide Y, Neuropeptide FF, and Neurotensin Receptor Ligands As Examples
    Keller, Max; Kuhn, Kilian K.; Einsiedel, Juergen; Huebner, Harald; Biselli, Sabrina; Mollereau, Catherine; Wifling, David; Svobodova, Jaroslava; Bernhardt, Guenther; Cabrele, Chiara; Vanderheyden, Patrick M. L.; Gmeiner, Peter; Buschauer, Armin
    Journal of Medicinal Chemistry (2016), 59 (5), 1925-1945CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Derivatization of biol. active peptides by conjugation with fluorophores or radionuclide-bearing moieties is an effective and commonly used approach to prep. mol. tools and diagnostic agents. Whereas lysine, cysteine, and N-terminal amino acids have been mostly used for peptide conjugation, we describe a new, widely applicable approach to peptide conjugation based on the nonclassical bioisosteric replacement of the guanidine group in arginine by a functionalized carbamoylguanidine moiety. Four arginine-contg. peptide receptor ligands (angiotensin II, neurotensin(8-13), an analog of the C-terminal pentapeptide of neuropeptide Y, and a neuropeptide FF analog) were subject of this proof-of-concept study. The Nω-carbamoylated arginines, bearing spacers with a terminal amino group, were incorporated into the peptides by std. Fmoc solid phase peptide synthesis. The synthesized chem. stable peptide derivs. showed high receptor affinities with Ki values in the low nanomolar range, even when bulky fluorophores had been attached. Two new tritiated tracers for angiotensin and neurotensin receptors are described.
  33. 33
    Keller, M.; Weiss, S.; Hutzler, C.; Kuhn, K. K.; M?llereau, C.; Dukorn, S.; Schindler, L.; Bernhardt, G.; König, B.; Buschauer, A. Nω-carbamoylation of the argininamide moiety: An avenue to insurmountable NPY Y1 receptor antagonists and a radiolabeled selective high-affinity molecular tool ([3H]UR-MK299) with extended residence time. J. Med. Chem. 2015, 58, 8834– 8849,  DOI: 10.1021/acs.jmedchem.5b00925
    Google Scholar
    33
    Nω-Carbamoylation of the Argininamide Moiety: An Avenue to Insurmountable NPY Y1 Receptor Antagonists and a Radiolabeled Selective High-Affinity Molecular Tool ([3H]UR-MK299) with Extended Residence Time
    Keller, Max; Weiss, Stefan; Hutzler, Christoph; Kuhn, Kilian K.; Mollereau, Catherine; Dukorn, Stefanie; Schindler, Lisa; Bernhardt, Guenther; Koenig, Burkhard; Buschauer, Armin
    Journal of Medicinal Chemistry (2015), 58 (22), 8834-8849CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Analogs of the argininamide-type NPY Y1 receptor (Y1R) antagonist BIBP3226, bearing carbamoyl moieties at the guanidine group, revealed subnanomolar Ki values and caused depression of the maximal response to NPY (calcium assay) by up to 90% in a concn.- and time-dependent manner, suggesting insurmountable antagonism. To gain insight into the mechanism of binding of the synthesized compds., a tritiated antagonist, (R)-Nα-diphenylacetyl-Nω-[2-([2,3-3H]propionylamino)ethyl]aminocarbonyl-(4-hydroxybenzyl)arginin-amide ([3H]UR-MK299, [3H]38), was prepd. [3H]38 revealed a dissocn. const. in the picomolar range (Kd 0.044 nM, SK-N-MC cells) and very high Y1R selectivity. Apart from superior affinity, a considerably lower target off-rate (t1/2 95 min) was characteristic of [3H]38 compared to that of the higher homolog contg. a tetramethylene instead of an ethylene spacer (t1/2 3 min, Kd 2.0 nM). Y1R binding of [3H]38 was fully reversible and fully displaceable by nonpeptide antagonists and the agonist pNPY. Therefore, the insurmountable antagonism obsd. in the functional assay has to be attributed to the extended target-residence time, a phenomenon of relevance in drug research beyond the NPY receptor field.
  34. 34
    Konieczny, A.; Braun, D.; Wifling, D.; Bernhardt, G.; Keller, M. Oligopeptides as neuropeptide Y Y4 receptor ligands: identification of a high-affinity tetrapeptide agonist and a hexapeptide antagonist. J. Med. Chem. 2020, 63, 8198– 8215,  DOI: 10.1021/acs.jmedchem.0c00426
    Google Scholar
    34
    Oligopeptides as Neuropeptide Y Y4 Receptor Ligands: Identification of a High-Affinity Tetrapeptide Agonist and a Hexapeptide Antagonist
    Konieczny, Adam; Braun, Diana; Wifling, David; Bernhardt, Guenther; Keller, Max
    Journal of Medicinal Chemistry (2020), 63 (15), 8198-8215CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Within the family of neuropeptide Y (NPY) receptors, the Y4 receptor (Y4R) is unique as it prefers pancreatic polypeptide (PP) over NPY and peptide YY (PYY). Today, low mol. wt. Y4R ligands are lacking, in particular antagonists. We synthesized a series of peptidic NPY Y4R ligands, derived from the hexapeptide acetyl-Arg-Tyr-Arg-Leu-Arg-Tyr-NH2 (1), reported to be a Y4R partial agonist with high affinity (pKi Y4R: 8.43). Peptide 1 was N-terminally extended as well as truncated, subjected to a D-amino acid scan, and Leu was replaced by different amino acids. Compds. were characterized by radioligand competition binding and functional studies (Cai2+ mobilization and β-arrestin 1/2 recruitment). N-terminal truncation of 1 resulted in a tetrapeptide (Arg-Leu-Arg-Tyr-NH2) being a Y4R partial agonist with retained Y4R affinity (pKi: 8.47). Remarkably, replacement of Leu in 1 and in derivs. of 1 by Trp turned Y4R agonism to antagonism, giving Y4R antagonists with pKi values ≤ 7.57.
  35. 35
    Kuhn, K. K.; Ertl, T.; Dukorn, S.; Keller, M.; Bernhardt, G.; Reiser, O.; Buschauer, A. High affinity agonists of the neuropeptide Y (NPY) Y4 receptor derived from the C-terminal pentapeptide of human pancreatic polypeptide (hPP): Synthesis, stereochemical discrimination, and radiolabeling. J. Med. Chem. 2016, 59, 6045– 6058,  DOI: 10.1021/acs.jmedchem.6b00309
    Google Scholar
    35
    High Affinity Agonists of the Neuropeptide Y (NPY) Y4 Receptor Derived from the C-Terminal Pentapeptide of Human Pancreatic Polypeptide (hPP): Synthesis, Stereochemical Discrimination, and Radiolabeling
    Kuhn, Kilian K.; Ertl, Thomas; Dukorn, Stefanie; Keller, Max; Bernhardt, Guenther; Reiser, Oliver; Buschauer, Armin
    Journal of Medicinal Chemistry (2016), 59 (13), 6045-6058CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    The diastereomeric mixt. of D/L-2,7-diaminooctanedioyl-bis(YRLRY-NH2) (BVD-74D, 2) was described in the literature as a high affinity Y4 receptor agonist. Here we report on the synthesis and pharmacol. characterization of the pure diastereomers (2R,7R)- and (2S,7S)-2 and a series of homo- and heterodimeric analogs in which octanedioic acid was used as an achiral linker. To investigate the role of the Arg residues, one or two arginines were replaced by Ala. Moreover, Nω-(6-aminohexylaminocarbonyl)Arg was introduced as an arginine replacement (17). (2R,7R)-2 was superior to (2S,7S)-2 in binding and functional cellular assays and equipotent with 17. [3H]Propionylation of one amino group in the linker of (2R,7R)-2 or at the primary amino group in 17 resulted in high affinity Y4R radioligands ([3H]-(2R,7R)-10, [3H]18) with subnanomolar Kd values.
  36. 36
    Berlicki, Ł.; Kaske, M.; Gutiérrez-Abad, R.; Bernhardt, G.; Illa, O.; Ortuño, R. M.; Cabrele, C.; Buschauer, A.; Reiser, O. Replacement of Thr32 and Gln34 in the C-terminal neuropeptide Y fragment 25–36 by cis-cyclobutane and cis-cyclopentane β-amino acids shifts selectivity toward the Y4 receptor. J. Med. Chem. 2013, 56, 8422– 8431,  DOI: 10.1021/jm4008505
    Google Scholar
    36
    Replacement of Thr32 and Gln34 in the C-Terminal Neuropeptide Y Fragment 25-36 by cis-Cyclobutane and cis-Cyclopentane β Amino Acids Shifts Selectivity toward the Y4 Receptor
    Berlicki, Lukasz; Kaske, Melanie; Gutierrez-Abad, Raquel; Bernhardt, Guenther; Illa, Ona; Ortuno, Rosa M.; Cabrele, Chiara; Buschauer, Armin; Reiser, Oliver
    Journal of Medicinal Chemistry (2013), 56 (21), 8422-8431CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Neuropeptide Y (NPY) and pancreatic polypeptide (PUP) control central and peripheral processes by activating the G protein coupled receptors YxR (x = 1, 2, 4, 5). We present analogs of the C-terminal fragments 25-36 and 32-36 of NPY and PP contg. (1R,2S)-cyclobutane (βCbu) or (1R,2S)-cyclopentane (βCpe) β-amino acids, which display exclusively Y4R affinity. In particular, [βCpe34]-NPY-(25-36) is a Y4R selective partial agonist (EC50 41 nM, Emax 71%) that binds Y4R with a Ki of 10 nM and a selectivity >100-fold relative to Y1R and Y2R and >50-fold relative to Y5R. Comparably, [Y32, βCpe34]-NPY-(PP)-(32-36) selectively binds and activates Y4R (EC50 94 nM, Emax 73%). The NMR structure of [βCpe34]-NPY-(25-36) in dodecylphosphatidylcholine micelles shows a short helix at residues 27-32, while the C-terminal segment R33βCpe34R35Y36 is extended. The biol. properties of the βCbu- or βCpe-contg. NPY and PP C-terminal fragments encourage the future application of these β-amino acids in the synthesis of selective Y4R ligands.
  37. 37
    Wirth, U.; Erl, J.; Azzam, S.; Höring, C.; Skiba, M.; Singh, R.; Hochmuth, K.; Keller, M.; Wegener, J.; König, B. Monitoring the reversibility of GPCR signaling by combining photochromic ligands with label-free impedance analysis. Angew. Chem., Int. Ed. 2023, 62, e202215547  DOI: 10.1002/anie.202215547
    Google Scholar
    37
    Monitoring the Reversibility of GPCR Signaling by Combining Photochromic Ligands with Label-free Impedance Analysis
    Wirth, Ulrike; Erl, Julia; Azzam, Saphia; Horing, Carina; Skiba, Michael; Singh, Ritu; Hochmuth, Kathrin; Keller, Max; Wegener, Joachim; Konig, Burkhard
    Angewandte Chemie, International Edition (2023), 62 (21), e202215547CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)
    G protein-coupled cell surface receptors (GPCR) trigger complex intracellular signaling cascades upon agonist binding. Classic pharmacol. assays provide information about binding affinities, activation or blockade at different stages of the signaling cascade, but real time dynamics and reversibility of these processes remain often disguised. We show that combining photochromic NPY receptor ligands, which can be toggled in their receptor activation ability by irradn. with light of different wavelengths, with whole cell label-free impedance assays allows observing the cell response to receptor activation and its reversibility over time. The concept demonstrated on NPY receptors may be well applicable to many other GPCRs providing a deeper insight into the time course of intracellular signaling processes.
  38. 38
    Archipowa, N.; Wittmann, L.; Köckenberger, J.; Ertl, F. J.; Gleixner, J.; Keller, M.; Heinrich, M. R.; Kutta, R. J. Characterization of fluorescent dyes frequently used for bioimaging: Photophysics and photocatalytical reactions with proteins. J. Phys. Chem. B 2023, 127, 9532– 9542,  DOI: 10.1021/acs.jpcb.3c04484
    Google Scholar
    There is no corresponding record for this reference.
  39. 39
    Keller, M.; Mahuroof, S. A.; Yee, V. H.; Carpenter, J.; Schindler, L.; Littmann, T.; Pegoli, A.; Hübner, H.; Bernhardt, G.; Gmeiner, P.; Holliday, N. D. Fluorescence labeling of neurotensin(8–13) via arginine residues gives molecular tools with high receptor affinity. ACS Med. Chem. Lett. 2020, 11, 16– 22,  DOI: 10.1021/acsmedchemlett.9b00462
    Google Scholar
    39
    Fluorescence labeling of neurotensin(8-13) via arginine residues gives molecular tools with high receptor affinity
    Keller, Max; Mahuroof, Shahani A.; Hong Yee, Vivyanne; Carpenter, Jessica; Schindler, Lisa; Littmann, Timo; Pegoli, Andrea; Huebner, Harald; Bernhardt, Guenther; Gmeiner, Peter; Holliday, Nicholas D.
    ACS Medicinal Chemistry Letters (2020), 11 (1), 16-22CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)
    Fluorescence-labeled receptor ligands have emerged as valuable mol. tools, being indispensable for studying receptor-ligand interactions by fluorescence-based techniques such as high-content imaging, fluorescence microscopy, and fluorescence polarization. Through application of a new labeling strategy for peptides, a series of fluorescent neurotensin(8-13) derivs. was synthesized by attaching red-emitting fluorophores (indolinium- and pyridinium-type cyanine dyes) to carbamoylated arginine residues in neurotensin(8-13) analogs, yielding fluorescent probes with high NTS1R affinity (pKi values: 8.15-9.12) and potency (pEC50 values (Ca2+ mobilization): 8.23-9.43). Selected fluorescent ligands were investigated by flow cytometry and high-content imaging (satn. binding, kinetic studies, and competition binding) as well as by confocal microscopy using intact CHO-hNTS1R cells. The study demonstrates the applicability of the fluorescent probes as mol. tools to obtain, for example, information about the localization of receptors in cells and to det. binding affinities of nonlabeled ligands.
  40. 40
    Müller, C.; Gleixner, J.; Tahk, M.-J.; Kopanchuk, S.; Laasfeld, T.; Weinhart, M.; Schollmeyer, D.; Betschart, M. U.; Lüdeke, S.; Koch, P.; Rinken, A.; Keller, M. Structure-based design of high-affinity fluorescent probes for the neuropeptide Y Y1 receptor. J. Med. Chem. 2022, 65, 4832– 4853,  DOI: 10.1021/acs.jmedchem.1c02033
    Google Scholar
    40
    Structure-based design of high-affinity fluorescent probes for the neuropeptide Y Y1 receptor
    Mueller, Christoph; Gleixner, Jakob; Tahk, Maris-Johanna; Kopanchuk, Sergei; Laasfeld, Tonis; Weinhart, Michael; Schollmeyer, Dieter; Betschart, Martin U.; Luedeke, Steffen; Koch, Pierre; Rinken, Ago; Keller, Max
    Journal of Medicinal Chemistry (2022), 65 (6), 4832-4853CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    The recent crystn. of the neuropeptide Y Y1 receptor (Y1R) in complex with the argininamide-type Y1R selective antagonist UR-MK299 (2) opened up a new approach toward structure-based design of nonpeptidic Y1R ligands. We designed novel fluorescent probes showing excellent Y1R selectivity and, in contrast to previously described fluorescent Y1R ligands, considerably higher (~ 100-fold) binding affinity. This was achieved through the attachment of different fluorescent dyes to the diphenylacetyl moiety in 2 via an amine-functionalized linker. The fluorescent ligands exhibited picomolar Y1R binding affinities (pKi values of 9.36-9.95) and proved to be Y1R antagonists, as validated in a Fura-2 calcium assay. The versatile applicability of the probes as tool compds. was demonstrated by flow cytometry- and fluorescence anisotropy-based Y1R binding studies (satn. and competition binding and assocn. and dissocn. kinetics) as well as by widefield and total internal reflection fluorescence (TIRF) microscopy of live tumor cells, revealing that fluorescence was mainly localized at the plasma membrane.
  41. 41
    Keller, M.; Erdmann, D.; Pop, N.; Pluym, N.; Teng, S.; Bernhardt, G.; Buschauer, A. Red-fluorescent argininamide-type NPY Y1 receptor antagonists as pharmacological tools. Biorg. Med. Chem. 2011, 19, 2859– 2878,  DOI: 10.1016/j.bmc.2011.03.045
    Google Scholar
    41
    Red-fluorescent argininamide-type NPY Y1 receptor antagonists as pharmacological tools
    Keller, Max; Erdmann, Daniela; Pop, Nathalie; Pluym, Nikola; Teng, Shangjun; Bernhardt, Guenther; Buschauer, Armin
    Bioorganic & Medicinal Chemistry (2011), 19 (9), 2859-2878CODEN: BMECEP; ISSN:0968-0896. (Elsevier B.V.)
    Fluorescently labeled NPY Y1 receptor (Y1R) ligands were synthesized by connecting pyrylium and cyanine dyes with the argininamide-type Y1R antagonist core structure by linkers, covering a wide variety in length and chem. nature, attached to the guanidine group. The most promising fluorescent probes had Y1R affinities (radioligand binding) and antagonistic activities (calcium assay) in the one- to two-digit nanomolar range. These compds. turned out to be stable under assay conditions and to be appropriate for the detection of Y1Rs by confocal microscopy in live cells. To improve the signal-to-noise ratio by shifting the emission into the near IR, a new benzothiazolium-type fluorescent cyanine dye (UR-DE99) was synthesized and attached to the parent antagonist via a carbamoyl linker yielding UR-MK131, a highly potent fluorescent Y1R probe, which was also successfully applied in flow cytometry.
  42. 42
    She, X.; Pegoli, A.; Gruber, C. G.; Wifling, D.; Carpenter, J.; Hübner, H.; Chen, M.; Wan, J.; Bernhardt, G.; Gmeiner, P.; Holliday, N. D.; Keller, M. Red-emitting dibenzodiazepinone derivatives as fluorescent dualsteric probes for the muscarinic acetylcholine M2 receptor. J. Med. Chem. 2020, 63, 4133– 4154,  DOI: 10.1021/acs.jmedchem.9b02172
    Google Scholar
    42
    Red-Emitting Dibenzodiazepinone Derivatives as Fluorescent Dualsteric Probes for the Muscarinic Acetylcholine M2 Receptor
    She, Xueke; Pegoli, Andrea; Gruber, Corinna G.; Wifling, David; Carpenter, Jessica; Huebner, Harald; Chen, Mengya; Wan, Jianfei; Bernhardt, Guenther; Gmeiner, Peter; Holliday, Nicholas D.; Keller, Max
    Journal of Medicinal Chemistry (2020), 63 (8), 4133-4154CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Fluorescently labeled dibenzodiazepinone-type muscarinic acetylcholine receptor (MR) antagonists, including dimeric ligands, were prepd. using red-emitting cyanine dyes. Probes contg. a fluorophore with neg. charge showed high M2R affinities (pKi (radioligand competition binding): 9.10-9.59). Binding studies at M1 and M3-M5 receptors indicated a M2R preference. Flow cytometric and high-content imaging satn. and competition binding (M1R, M2R, and M4R) confirmed occupation of the orthosteric site. Confocal microscopy revealed that fluorescence was located mainly at the cell membrane (CHO-hM2R cells). Results from dissocn. and satn. binding expts. (M2R) in the presence of allosteric M2R modulators (dissocn.: W84, LY2119620, and alcuronium; satn. binding: W84) were consistent with a competitive mode of action between the fluorescent probes and the allosteric ligands. Taken together, these lines of evidence indicate that these ligands are useful fluorescent mol. tools to label the M2R in imaging and binding studies and suggest that they have a dualsteric mode of action.
  43. 43
    Katritch, V.; Fenalti, G.; Abola, E. E.; Roth, B. L.; Cherezov, V.; Stevens, R. C. Allosteric sodium in class A GPCR signaling. Trends Biochem. Sci. 2014, 39, 233– 244,  DOI: 10.1016/j.tibs.2014.03.002
    Google Scholar
    43
    Allosteric sodium in class A GPCR signaling
    Katritch, Vsevolod; Fenalti, Gustavo; Abola, Enrique E.; Roth, Bryan L.; Cherezov, Vadim; Stevens, Raymond C.
    Trends in Biochemical Sciences (2014), 39 (5), 233-244CODEN: TBSCDB; ISSN:0968-0004. (Elsevier Ltd.)
    A review. Despite their functional and structural diversity, G-protein-coupled receptors (GPCRs) share a common mechanism of signal transduction via conformational changes in the seven-transmembrane (7TM) helical domain. New major insights into this mechanism come from the recent crystallog. discoveries of a partially hydrated sodium ion that is specifically bound in the middle of the 7TM bundle of multiple class A GPCRs. This review discusses the remarkable structural conservation and distinct features of the Na+ pocket in this most populous GPCR class, as well as the conformational collapse of the pocket upon receptor activation. New insights help to explain allosteric effects of sodium on GPCR agonist binding and activation, and sodium's role as a potential co-factor in class A GPCR function.
  44. 44
    White, K. L.; Eddy, M. T.; Gao, Z. G.; Han, G. W.; Lian, T.; Deary, A.; Patel, N.; Jacobson, K. A.; Katritch, V.; Stevens, R. C. Structural connection between activation microswitch and allosteric sodium site in GPCR Signaling. Structure 2018, 26, 259– 269,  DOI: 10.1016/j.str.2017.12.013
    Google Scholar
    44
    Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling
    White, Kate L.; Eddy, Matthew T.; Gao, Zhan-Guo; Han, Gye Won; Lian, Tiffany; Deary, Alexander; Patel, Nilkanth; Jacobson, Kenneth A.; Katritch, Vsevolod; Stevens, Raymond C.
    Structure (Oxford, United Kingdom) (2018), 26 (2), 259-269.e5CODEN: STRUE6; ISSN:0969-2126. (Elsevier Ltd.)
    Sodium ions are endogenous allosteric modulators of many G-protein-coupled receptors (GPCRs). Mutation of key residues in the sodium binding motif causes a striking effect on G-protein signaling. We report the crystal structures of agonist complexes for two variants in the first sodium coordination shell of the human A2A adenosine receptor, D522.50N and S913.39A. Both structures present an overall active-like conformation; however, the variants show key changes in the activation motif NPxxY. Changes in the hydrogen bonding network in this microswitch suggest a possible mechanism for modified G-protein signaling and enhanced thermal stability. These structures, signaling data, and thermal stability anal. with a panel of pharmacol. ligands provide a basis for understanding the role of the sodium-coordinating residues on stability and G-protein signaling. Utilizing the D2.50N variant is a promising method for stabilizing class A GPCRs to accelerate structural efforts and drug discovery.
  45. 45
    DeVree, B. T.; Mahoney, J. P.; Velez-Ruiz, G. A.; Rasmussen, S. G.; Kuszak, A. J.; Edwald, E.; Fung, J. J.; Manglik, A.; Masureel, M.; Du, Y.; Matt, R. A.; Pardon, E.; Steyaert, J.; Kobilka, B. K.; Sunahara, R. K. Allosteric coupling from G protein to the agonist-binding pocket in GPCRs. Nature 2016, 535, 182– 186,  DOI: 10.1038/nature18324
    Google Scholar
    45
    Allosteric coupling from G protein to the agonist-binding pocket in GPCRs
    DeVree, Brian T.; Mahoney, Jacob P.; Velez-Ruiz, Gisselle A.; Rasmussen, Soren G. F.; Kuszak, Adam J.; Edwald, Elin; Fung, Juan-Jose; Manglik, Aashish; Masureel, Matthieu; Du, Yang; Matt, Rachel A.; Pardon, Els; Steyaert, Jan; Kobilka, Brian K.; Sunahara, Roger K.
    Nature (London, United Kingdom) (2016), 535 (7610), 182-186CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)
    G protein-coupled receptors (GPCRs) remain the primary conduit by which cells detect environmental stimuli and communicate with each other. Upon activation by extracellular agonists, these seven-transmembrane-domain-contg. receptors interact with heterotrimeric G proteins to regulate downstream second messenger and/or protein kinase cascades. Crystallog. evidence from a prototypic GPCR, the β2-adrenergic receptor (β2AR), in complex with its cognate G protein, Gs, has provided a model for how agonist binding promotes conformational changes that propagate through the GPCR and into the nucleotide-binding pocket of the G protein α-subunit to catalyze GDP release, the key step required for GTP binding and activation of G proteins. The structure also offers hints about how G protein binding may, in turn, allosterically influence ligand binding. Here we provide functional evidence that G protein coupling to the β2AR stabilizes a 'closed' receptor conformation characterized by restricted access to and egress from the hormone-binding site. Surprisingly, the effects of G protein on the hormone-binding site can be obsd. in the absence of a bound agonist, where G protein coupling driven by basal receptor activity impedes the assocn. of agonists, partial agonists, antagonists and inverse agonists. The ability of bound ligands to dissoc. from the receptor is also hindered, providing a structural explanation for the G protein-mediated enhancement of agonist affinity, which has been obsd. for many GPCR-G protein pairs. Our data also indicate that in contrast to agonist binding alone, coupling of a G protein in the absence of an agonist stabilizes large structural changes in a GPCR. The effects of nucleotide-free G protein on ligand-binding kinetics are shared by other members of the superfamily of GPCRs, suggesting that a common mechanism may underlie G protein-mediated enhancement of agonist affinity.
  46. 46
    Wingler, L. M.; Lefkowitz, R. J. Conformational basis of G protein-coupled receptor signaling versatility. Trends Cell Biol. 2020, 30, 736– 747,  DOI: 10.1016/j.tcb.2020.06.002
    Google Scholar
    46
    Conformational Basis of G Protein-Coupled Receptor Signaling Versatility
    Wingler, Laura M.; Lefkowitz, Robert J.
    Trends in Cell Biology (2020), 30 (9), 736-747CODEN: TCBIEK; ISSN:0962-8924. (Elsevier Ltd.)
    A review. G protein-coupled receptors (GPCRs) are privileged structural scaffolds in biol. that have the versatility to regulate diverse physiol. processes. Interestingly, many GPCR ligands exhibit significant 'bias' - the ability to preferentially activate subsets of the many cellular pathways downstream of these receptors. Recently, complementary information from structural and spectroscopic approaches has made significant inroads into understanding the mechanisms of these biased ligands. The consistently emerging theme is that GPCRs are highly dynamic proteins, and ligands with varying pharmacol. properties differentially modulate the equil. among multiple conformations. Biased signaling and other recently appreciated complexities of GPCR signaling thus appear to be a natural consequence of the conformational heterogeneity of GPCRs and GPCR-transducer complexes.
  47. 47
    Copeland, R. A. Conformational adaptation in drug–target interactions and residence time. Future Med. Chem. 2011, 3, 1491– 1501,  DOI: 10.4155/fmc.11.112
    Google Scholar
    47
    Conformational adaptation in drug-target interactions and residence time
    Copeland, Robert A.
    Future Medicinal Chemistry (2011), 3 (12), 1491-1501CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)
    A review. Although drug-target interactions are commonly illustrated in terms of structurally static binding and dissocn. events, such descriptions are inadequate to explain the impact of conformational dynamics on these processes. For high-affinity interactions, both the assocn. and dissocn. of drug mols. to and from their targets are often controlled by conformational changes of the target. Conformational adaptation can greatly influence the residence time of a drug on its target (i.e., the lifetime of the binary drug-target complex); long residence time can lead to sustained pharmacol. and may also mitigate off-target toxicity. In this perspective, the kinetics of drug-target assocn. and dissocn. reactions are explored, with particular emphasis on the impact of conformational adaptation on drug-target residence time.
  48. 48
    Vauquelin, G. Simplified models for heterobivalent ligand binding: when are they applicable and which are the factors that affect their target residence time. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2013, 386, 949– 962,  DOI: 10.1007/s00210-013-0881-0
    Google Scholar
    48
    Simplified models for heterobivalent ligand binding: when are they applicable and which are the factors that affect their target residence time
    Vauquelin, Georges
    Naunyn-Schmiedeberg's Archives of Pharmacology (2013), 386 (11), 949-962CODEN: NSAPCC; ISSN:0028-1298. (Springer)
    Bivalent ligands often display high affinity/avidity for and long residence time at their target. Thereto responsible is the synergy that emanates from the simultaneous binding of their two pharmacophores to their resp. target sites. Thermodn. cycle models permit the most complete description of the binding process, and thereto, corresponding differential equation-based simulations link the "microscopic" rate consts. that govern the individual binding steps to the "macroscopic" bivalent ligand's binding properties. Present simulations of heterobivalent ligand binding led to an appreciably simpler description thereof. The thermodn. cycle model can be split into two pathways/lanes that the bivalent ligand can solicit to reach fully bound state. Since the first binding event prompts the still free pharmacophore to stay into "forced proximity" of its target site, such lanes can be looked into by the equations that also apply to induced fit binding mechanisms. Interestingly, the simplest equations apply when bivalency goes along with a large gain in avidity. The overall bivalent ligand assocn. and dissocn. will be swifter than via each lane apart, but it is the lane that allows the fastest bidirectional "transit" between the free and the fully bound target that is chiefly solicited. The bivalent ligand's residence time is governed not only by the stability of the fully bound complex but also by the ability of freshly dissocd. pharmacophores to successfully rebind. Hence, the presence of a slow-assocg. pharmacophore could be counterproductive. Yet, a long residence time is unfortunately also responsible for the slow attainment of binding equil.
  49. 49
    Palmberger, D.; Wilson, I. B.; Berger, I.; Grabherr, R.; Rendic, D. SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells. PLoS One 2012, 7, e34226  DOI: 10.1371/journal.pone.0034226
    Google Scholar
    49
    SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells
    Palmberger, Dieter; Wilson, Iain B. H.; Berger, Imre; Grabherr, Reingard; Rendic, Dubravko
    PLoS One (2012), 7 (4), e34226CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)
    Recombinant prodn. of therapeutically active proteins has become a central focus of contemporary life science research. These proteins are often produced in mammalian cells, in order to obtain products with post-translational modifications similar to their natural counterparts. However, in cases where a fast and flexible system for recombinant prodn. of proteins is needed, the use of mammalian cells is limited. The baculoviral insect cell system has proven to be a powerful alternative for the expression of a wide range of recombinant proteins in short time frames. The major drawback of baculoviral systems lies in the inability to perform mammalian-like glycosylation required for the prodn. of therapeutic glycoproteins. In this study we integrated sequences encoding Caenorhabditis elegans N-acetylglucosaminyl-transferase II and bovine β1,4-galactosyltransferase I into the backbone of a baculovirus genome. The thereby generated SweetBac virus was subsequently used for the prodn. of the human HIV anti-gp41 antibody 3D6 by integrating heavy and light chain open reading frames into the SweetBac genome. The parallel expression of target genes and glycosyltransferases reduced the yield of secreted antibody. However, the overall expression rate, esp. in the recently established Tnao38 cell line, was comparable to that of transient expression in mammalian cells. In order to evaluate the ability of SweetBac to generate mammalian-like N-glycan structures on 3D6 antibody, we performed SDS-PAGE and tested for the presence of terminal galactose using Riccinus communis agglutinin I. The mammalianized variants of 3D6 showed highly specific binding to the lectin, indicating proper functionality. To confirm these results, PNGase A released N-glycans were analyzed by MALDI-TOF-MS and shown to contain structures with mainly one or two terminal galactose residues. Since the presence of specific N-glycans has an impact on antibodies' ability to exert different effector functions, we tested the binding to human Fc gamma receptor I present on U937 cells.
  50. 50
    Schneider, E. H.; Seifert, R. Sf9 cells: A versatile model system to investigate the pharmacological properties of G protein-coupled receptors. Pharmacol. Ther. 2010, 128, 387– 418,  DOI: 10.1016/j.pharmthera.2010.07.005
    Google Scholar
    50
    Sf9 cells: A versatile model system to investigate the pharmacological properties of G protein-coupled receptors
    Schneider, Erich H.; Seifert, Roland
    Pharmacology & Therapeutics (2010), 128 (3), 387-418CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)
    A review. The Sf9 cell/baculovirus expression system is widely used for high-level protein expression, often with the purpose of purifn. However, proteins may also be functionally expressed in the defined Sf9 cell environment. According to the literature, the pharmacol. of G-protein-coupled receptors (GPCRs) functionally reconstituted in Sf9 cells is similar to the receptor properties in mammalian cells. Sf9 cells express both recombinant GPCRs and G-proteins at much higher levels than mammalian cells. Sf9 cells can be grown in suspension culture, providing an inexpensive way of obtaining large protein amts. Co-infection with various baculoviruses allows free combination of GPCRs with different G-proteins. The absence of constitutively active receptors in Sf9 cells provides an excellent signal-to background ratio in functional assays, allowing the detection of agonist-independent receptor activity and of small ligand-induced signals including partial agonistic and inverse agonistic effects. Insect cell Gαi-like proteins mostly do not couple productively to mammalian GPCRs. Thus, unlike in mammalian cells, Sf9 cells do not require pertussis toxin treatment to obtain a Gαi-free environment. Co-expression of GPCRs with Gαi1, Gαi2, Gαi3 or Gαo in Sf9 cells allows the generation of a selectivity profile for these Gαi/o-isoforms. Addnl., GPCR-G-protein combinations can be compared with defined 1:1 stoichiometry by expressing GPCR-Gα fusion proteins. Sf9 cells can also be employed for ligand screening in medicinal chem. programs, using radioligand binding assays or functional assays, like the steady-state GTPase- or [35S]GTPγS binding assay. This review shows that Sf9 cells are a versatile model system to investigate the pharmacol. properties of GPCRs.
  51. 51
    Grätz, L.; Müller, C.; Pegoli, A.; Schindler, L.; Bernhardt, G.; Littmann, T. Insertion of Nanoluc into the extracellular loops as a complementary method to establish BRET-based binding assays for GPCRs. ACS Pharmacol. Transl. Sci. 2022, 5, 1142– 1155,  DOI: 10.1021/acsptsci.2c00162
    Google Scholar
    There is no corresponding record for this reference.
  52. 52
    Calderón, J. C.; Plut, E.; Keller, M.; Cabrele, C.; Reiser, O.; Gervasio, F. L.; Clark, T. Extended metadynamics protocol for binding/unbinding free energies of peptide ligands to class A G-protein-coupled receptors. J. Chem. Inf. Model. 2024, 64, 205– 218,  DOI: 10.1021/acs.jcim.3c01574
    Google Scholar
    There is no corresponding record for this reference.
  53. 53
    Hall, M. P.; Unch, J.; Binkowski, B. F.; Valley, M. P.; Butler, B. L.; Wood, M. G.; Otto, P.; Zimmerman, K.; Vidugiris, G.; Machleidt, T.; Robers, M. B.; Benink, H. A.; Eggers, C. T.; Slater, M. R.; Meisenheimer, P. L.; Klaubert, D. H.; Fan, F.; Encell, L. P.; Wood, K. V. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 2012, 7, 1848– 1857,  DOI: 10.1021/cb3002478
    Google Scholar
    53
    Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate
    Hall, Mary P.; Unch, James; Binkowski, Brock F.; Valley, Michael P.; Butler, Braeden L.; Wood, Monika G.; Otto, Paul; Zimmerman, Kristopher; Vidugiris, Gediminas; Machleidt, Thomas; Robers, Matthew B.; Benink, Helene A.; Eggers, Christopher T.; Slater, Michael R.; Meisenheimer, Poncho L.; Klaubert, Dieter H.; Fan, Frank; Encell, Lance P.; Wood, Keith V.
    ACS Chemical Biology (2012), 7 (11), 1848-1857CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)
    Bioluminescence methodologies have been extraordinarily useful due to their high sensitivity, broad dynamic range, and operational simplicity. These capabilities have been realized largely through incremental adaptations of native enzymes and substrates, originating from luminous organisms of diverse evolutionary lineages. We engineered both an enzyme and substrate in combination to create a novel bioluminescence system capable of more efficient light emission with superior biochem. and phys. characteristics. Using a small luciferase subunit (19 kDa) from the deep sea shrimp Oplophorus gracilirostris, we have improved luminescence expression in mammalian cells ∼2.5 million-fold by merging optimization of protein structure with development of a novel imidazopyrazinone substrate (furimazine). The new luciferase, NanoLuc, produces glow-type luminescence (signal half-life >2 h) with a specific activity ∼150-fold greater than that of either firefly (Photinus pyralis) or Renilla luciferases similarly configured for glow-type assays. In mammalian cells, NanoLuc shows no evidence of post-translational modifications or subcellular partitioning. The enzyme exhibits high phys. stability, retaining activity with incubation up to 55 °C or in culture medium for >15 h at 37 °C. As a genetic reporter, NanoLuc may be configured for high sensitivity or for response dynamics by appending a degrdn. sequence to reduce intracellular accumulation. Appending a signal sequence allows NanoLuc to be exported to the culture medium, where reporter expression can be measured without cell lysis. Fusion onto other proteins allows luminescent assays of their metab. or localization within cells. Reporter quantitation is achievable even at very low expression levels to facilitate more reliable coupling with endogenous cellular processes.
  54. 54
    Keller, M.; Kaske, M.; Holzammer, T.; Bernhardt, G.; Buschauer, A. Dimeric argininamide-type neuropeptide Y receptor antagonists: Chiral discrimination between Y1 and Y4 receptors. Biorg. Med. Chem. 2013, 21, 6303– 6322,  DOI: 10.1016/j.bmc.2013.08.065
    Google Scholar
    There is no corresponding record for this reference.
  55. 55
    Pegoli, A.; She, X.; Wifling, D.; Hubner, H.; Bernhardt, G.; Gmeiner, P.; Keller, M. Radiolabeled dibenzodiazepinone-type antagonists give evidence of dualsteric binding at the M(2) muscarinic acetylcholine receptor. J. Med. Chem. 2017, 60, 3314– 3334,  DOI: 10.1021/acs.jmedchem.6b01892
    Google Scholar
    55
    Radiolabeled Dibenzodiazepinone-Type Antagonists Give Evidence of Dualsteric Binding at the M2 Muscarinic Acetylcholine Receptor
    Pegoli Andrea; She Xueke; Wifling David; Bernhardt Gunther; Keller Max; Hubner Harald; Gmeiner Peter
    Journal of medicinal chemistry (2017), 60 (8), 3314-3334 ISSN:.
    The dualsteric ligand approach, aiming at ligands with improved subtype selectivity, has been increasingly applied to muscarinic receptors (MRs). In this article, we present the synthesis and characterization of a M2R subtype-preferring radiolabeled dibenzodiazepinone-type antagonist ([(3)H]UNSW-MK259, [(3)H]19) and its homodimeric analogue [(3)H]UR-AP060 ([(3)H]33). Saturation binding studies at the M2R, using the orthosteric antagonist atropine to determine unspecific binding, proved that the monomeric and the dimeric compound bind to the orthosteric binding site (apparent Kd: 0.87 and 0.31 nM, respectively). Various binding studies with [(3)H]19 and [(3)H]33 at the M2R, for instance, saturation binding experiments in the presence of the allosteric MR modulators W84 (8) or LY2119620 (9) (Schild-like analysis) suggested a competitive mechanism between the allosteric modulator and the dibenzodiazepinone derivatives, and thus a dualsteric binding mode of both 19 and 33. This was consistent with the results of M2R MD simulations (≥2 μs) performed with 19 and 33.
  56. 56
    Schindler, L.; Moosbauer, J.; Schmidt, D.; Spruss, T.; Grätz, L.; Lüdeke, S.; Hofheinz, F.; Meister, S.; Echtenacher, B.; Bernhardt, G.; Pietzsch, J.; Hellwig, D.; Keller, M. Development of a neurotensin-derived 68Ga-labeled PET ligand with high in vivo stability for imaging of NTS1 receptor-expressing tumors. Cancers 2022, 14, 4922  DOI: 10.3390/cancers14194922
    Google Scholar
    There is no corresponding record for this reference.
  57. 57
    Schindler, L.; Wohlfahrt, K.; von Krüchten, L. G.; Prante, O.; Keller, M.; Maschauer, S. Neurotensin analogs by fluoroglycosylation at Nω-carbamoylated arginines for PET imaging of NTS1-positive tumors. Sci. Rep. 2022, 12, 15028  DOI: 10.1038/s41598-022-19296-0
    Google Scholar
    There is no corresponding record for this reference.
  58. 58
    Höfelschweiger, B. K. The pyrylium dyes: A new class of biolabels. Synthesis, spectroscopy, and application as labels and in general protein assay. Doctoral thesis, University of Regensburg, Regensburg, 2005.
    Google Scholar
    There is no corresponding record for this reference.
  59. 59
    Moser, C.; Bernhardt, G.; Michel, J.; Schwarz, H.; Buschauer, A. Cloning and functional expression of the hNPY Y5 receptor in human endometrial cancer (HEC-1B) cells. Can. J. Physiol. Pharmacol. 2000, 78, 134– 142,  DOI: 10.1139/y99-125
    Google Scholar
    59
    Cloning and functional expression of the hNPY Y5 receptor in human endometrial cancer (HEC-1B) cells
    Moser, C.; Bernhardt, G.; Michel, J.; Schwarz, H.; Buschauer, A.
    Canadian Journal of Physiology and Pharmacology (2000), 78 (2), 134-142CODEN: CJPPA3; ISSN:0008-4212. (National Research Council of Canada)
    Aiming to develop a functional assay for the human NPY Y5 receptor based on adenylyl cyclase activity, HEC-1B cells, in which cAMP synthesis can be efficiently stimulated with forskolin, were selected for the transfection with the pcDNA3-Y5-FLAG and the pcDEF3-Y5 vectors. After optimization of the transfection procedure, the binding of [3H]propionyl-NPY to transiently and stably expressed Y5 receptors was detd. The affinities of NPY, NPY derivs., and rPP (pNPY ≥ p(Leu31Pro34)NPY = p(2-36)NPY ≥ p(D-Trp32)NPY > p(13-36)NPY > rPP) were in accordance with the NPY Y5 receptor subtype. For [3H]propionyl-pNPY approx. 1.7×105 and 1×106 binding sites per transiently and stably transfected cell, resp., were detd. The KD values were 2.4±0.4 and 1.7±0.2 nM, resp. Due to the high expression of the receptor protein, both stably and transiently transfected cells can be conveniently used in routine radioligand binding studies. By contrast, functional assays were only feasible with HEC-1B cells stably expressing the Y5 receptor. In these cells, 10 nM pNPY inhibited the forskolin-stimulated cAMP synthesis by 75%. This effect was partially antagonized by the Y5 antagonist N-{trans-[4-(2-naphthylmethylamino)-methyl]cyclohexylmethyl}naphthalene-2-sulfonamide. Although the genetic variability of cancer cells is in principle incompatible with a stable phenotype, both ligand binding characteristics and functionality of the Y5 receptor remained unchanged for more than 30 passages.
  60. 60
    Bartole, E.; Grätz, L.; Littmann, T.; Wifling, D.; Seibel, U.; Buschauer, A.; Bernhardt, G. UR-DEBa242: A Py-5-labeled fluorescent multipurpose probe for investigations on the histamine H3 and H4 receptors. J. Med. Chem. 2020, 63, 5297– 5311,  DOI: 10.1021/acs.jmedchem.0c00160
    Google Scholar
    60
    UR-DEBa242: A Py-5-Labeled Fluorescent Multipurpose Probe for Investigations on the Histamine H3 and H4 Receptors
    Bartole, Edith; Graetz, Lukas; Littmann, Timo; Wifling, David; Seibel, Ulla; Buschauer, Armin; Bernhardt, Guenther
    Journal of Medicinal Chemistry (2020), 63 (10), 5297-5311CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
    Comprehensively characterized fluorescent probes for the histamine H3 receptor (H3R) and esp. for the H4R orthologs [e.g., human (h) and mouse (m)] are highly needed as versatile complementary tools to radioligands. In view of fluorescent probes for BRET-based binding studies and for localizing the H4R in live cells, we synthesized and biol. characterized Py-5-labeled histamine derivs. The most notable compd. was UR-DEBa242 (26, 1-[4-(1H-Imidazol-4-yl)butyl]-4-{(1E,3E)-4-[4-(dimethylamino)phenyl]buta-1,3-dienyl}-2, 6-dimethylpyridinium hydrotrifluoroacetate trifluoroacetate), acting as a partial agonist at the hH3R [pEC50 (reporter gene) 8.77] and as an inverse agonist/antagonist at the h/mH4Rs [pIC50(reporter gene) 8.76/7.08; pIC50/pKb (β-arrestin2) 7.81/7.30]. In confocal microscopy, 26 proved suitable for hH4R localization and trafficking studies in live cells. BRET-based binding at the NLuc-hH3,4Rs/mH4R [pKd 8.78/7.75/7.18, comparable to binding consts. from radioligand binding/flow cytometry; fast assocn./dissocn. (~ 2 min)] revealed 26 as a useful mol. tool to det. hH3,4Rs/mH4R binding affinities of ligands binding to these receptors.
  61. 61
    Mansouri, M.; Bellon-Echeverria, I.; Rizk, A.; Ehsaei, Z.; Cosentino, C. C.; Silva, C. S.; Xie, Y.; Boyce, F. M.; Davis, M. W.; Neuhauss, S. C. F.; Taylor, V.; Ballmer-Hofer, K.; Berger, I.; Berger, P. Highly efficient baculovirus-mediated multigene delivery in primary cells. Nat. Commun. 2016, 7, 11529  DOI: 10.1038/ncomms11529
    Google Scholar
    61
    Highly efficient baculovirus-mediated multigene delivery in primary cells
    Mansouri, Maysam; Bellon-Echeverria, Itxaso; Rizk, Aurelien; Ehsaei, Zahra; Cianciolo Cosentino, Chiara; Silva, Catarina S.; Xie, Ye; Boyce, Frederick M.; Davis, M. Wayne; Neuhauss, Stephan C. F.; Taylor, Verdon; Ballmer-Hofer, Kurt; Berger, Imre; Berger, Philipp
    Nature Communications (2016), 7 (), 11529CODEN: NCAOBW; ISSN:2041-1723. (Nature Publishing Group)
    Multigene delivery and subsequent cellular expression is emerging as a key technol. required in diverse research fields including, synthetic and structural biol., cellular reprogramming and functional pharmaceutical screening. Current viral delivery systems such as retro- and adenoviruses suffer from limited DNA cargo capacity, thus impeding unrestricted multigene expression. We developed MultiPrime, a modular, non-cytotoxic, non-integrating, baculovirus-based vector system expediting highly efficient transient multigene expression from a variety of promoters. MultiPrime viruses efficiently transduce a wide range of cell types, including non-dividing primary neurons and induced-pluripotent stem cells (iPS). We show that MultiPrime can be used for reprogramming, and for genome editing and engineering by CRISPR/Cas9. Moreover, we implemented dual-host-specific cassettes enabling multiprotein expression in insect and mammalian cells using a single reagent. Our expts. establish MultiPrime as a powerful and highly efficient tool, to deliver multiple genes for a wide range of applications in primary and established mammalian cells.
  62. 62
    Nie, Y.; Chaillet, M.; Becke, C.; Haffke, M.; Pelosse, M.; Fitzgerald, D.; Collinson, I.; Schaffitzel, C.; Berger, I. ACEMBL tool-kits for high-throughput multigene delivery and expression in prokaryotic and eukaryotic hosts. Adv. Exp. Med. Biol. 2016, 896, 27– 42,  DOI: 10.1007/978-3-319-27216-0_3
    Google Scholar
    There is no corresponding record for this reference.
  63. 63
    Cheng, Y.-C.; Prusoff, W. H. Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50% inhibition (IC50) of an enzymatic reaction. Biochem. Pharmacol. 1973, 22, 3099– 3108,  DOI: 10.1016/0006-2952(73)90196-2
    Google Scholar
    63
    Relation between the inhibition constant K1) and the concentration of inhibitor which causes fifty per cent inhibition (I50) of an enzymic reaction
    Cheng, Yung-Chi; Prusoff, William H.
    Biochemical Pharmacology (1973), 22 (23), 3099-108CODEN: BCPCA6; ISSN:0006-2952.
    The Ki and I50 values are equal where the kinetics are non- or uncompetitive, but not where they are competitive. The relation between the 2 values was analyzed for non- and uncompetitive bi- and monosubstrate reactions and for competitive bisubstrate reactions.
  64. 64
    Laasfeld, T.; Kopanchuk, S.; Rinken, A. Image-based cell-size estimation for baculovirus quantification. BioTechniques 2017, 63, 161– 168,  DOI: 10.2144/000114595
    Google Scholar
    64
    Image-based cell-size estimation for baculovirus quantification
    Laasfeld, Tanis; Kopanchuk, Sergei; Rinken, Ago
    BioTechniques (2017), 63 (4), 161-168CODEN: BTNQDO; ISSN:0736-6205. (Informa Healthcare)
    Measurement of virus concn. is essential for effective virus-based transfection technologies. Here, we describe a user-friendly, image-based cell-size estn. (ICSE) assay for bacufovirus quantification that relies on automated detn. of celf diams. from bright-field microscopy images. In the !CSC assay, microplate-based imaging systems and our custom ICSE-Tools software enable measurement of cell morphol. parameters over time. Results from the ICSE assay were in agreement with virus concn. measurements obtained using the traditional plaque assay as well as the Coulter principle- based cell-size measurement assay. ICSE-Tools is designed for data organization and image anal. from microplate-based imaging systems, and is freely available at www.gper.ut.eelsoftware.html.
  65. 65
    Veiksina, S.; Tahk, M.-J.; Laasfeld, T.; Link, R.; Kopanchuk, S.; Rinken, A. Fluorescence Anisotropy-Based Assay for Characterization of Ligand Binding Dynamics to GPCRs: The Case of Cy3B-Labeled Ligands Binding to MC4 Receptors in Budded Baculoviruses. In G Protein-Coupled Receptor Screening Assays: Methods and Protocols; Martins, S. A. M.; Prazeres, D. M. F., Eds.; Springer: US, New York, NY, 2021; pp 119– 136.
    Google Scholar
    There is no corresponding record for this reference.
  66. 66
    Kopanchuk, S.; Vavers, E.; Veiksina, S.; Ligi, K.; Zvejniece, L.; Dambrova, M.; Rinken, A. Intracellular dynamics of the Sigma-1 receptor observed with super-resolution imaging microscopy. PLoS One 2022, 17, e0268563  DOI: 10.1371/journal.pone.0268563
    Google Scholar
    There is no corresponding record for this reference.
  67. 67
    Soulez, F. In A “Learn 2D, Apply 3D” Method for 3D Deconvolution Microscopy, 2014 IEEE 11th International Symposium on Biomedical Imaging (ISBI); IEEE, 2014; pp 1075– 1078.
    Google Scholar
    There is no corresponding record for this reference.
  68. 68
    Chenouard, N.; Bloch, I.; Olivo-Marin, J. C. Multiple hypothesis tracking for cluttered biological image sequences. IEEE Trans. Pattern Anal. Mach. Intell. 2013, 35, 2736– 3750,  DOI: 10.1109/TPAMI.2013.97
    Google Scholar
    68
    Multiple hypothesis tracking for cluttered biological image sequences
    Chenouard Nicolas; Bloch Isabelle; Olivo-Marin Jean-Christophe
    IEEE transactions on pattern analysis and machine intelligence (2013), 35 (11), 2736-3750 ISSN:.
    In this paper, we present a method for simultaneously tracking thousands of targets in biological image sequences, which is of major importance in modern biology. The complexity and inherent randomness of the problem lead us to propose a unified probabilistic framework for tracking biological particles in microscope images. The framework includes realistic models of particle motion and existence and of fluorescence image features. For the track extraction process per se, the very cluttered conditions motivate the adoption of a multiframe approach that enforces tracking decision robustness to poor imaging conditions and to random target movements. We tackle the large-scale nature of the problem by adapting the multiple hypothesis tracking algorithm to the proposed framework, resulting in a method with a favorable tradeoff between the model complexity and the computational cost of the tracking procedure. When compared to the state-of-the-art tracking techniques for bioimaging, the proposed algorithm is shown to be the only method providing high-quality results despite the critically poor imaging conditions and the dense target presence. We thus demonstrate the benefits of advanced Bayesian tracking techniques for the accurate computational modeling of dynamical biological processes, which is promising for further developments in this domain.

Cited By

Click to copy section linkSection link copied!
Citation Statements
Explore this article's citation statements on scite.ai
powered by  Scite

This article is cited by 3 publications.

  1. Fabian J. Ertl, Sergei Kopanchuk, Nicola C. Dijon, Santa Veikšina, Maris-Johanna Tahk, Tõnis Laasfeld, Franziska Schettler, Albert O. Gattor, Harald Hübner, Nataliya Archipowa, Johannes Köckenberger, Markus R. Heinrich, Peter Gmeiner, Roger J. Kutta, Nicholas D. Holliday, Ago Rinken, Max Keller. Dually Labeled Neurotensin NTS1R Ligands for Probing Radiochemical and Fluorescence-Based Binding Assays. Journal of Medicinal Chemistry 2024, 67 (18) , 16664-16691. https://doi.org/10.1021/acs.jmedchem.4c01470
  2. Renáta Szabó, Ágnes Hornyánszky, Dóra Judit Kiss, György Miklós Keserű. Fluorescent tools for imaging class A G-protein coupled receptors. European Journal of Pharmaceutical Sciences 2025, 209 , 107074. https://doi.org/10.1016/j.ejps.2025.107074
  3. Max E. Huber, Silas L. Wurnig, Aurélien F. A. Moumbock, Lara Toy, Evi Kostenis, Ana Alonso Bartolomé, Martyna Szpakowska, Andy Chevigné, Stefan Günther, Finn K. Hansen, Matthias Schiedel. Development of a NanoBRET Assay Platform to Detect Intracellular Ligands for the Chemokine Receptors CCR6 and CXCR1. ChemMedChem 2024, 19 (20) https://doi.org/10.1002/cmdc.202400284
Download PDF
Go to ACS Pharmacology & Translational Science
Get e-Alerts
Get e-Alerts

ACS Pharmacology & Translational Science

Cite this: ACS Pharmacol. Transl. Sci. 2024, 7, 4, 1142–1168
Click to copy citationCitation copied!
https://doi.org/10.1021/acsptsci.4c00013
Published March 20, 2024

Copyright © 2024 The Authors. Published by American Chemical Society. This publication is licensed under

CC-BY 4.0 .

Article Views

1426

Altmetric

-

Citations

3
Learn about these metrics

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

  • Abstract

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 1

    Figure 1. (A) Structures and Y4R affinities of reported Y4R fluorescent ligands. 1 (26) and 2 (27) represent derivatives of the endogenous Y4R ligand hPP labeled with sulfo-Cy5 (S0223) and 5-TAMRA, respectively. Compound 3 (29) represents a derivative of the hexapeptide UR-KK236 (28) labeled with Sulfo-Cy5.5 (lumiprobe, ref no. 7330). (B) Structures of the reported cyclic Y4R ligands 4–7 showing high binding affinity to Y4R (pKi > 10). (30,31)

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 2

    Figure 2. Study design of the present work: synthesis and characterization of fluorescent probes with high Y4R binding affinity derived from recently reported cyclic hexapeptides (6, (31) 4 (30)).

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 3

    Figure 3. Structures of the reported Nω-carbamoylated arginines 8 (32) and 9 (29) used in SPPS for the preparation of precursor peptide 11.

    High Resolution Image
    Download MS PowerPoint Slide

    Scheme 1

    Scheme 1. Synthesis of the Cyclic Peptide 11 via SPPSa
    High Resolution Image
    Download MS PowerPoint Slide

    aReagents and conditions: (a) Fmoc amino acid/HOBt/HBTU/DIPEA (5/5/4.9/10 equiv), DMF/NMP 8:2 v/v, 38 °C, 2 × 45 min (“double” coupling); Fmoc deprotection (following amino acid coupling): 20% piperidine in DMF/NMP 8:2 v/v, rt, 2 × 10 min; (b) building block 8 or 9/HOBt/HBTU/DIPEA (3/3/2.9/6 equiv), DMF/NMP 8:2 v/v, 38 °C, 16 h (single coupling); Fmoc deprotection (following amino acid coupling): as under (a); (c) succinic anhydride/DIPEA (10/10 equiv), DMF/NMP 8:2 v/v, 38 °C, 45 min; (d) (1) TFA/CH2Cl2 1:3 v/v, rt, 2 × 20 min; (2) TFA/H2O 95:5 v/v, rt, 5 h; overall yield: 37%; (e) peptide cyclization: HOBt/PyBOP/DIPEA (3/2.9/6 equiv), DMF/NMP 8:2 v/v, rt, 16 h, 21%.

    Scheme 2

    Scheme 2. Synthesis of the Fluorescent Y4R Ligands 16–19a
    High Resolution Image
    Download MS PowerPoint Slide

    aReagents and conditions: (a) DIPEA, DMF, rt, 2 h, 34–69%; (b) CuSO4, sodium ascorbate, H2O/NMP 1:1 v/v, rt, 2 h, 27%.

    Figure 4

    Figure 4. Flow cytometric saturation binding of 16 (A), 17 (B), and 18 (C) at whole CHO-hY4R-Gqi5-mtAEQ cells at 22 ± 2 °C. (A) Representative saturation isotherms (red circle) of 16 from experiments performed in sodium-free buffer (buffer I) and sodium-containing buffer (DPBS, 137 mM Na+). (B, C) Representative saturation isotherms (red circle) of 17 (B) and 18 (C) from experiments performed in sodium-containing buffer (DPBS). Unspecific binding (blue squares) was determined in the presence of 1 μM hPP (A–C). Total and unspecific binding data represent mean values ± SEM. Specific binding, representing calculated values ± propagated error, were fitted according to an equation describing a hyperbolic isotherm (binding-saturation: one site-specific binding, GraphPad Prism 5).

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 5

    Figure 5. Binding kinetics of 16–18 determined by flow cytometry at whole CHO-hY4R-Gqi5-mtAEQ cells at 22 ± 2 °C. (A) Association of 16 to the hY4R under sodium-free conditions (buffer I) and in sodium-containing buffer (DPBS, 137 mM Na+). Concentration of 16: 0.3 and 0.7 nM, respectively. Proportion of the initial fast association (two-phase association fit, GraphPad Prism 5): 38 ± 4% (mean ± SEM). (B) Dissociation of 16 from the hY4R determined in buffer I and DPBS. The dissociation was initiated after 1.5 h of preincubation with 16 (c = 1.5 nM (Na+-free) and 3.5 nM (137 mM Na+)) by the addition of an excess of hPP (1000-fold) and 5 (100-fold). Plateau values of the three-parameter fits (monophasic exponential decline): 13% (Na+-free), 22% (137 mM Na+). (C) Association of 17 (c = 1 nM) and 18 (c = 0.5 nM) to the hY4R determined in DPBS (137 mM Na+). Proportion of the initial fast association (two-phase association fit, GraphPad Prism 5): 74 ± 1% (17), 29 ± 3% (18) (mean values ± SEM). (D) Dissociation of 17 and 18 from the hY4R in DPBS. The dissociation was initiated after 1.5 h of preincubation with 17 (c = 5 nM) or 18 (c = 2.5 nM) by the addition of an excess of hPP (1000-fold) and 5 (100-fold). Plateau values of the three-parameter fits (monophasic exponential decline): 13% (17), 22% (18). Data (A–D) represent mean values ± SEM from three independent experiments performed in duplicate.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 6

    Figure 6. Binding of 16 to hY4R displaying BBVs studied by FA measurement at 27 °C. (A) Binding isotherms of 16 obtained from experiments using fixed concentrations of 16 (0.5 or 2 nM) and increasing amounts of Y4R. Total binding is represented by filled symbols and unspecific binding (determined in the presence of 1 μM hPP) is represented by open symbols. Depicted data (mean values ± SEM from a representative experiment performed in duplicate) represent snapshots at 90 min incubation. Y4R concentrations displayed on the abscissa were calculated after global analysis of the data from three or four individual experiments by a modified version of a model described by Veiksina et al., (19) affording the estimated binding site (Y4R) concentration of the applied BBV stock which amounted to 6 ± 1 nM (Y4Rnonglyco, mean value ± SEM, n = 3) or 2.1 ± 0.1 nM (Y4RSwBac, mean value ± SEM, n = 4). (B) Association and dissociation of 16 (0.5 nM) determined in real time for three different Y4R concentrations (green, blue, and red symbols). Total binding is represented by filled symbols and unspecific binding (determined in the presence of 1 μM hPP) is represented by open symbols. Data represent mean values ± SEM from a representative experiment performed in duplicate.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 7

    Figure 7. Characterization of Y4R binding of fluorescent ligand 16 in a NanoBRET-based binding assay at 25 °C using intact HEK293T-hY4R-NLuc(intraECL2) cells. (A) Representative saturation isotherm (specific binding) from saturation binding experiments. Unspecific binding was determined in the presence of 1 μM 5. Total and unspecific binding data represent mean values ± SEM. Specific binding data represent calculated values ± propagated error. (B) Association of 16 (c = 1 nM) to Y4R. Mean values ± SEM from three independent experiments performed in triplicate. (C) Dissociation of 16 from Y4R. The dissociation was initiated after 1.5 h of preincubation with 16 (c = 3.5 nM) by the addition of a 1000-fold excess of 5. Mean values ± SEM from three independent experiments performed in duplicate. Plateau value of the three-parameter fit describing a monophasic exponential decline: 6% (note: for the biphasic fit the plateau value was not different from zero, see discussion).

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 8

    Figure 8. Determination of Y4R affinities of Y4R reference ligands (hPP, 5, 7, UR-MK188, UR-MEK388, UR-KK200) in different fluorescence-based assays by competition binding with 16. (A) Displacement curves based on data from flow cytometric competition binding experiments performed with intact CHO-hY4R-Gqi5-mtAEQ cells in sodium-free buffer (buffer I) and sodium-containing buffer (DPBS, 137 mM Na+). (B) Displacement curves from fluorescence anisotropy-based competition binding experiments performed with Y4RSwBac-displaying BBVs in DPBS. (C) Displacement curves from NanoBRET-based competition binding experiments performed with intact HEK293T-hY4R-NLuc(intraECL2) cells in L15-HEPES (140 mM Na+). Data (A–C), representing mean values ± SEM from three to five independent experiments performed in duplicate (B) or triplicate (A, C), were fitted according to a four-parameter logistic model.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 9

    Figure 9. Visualization of fluorescent ligand (16, 17) binding to CHO-hY4R-Gqi5-mtAEQ cells by confocal microscopy. Shown are representative images acquired after incubation of the cells with 16 or 17 (each 20 nM) at 22 °C for 10 and 30 min. Unspecific binding was determined in the presence of 1 μM hPP. Nuclei were stained with H33342 (2 μM). Fluorescence of 16 and 17 is shown in green and red, respectively. Fluorescence of H33342 is shown in blue. Scale bar: 10 μm.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 10

    Figure 10. Visualization of binding of 16 to the hY4R transiently expressed by SK-OV-3 cells using wide-field and TIRF microscopy. (A) Wide-field fluorescence images acquired after incubation of the cells with 16 at 37 °C for 30 min. The two-color composite of individual focal planes after Z-stack deconvolution is shown with the green pseudocolor for 16 (561 nm excitation) and the blue pseudocolor for the nuclear stain channel (Hoechst 34580, 405 nm excitation). (B) Wide-field fluorescence and TIRF images of the same cells obtained after incubation of the cells with 16 (1 nM) at 37 °C for 30 min. Wide-field images were processed as under (A). In TIRF images, fluorescence of 16 is shown in white pseudocolor. Scale bar: 10 μm.

    High Resolution Image
    Download MS PowerPoint Slide

  • References

    This article references 68 other publications.

    1. 1
      Michel, M. C.; Beck-Sickinger, A.; Cox, H.; Doods, H. N.; Herzog, H.; Larhammar, D.; Quirion, R.; Schwartz, T.; Westfall, T. XVI. International Union of Pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY, and pancreatic polypeptide receptors. Pharmacol. Rev. 1998, 50, 143– 150
      1
      XVI. International union of pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY, and pancreatic polypeptide receptors
      Michel, Martin C.; Beck-Sickinger, Annette; Cox, Helen; Doods, Henri N.; Herzog, Herbert; Larhammar, Dan; Quirion, Remi; Schwartz, Thue; Westfall, Thomas
      Pharmacological Reviews (1998), 50 (1), 143-150CODEN: PAREAQ; ISSN:0031-6997. (Williams & Wilkins)
      A review with ∼80 refs.
    2. 2
      Pedragosa-Badia, X.; Stichel, J.; Beck-Sickinger, A. G. Neuropeptide Y receptors: how to get subtype selectivity. Front. Endocrinol. 2013, 4, 5  DOI: 10.3389/fendo.2013.00005
      2
      Neuropeptide Y receptors: how to get subtype selectivity
      Pedragosa-Badia Xavier; Stichel Jan; Beck-Sickinger Annette G
      Frontiers in endocrinology (2013), 4 (), 5 ISSN:1664-2392.
      The neuropeptide Y (NPY) system is a multireceptor/multiligand system consisting of four receptors in humans (hY(1), hY(2), hY(4), hY(5)) and three agonists (NPY, PYY, PP) that activate these receptors with different potency. The relevance of this system in diseases like obesity or cancer, and the different role that each receptor plays influencing different biological processes makes this system suitable for the design of subtype selectivity studies. In this review we focus on the latest findings within the NPY system, we summarize recent mutagenesis studies, structure activity relationship studies, receptor chimera, and selective ligands focusing also on the binding mode of the native agonists.
    3. 3
      Ueno, N.; Inui, A.; Iwamoto, M.; Kaga, T.; Asakawa, A.; Okita, M.; Fujimiya, M.; Nakajima, Y.; Ohmoto, Y.; Ohnaka, M.; Nakaya, Y.; Miyazaki, J.-I.; Kasuga, M. Decreased food intake and body weight in pancreatic polypeptide-overexpressing mice. Gastroenterology 1999, 117, 1427– 1432,  DOI: 10.1016/S0016-5085(99)70293-3
      3
      Decreased food intake and body weight in pancreatic polypeptide-overexpressing mice
      Ueno N; Inui A; Iwamoto M; Kaga T; Asakawa A; Okita M; Fujimiya M; Nakajima Y; Ohmoto Y; Ohnaka M; Nakaya Y; Miyazaki J I; Kasuga M
      Gastroenterology (1999), 117 (6), 1427-32 ISSN:0016-5085.
      BACKGROUND & AIMS: Pancreatic polypeptide (PP) is a 36-amino acid hormone produced by F cells within the pancreatic islets and the exocrine pancreas. The definitive function of PP in mammalian physiology remains to be determined. This study examined the effects of chronic overexpression of PP through the development of PP transgenic mice. METHODS: PP transgenic mice were created by using mouse PP complementary DNA under the control of the cytomegalovirus immediate early enhancer-chicken beta-actin hybrid promoter (pCAGGS expression vector). RESULTS: A unique line of transgenic mice was created that overexpresses PP in the pancreatic islets with low levels of expression in other tissues including the brain. Plasma PP concentrations were more than 20 times higher than those of control littermates. However, PP overproduction led to postnatal lethality in half of the pups because of markedly decreased milk intake. The remaining PP transgenic mice gained less weight with specifically reduced food intake and fat mass compared with controls, a result that was more evident in male than in female mice. The transgenic mice exhibited a reduced rate of gastric emptying of a solid meal but had normal oxygen consumption and fasting leptin levels. Immunoneutralization with anti-PP antiserum reversed the phenotypic changes of transgenic animals. CONCLUSIONS: PP could be involved in feeding and body weight regulation partly through regulation of gastric emptying.
    4. 4
      Batterham, R. L.; Le Roux, C. W.; Cohen, M. A.; Park, A. J.; Ellis, S. M.; Patterson, M.; Frost, G. S.; Ghatei, M. A.; Bloom, S. R. Pancreatic polypeptide reduces appetite and food intake in humans. J. Clin. Endocrinol. Metab. 2003, 88, 3989– 3992,  DOI: 10.1210/jc.2003-030630
      4
      Pancreatic polypeptide reduces appetite and food intake in humans
      Batterham, R. L.; Le Roux, C. W.; Cohen, M. A.; Park, A. J.; Ellis, S. M.; Patterson, M.; Frost, G. S.; Ghatei, M. A.; Bloom, S. R.
      Journal of Clinical Endocrinology and Metabolism (2003), 88 (8), 3989-3992CODEN: JCEMAZ; ISSN:0021-972X. (Endocrine Society)
      Pancreatic polypeptide (PP) is a gut hormone released from the pancreas in response to ingestion of food. Plasma PP has been shown to be reduced in conditions assocd. with increased food intake and elevated in anorexia nervosa. In addn. peripheral administration of PP has been shown to decrease food intake in rodents. These findings suggest that PP may act as a circulating factor that regulates food intake. Therefore we investigated the effect of i.v. infusion of PP (10 pmol/kg/min) on appetite and food intake in a randomized double-blind placebo-controlled crossover study in ten healthy volunteers. Infusion of PP reduced appetite and decreased the energy intake at a buffet lunch two hours post-infusion by 21.8±5.7% (P < 0.01). More importantly the inhibition of food intake was sustained, such that energy intake, as assessed by food diaries, was significantly reduced both the evening of the study and the following morning. Overall PP infusion reduced cumulative 24-h energy intake by 25.3±5.8%. In conclusion our data demonstrates that PP causes a sustained decrease in both appetite and food intake.
    5. 5
      Schmidt, P. T.; Näslund, E.; Grybäck, P.; Jacobsson, H.; Holst, J. J.; Hilsted, L.; Hellström, P. M. A role for pancreatic polypeptide in the regulation of gastric emptying and short-term metabolic control. J. Clin. Endocrinol. Metab. 2005, 90, 5241– 5246,  DOI: 10.1210/jc.2004-2089
      5
      A role for pancreatic polypeptide in the regulation of gastric emptying and short-term metabolic control
      Schmidt, P. T.; Naeslund, E.; Grybaeck, P.; Jacobsson, H.; Holst, J. J.; Hilsted, L.; Hellstroem, P. M.
      Journal of Clinical Endocrinology and Metabolism (2005), 90 (9), 5241-5246CODEN: JCEMAZ; ISSN:0021-972X. (Endocrine Society)
      Context: Previous studies using pancreatic polypeptide (PP) infusions in humans have failed to show an effect on gastric emptying, glucose metab., and insulin secretion. This might be due to the use of nonhuman sequences of the peptide. Objective: The objective of this study was to use synthetic human PP to study gastric emptying rates of a solid meal and postprandial hormone secretion and glucose disposal as well as the gastric emptying rate of water. Design: This was a single-blind study. Setting: The study was performed at a university hospital. Participants: Fourteen healthy adult subjects were studied. Interventions: Infusion of saline or PP at 0.75 or 2.25 pmol/kg·min was given to eight subjects (gastric emptying of solid food), and infusion of saline or PP at 2.25 pmol/kg·min was given to six subjects (gastric emptying of water). Main Outcome Measures: The main outcome measures were gastric emptying of solids (scintigraphy), hunger ratings (visual analog scale), and plasma concns. of PP, insulin, glucagon, somatostatin, glucagon-like peptide 1, glucose, and gastric emptying of plain water (scintigraphy). Results: PP prolonged the lag phase and the half-time of emptying of the solid meal. The change in hunger rating, satiety, desire to eat after the meal, or prospective consumption was not affected. The postprandial rise in plasma glucose was prolonged by PP. The postprandial rise in insulin was also delayed by PP. PP had no significant effect on the emptying of water. Conclusions: PP inhibits gastric emptying of solid food and delays the postprandial rise in plasma glucose and insulin. PP is suggested to have a physiol. role in the pancreatic postprandial counter-regulation of gastric emptying and insulin secretion.
    6. 6
      Painsipp, E.; Wultsch, T.; Edelsbrunner, M. E.; Tasan, R. O.; Singewald, N.; Herzog, H.; Holzer, P. Reduced anxiety-like and depression-related behavior in neuropeptide Y Y4 receptor knockout mice. Genes, Brain Behav. 2008, 7, 532– 542,  DOI: 10.1111/j.1601-183X.2008.00389.x
      6
      Reduced anxiety-like and depression-related behavior in neuropeptide Y Y4 receptor knockout mice
      Painsipp E; Wultsch T; Edelsbrunner M E; Tasan R O; Singewald N; Herzog H; Holzer P
      Genes, brain, and behavior (2008), 7 (5), 532-42 ISSN:.
      Neuropeptide Y (NPY) acting through Y1 receptors reduces anxiety- and depression-like behavior in rodents, whereas Y2 receptor stimulation has the opposite effect. This study addressed the implication of Y4 receptors in emotional behavior by comparing female germ line Y4 knockout (Y4-/-) mice with control and germ line Y2-/- animals. Anxiety- and depression-like behavior was assessed with the open field (OF), elevated plus maze (EPM), stress-induced hyperthermia (SIH) and tail suspension tests (TST), respectively. Learning and memory were evaluated with the object recognition test (ORT). In the OF and EPM, both Y4-/- and Y2-/- mice exhibited reduced anxiety-related behavior and enhanced locomotor activity relative to control animals. Locomotor activity in a familiar environment was unchanged in Y4-/- but reduced in Y2-/- mice. The basal rectal temperature exhibited diurnal and genotype-related alterations. Control mice had temperature minima at noon and midnight, whereas Y4-/- and Y2-/- mice displayed only one temperature minimum at noon. The magnitude of SIH was related to time of the day and genotype in a complex manner. In the TST, the duration of immobility was significantly shorter in Y4-/- and Y2-/- mice than in controls. Object memory 6 h after initial exposure to the ORT was impaired in Y2-/- but not in Y4-/- mice, relative to control mice. These results show that genetic deletion of Y4 receptors, like that of Y2 receptors, reduces anxiety-like and depression-related behavior. Unlike Y2 receptor knockout, Y4 receptor knockout does not impair object memory. We propose that Y4 receptors play an important role in the regulation of behavioral homeostasis.
    7. 7
      Lin, S.; Shi, Y.-C.; Yulyaningsih, E.; Aljanova, A.; Zhang, L.; Macia, L.; Nguyen, A. D.; Lin, E.-J. D.; During, M. J.; Herzog, H.; Sainsbury, A. Critical role of arcuate Y4 receptors and the melanocortin system in pancreatic polypeptide-induced reduction in food intake in mice. PLoS One 2009, 4, e8488  DOI: 10.1371/journal.pone.0008488
      There is no corresponding record for this reference.
    8. 8
      Tasan, R. O.; Lin, S.; Hetzenauer, A.; Singewald, N.; Herzog, H.; Sperk, G. Increased novelty-induced motor activity and reduced depression-like behavior in neuropeptide Y (NPY)-Y4 receptor knockout mice. Neuroscience 2009, 158, 1717– 1730,  DOI: 10.1016/j.neuroscience.2008.11.048
      There is no corresponding record for this reference.
    9. 9
      Sainsbury, A.; Shi, Y. C.; Zhang, L.; Aljanova, A.; Lin, Z.; Nguyen, A. D.; Herzog, H.; Lin, S. Y4 receptors and pancreatic polypeptide regulate food intake via hypothalamic orexin and brain-derived neurotropic factor dependent pathways. Neuropeptides 2010, 44, 261– 268,  DOI: 10.1016/j.npep.2010.01.001
      9
      Y4 receptors and pancreatic polypeptide regulate food intake via hypothalamic orexin and brain-derived neurotropic factor dependent pathways
      Sainsbury, Amanda; Shi, Yan-Chuan; Zhang, Lei; Aljanova, Aygul; Lin, Zhou; Nguyen, Amy D.; Herzog, Herbert; Lin, Shu
      Neuropeptides (Oxford, United Kingdom) (2010), 44 (3), 261-268CODEN: NRPPDD; ISSN:0143-4179. (Elsevier Ltd.)
      Gut-derived peptides are known to regulate food intake by activating specific receptors in the brain, but the target nuclei and neurons influenced are largely unknown. Here we show that peripherally administered pancreatic polypeptide (PP) stimulates neurons in key nuclei of the hypothalamus crit. for appetite and satiety regulation. In the lateral hypothalamic area (LHA), also known as the feeding center, neurons expressing the orexigenic neuropeptide orexin colocalize with the early neuronal activation marker c-Fos upon i.p. injection of PP into mice. In the ventromedial hypothalamus (VMH), also known as the satiety center, neurons activated by PP, as indicated by induction of c-Fos immunoreactivity, express the anorexigenic brain-derived neurotrophic factor (BDNF). Activation of neurons in the LHA and VMH in response to PP occurs via a Y4 receptor-dependent process as it is not seen in Y4 receptor knockout mice. We further demonstrate that in response to i.p. PP, orexin mRNA expression in the LHA is down-regulated, with Y4 receptors being crit. for this effect as it is not seen in Y4 receptor knockout mice, whereas BDNF mRNA expression is up-regulated in the VMH in response to i.p. PP in the fasted, but not in the non-fasted state. Taken together these data suggest that PP can regulate food intake by suppressing orexigenic pathways by down-regulation of orexin and simultaneously increasing anorexigenic pathways by up-regulating BDNF.
    10. 10
      Li, J. B.; Asakawa, A.; Terashi, M.; Cheng, K.; Chaolu, H.; Zoshiki, T.; Ushikai, M.; Sheriff, S.; Balasubramaniam, A.; Inui, A. Regulatory effects of Y4 receptor agonist (BVD-74D) on food intake. Peptides 2010, 31, 1706– 1710,  DOI: 10.1016/j.peptides.2010.06.011
      10
      Regulatory effects of Y4 receptor agonist (BVD-74D) on food intake
      Li, Jiang-Bo; Asakawa, Akihiro; Terashi, Mutsumi; Cheng, Kai-Chun; Chaolu, Huhe; Zoshiki, Takahiro; Ushikai, Miharu; Sheriff, Sulaiman; Balasubramaniam, Ambikaipakan; Inui, Akio
      Peptides (New York, NY, United States) (2010), 31 (9), 1706-1710CODEN: PPTDD5; ISSN:0196-9781. (Elsevier)
      The objective of this study was to clarify the role of a novel agonist with high selectivity and affinity for Y4 receptors in the regulation of food intake. The Y4 receptor agonist BVD-74D was administered to C57BL/6J mice that were fed with a normal or high-fat diet, and to fatty liver Shionogi (FLS)-ob/ob mice; the food intake, water intake, and body wt. gain were measured in these mice. In the mice fed with a normal diet, the cumulative food intake significantly decreased at 20 min and 1 h after the administration of 1 mg/kg of BVD-74D and at 1, 2, 4, 8, and 24 h after the administration of 10 mg/kg of BVD-74D. Moreover, the cumulative water intake and body wt. gain significantly decreased in these mice. Among the mice that were fed with a high-fat diet, the cumulative food intake and water intake significantly decreased 1, 2, and 4 h after BVD-74D (10 mg/kg) administration. Furthermore, the cumulative food intake significantly decreased 2 and 4 h after BVD-74D (10 mg/kg) administration in the FLS-ob/ob mice. Thus, we propose that the novel Y4 receptor agonist BVD-74D has suppressive effects on food intake, water intake, and wt. gain in normal mice fed with normal diets and on food intake in normal mice fed with high-fat diets and in FLS-ob/ob mice. These findings indicate that the Y4 receptor and its agonist would be promising targets for obesity.
    11. 11
      Moriya, R.; Fujikawa, T.; Ito, J.; Shirakura, T.; Hirose, H.; Suzuki, J.; Fukuroda, T.; MacNeil, D. J.; Kanatani, A. Pancreatic polypeptide enhances colonic muscle contraction and fecal output through neuropeptide Y Y4 receptor in mice. Eur. J. Pharmacol. 2010, 627, 258– 264,  DOI: 10.1016/j.ejphar.2009.09.057
      There is no corresponding record for this reference.
    12. 12
      Brothers, S. P.; Wahlestedt, C. Therapeutic potential of neuropeptide Y (NPY) receptor ligands. EMBO Mol. Med. 2010, 2, 429– 439,  DOI: 10.1002/emmm.201000100
      12
      Therapeutic potential of neuropeptide Y (NPY) receptor ligands
      Brothers, Shaun P.; Wahlestedt, Claes
      EMBO Molecular Medicine (2010), 2 (11), 429-439CODEN: EMMMAM; ISSN:1757-4684. (Wiley-Blackwell)
      A review. Neuropeptide Y (NPY) is widely distributed in the human body and contributes to a vast no. of physiol. processes. Since its discovery, NPY has been implicated in metabolic regulation and, although interest in its role in central mechanisms related to food intake and obesity has somewhat diminished, the topic remains a strong focus of research concerning NPY signalling. In addn., a no. of other uses for modulators of NPY receptors have been implied in a range of diseases, although the development of NPY receptor ligands has been slow, with no clin. approved receptor therapeutics currently available. Nevertheless, several interesting small mol. compds., notably Y2 receptor antagonists, have been published recently, fueling optimism in the field. Herein we review the role of NPY in the pathophysiol. of a no. of diseases and highlight instances where NPY receptor signalling systems are attractive therapeutic targets.
    13. 13
      Verma, D.; Hörmer, B.; Bellmann-Sickert, K.; Thieme, V.; Beck-Sickinger, A. G.; Herzog, H.; Sperk, G.; Tasan, R. O. Pancreatic polypeptide and its central Y4 receptors are essential for cued fear extinction and permanent suppression of fear. Br. J. Pharmacol. 2016, 173, 1925– 1938,  DOI: 10.1111/bph.13456
      13
      Pancreatic polypeptide and its central Y4 receptors are essential for cued fear extinction and permanent suppression of fear
      Verma, D.; Hoermer, B.; Bellmann-Sickert, K.; Thieme, V.; Beck-Sickinger, A. G.; Herzog, H.; Sperk, G.; Tasan, R. O.
      British Journal of Pharmacology (2016), 173 (12), 1925-1938CODEN: BJPCBM; ISSN:1476-5381. (Wiley-Blackwell)
      Background and purpose : Avoiding danger and finding food are closely related behaviors that are essential for surviving in a natural environment. Growing evidence supports an important role of gut-brain peptides in modulating energy homeostasis and emotional-affective behavior. For instance, postprandial release of pancreatic polypeptide (PP) reduced food intake and altered stress-induced motor activity and anxiety by activating central Y4 receptors. Exptl. approach : We characterized [K30(PEG2)]hPP2-36 as long-acting Y4 receptor agonist and injected it peripherally into wildtype and Y4 receptor knockout (Y4KO) C57Bl/6NCrl mice to investigate the role of Y4 receptors in fear conditioning. Extinction and relapse after extinction was measured by spontaneous recovery and renewal. Key results : The Y4KO mice showed impaired cued and context fear extinction without affecting acquisition, consolidation or recall of fear. Correspondingly, peripheral injection of [K30(PEG2)]hPP2-36 facilitated extinction learning upon fasting, an effect that was long-lasting and generalized. Furthermore, peripherally applied [K30(PEG2)]hPP2-36 before extinction inhibited the activation of orexin-expressing neurons in the lateral hypothalamus in WT, but not in Y4KO mice. Conclusions and implications : Our findings suggests suppression of excessive arousal as a possible mechanism for the extinction-promoting effect of central Y4 receptors and provide strong evidence that fear extinction requires integration of vegetative stimuli with cortical and subcortical information, a process crucially depending on Y4 receptors. Importantly, in the lateral hypothalamus two peptide systems, PP and orexin, interact to generate an emotional response adapted to the current homeostatic state. Detailed investigations of feeding-relevant genes may thus deliver multiple intervention points for treating anxiety-related disorders.
    14. 14
      Zhang, L.; Bijker, M. S.; Herzog, H. The neuropeptide Y system: Pathophysiological and therapeutic implications in obesity and cancer. Pharmacol. Ther. 2011, 131, 91– 113,  DOI: 10.1016/j.pharmthera.2011.03.011
      14
      The neuropeptide Y system: Pathophysiological and therapeutic implications in obesity and cancer
      Zhang, Lei; Bijker, Martijn S.; Herzog, Herbert
      Pharmacology & Therapeutics (2011), 131 (1), 91-113CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)
      A review. The neuropeptide Y (NPY) system - comprising of neuropeptide Y, peptide YY, pancreatic polypeptide and the corresponding Y receptors through which they act (Y1, Y2, Y4, Y5 and y6) - is well known for its role in the regulation of energy homeostasis and assocd. processes. Dysfunctions of the system have been implicated in human diseases such as obesity and cancer, raising the possibility that correction of the system may provide therapeutic benefits for these diseases. In addn. to the regulation of appetite and satiety that has attracted most attention during the past years, insight has also been gained into the crit. role of NPY in the control of energy expenditure, oxidative fuel selection and bone metab. Studies using conditional knockout models further shed light on the central vs. peripheral, and hypothalamic vs. extra-hypothalamic mechanisms of these regulatory effects of NPY. Moreover, a role of NPY family peptides and Y receptors in modulating the growth of tumors has emerged. These findings provide the basis for novel NPY system-targeted strategies to treat obesity as well as cancer. Such strategies include modifying both sides of the energy balance equation - energy intake vs. energy expenditure - to achieve a greater wt./fat loss by particularly modulating peripheral Y receptor(s) to ameliorate metabolic conditions without interfering with central functions of Y receptors. In addn., targeting multiple Y receptors and/or multiple systems involved in the regulation of energy balance will have greater beneficial effects. However, long-term interference with the NPY system to target obesity or cancer related aspects needs to consider potential side effects on bone health.
    15. 15
      Yi, M.; Li, H.; Wu, Z.; Yan, J.; Liu, Q.; Ou, C.; Chen, M. A promising therapeutic target for metabolic diseases: Neuropeptide Y receptors in humans. Cell. Physiol. Biochem. 2018, 45, 88– 107,  DOI: 10.1159/000486225
      15
      A Promising Therapeutic Target for Metabolic Diseases: Neuropeptide Y Receptors in Humans
      Yi, Min; Li, Hekai; Wu, Zhiye; Yan, Jianyun; Liu, Qicai; Ou, Caiwen; Chen, Minsheng
      Cellular Physiology and Biochemistry (2018), 45 (1), 88-107CODEN: CEPBEW; ISSN:1015-8987. (S. Karger AG)
      Human neuropeptide Y (hNPY) is one of the most widely expressed neurotransmitters in the human central and peripheral nervous systems. It consists of 36 highly conserved amino acid residues, and was first isolated from the porcine hypothalamus in 1982. While it is the most recently discovered member of the pancreatic polypeptide family (which includes neuropeptide Y, gut-derived hormone peptide YY, and pancreatic polypeptide), NPY is the most abundant peptide found in the mammalian brain. In order to exert particular functions, NPY needs to bind to the NPY receptor to activate specific signaling pathways. NPY receptors belong to the class A or rhodopsin-like G-protein coupled receptor (GPCR) family and signal via cell-surface receptors. By binding to GPCRs, NPY plays a crucial role in various biol. processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Abnormal regulation of NPY is involved in the development of a wide range of diseases, including obesity, hypertension, atherosclerosis, epilepsy, metabolic disorders, and many cancers. Thus far, five receptors have been cloned from mammals (Y1, Y2, Y4, Y5, and y6), but only four of these (hY1, hY2, hY4, and hY5) are functional in humans. In this review, we summarize the structural characteristics of human NPY receptors and their role in metabolic diseases.
    16. 16
      Allen, M.; Reeves, J.; Mellor, G. High throughput fluorescence polarization: a homogeneous alternative to radioligand binding for cell surface receptors. J. Biomol. Screening 2000, 5, 63– 69,  DOI: 10.1177/108705710000500202
      16
      High throughput fluorescence polarization: a homogeneous alternative to radioligand binding for cell surface receptors
      Allen, Michael; Reeves, Julian; Mellor, Geoffrey
      Journal of Biomolecular Screening (2000), 5 (2), 63-69CODEN: JBISF3; ISSN:1087-0571. (Mary Ann Liebert, Inc.)
      High throughput fluorescence polarization (FP) assays are described that offer a nonradioactive, homogeneous, and low-cost alternative to radioligand binding assays for cell surface receptors (G protein-coupled receptors and ligand-gated ion channels). FP assays were shown to work across a range of both peptide (vasopressin V1a and δ-opioid) and nonpeptide (β1-adrenoceptor, 5-hydroxytryptamine3) receptors. Structure-activity relationships were investigated at β1-receptors and were found to be consistent with radioligand binding assays. FP was shown to tolerate up to 5% DMSO with no loss in sensitivity or signal window. From a random set of 1,280 compds., 1.9% were found to significantly interfere with FP measurement. If fluorescent or quenching compds. were eliminated (3% of all compds.), less than 0.4% of compds. were found to interfere with FP measurement. Assays could be run in 384-well plates with little loss of signal window or sensitivity compared to 96-well plate assays. New advances in FP measurement have therefore enabled FP to offer a high throughput alternative to radioligand binding for cell surface receptors.
    17. 17
      Leyris, J.-P.; Roux, T.; Trinquet, E.; Verdié, P.; Fehrentz, J.-A.; Oueslati, N.; Douzon, S.; Bourrier, E.; Lamarque, L.; Gagne, D. Homogeneous time-resolved fluorescence-based assay to screen for ligands targeting the growth hormone secretagogue receptor type 1a. Anal. Biochem. 2011, 408, 253– 262,  DOI: 10.1016/j.ab.2010.09.030
      17
      Homogeneous time-resolved fluorescence-based assay to screen for ligands targeting the growth hormone secretagogue receptor type 1a
      Leyris, Jean-Philippe; Roux, Thomas; Trinquet, Eric; Verdie, Pascal; Fehrentz, Jean-Alain; Oueslati, Nadia; Douzon, Stephanie; Bourrier, Emmanuel; Lamarque, Laurent; Gagne, Didier; Galleyrand, Jean-Claude; M'kadmi, Celine; Martinez, Jean; Mary, Sophie; Baneres, Jean-Louis; Marie, Jacky
      Analytical Biochemistry (2011), 408 (2), 253-262CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
      The growth hormone secretagogue receptor type 1a (GHS-R1a) belongs to class A G-protein-coupled receptors (GPCR). This receptor mediates pleiotropic effects of ghrelin and represents a promising target for dysfunctions of growth hormone secretion and energy homeostasis including obesity. Identification of new compds. which bind GHS-R1a is traditionally achieved using radioactive binding assays. Here we propose a new fluorescence-based assay, called Tag-lite binding assay, based on a fluorescence resonance energy transfer (FRET) process between a terbium cryptate covalently attached to a SNAP-tag fused GHS-R1a (SNAP-GHS-R1a) and a high-affinity red fluorescent ghrelin ligand. The long fluorescence lifetime of the terbium cryptate allows a time-resolved detection of the FRET signal. The assay was made compatible with high-throughput screening by using prelabeled cells in suspension under a 384-well plate format. Ki values for a panel of 14 compds. displaying agonist, antagonist, or inverse agonist properties were detd. using both the radioactive and the Tag-lite binding assays performed on the same batches of GHS-R1a-expressing cells. Compd. potencies obtained in the two assays were nicely correlated. This study is the first description of a sensitive and reliable nonradioactive binding assay for GHS-R1a in a format amenable to high-throughput screening.
    18. 18
      Emami-Nemini, A.; Roux, T.; Leblay, M.; Bourrier, E.; Lamarque, L.; Trinquet, E.; Lohse, M. J. Time-resolved fluorescence ligand binding for G protein–coupled receptors. Nat. Protoc. 2013, 8, 1307– 1320,  DOI: 10.1038/nprot.2013.073
      18
      Time-resolved fluorescence ligand binding for G protein-coupled receptors
      Emami-Nemini, Alexander; Roux, Thomas; Leblay, Marion; Bourrier, Emmanuel; Lamarque, Laurent; Trinquet, Eric; Lohse, Martin J.
      Nature Protocols (2013), 8 (7), 1307-1320, 14 pp.CODEN: NPARDW; ISSN:1750-2799. (Nature Publishing Group)
      G protein-coupled receptors (GPCRs) and their ligands are traditionally characterized by radioligand-binding expts. These expts. yield excellent quant. data, but have low temporal and spatial resoln. In addn., the use of radioligands presents safety concerns. Here we provide a general procedure for an alternative approach with high temporal and spatial resoln., based on Tb+-labeled fluorescent receptor ligands and time-resolved fluorescence resonance energy transfer (TR-FRET). This protocol and its design are detailed here for the parathyroid hormone receptor, a class B GPCR, and its fluorescently labeled 34-amino acid peptide ligand, but it can be easily modified for other receptors and their appropriately labeled ligands. We discuss three protocol options that use Tb+-labeled fluorescent ligands: a time-resolved fluorescence sepn. option that works on native receptors but requires sepn. of bound and unbound ligand; a TR-FRET option using SNAP-tag-labeled receptors for high-throughput screening; and a TR-FRET option that uses fluorescently labeled antibodies directed against an epitope engineered into the Flag-labeled receptors' N terminus. These protocol options can be used as std. procedures with very high signal-to-background ratios in order to characterize ligands and their receptors in living cells and in cell membranes via straightforward plate-reader measurements.
    19. 19
      Veiksina, S.; Kopanchuk, S.; Rinken, A. Budded baculoviruses as a tool for a homogeneous fluorescence anisotropy-based assay of ligand binding to G protein-coupled receptors: The case of melanocortin 4 receptors. Biochim. Biophys. Acta, Biomembr. 2014, 1838, 372– 381,  DOI: 10.1016/j.bbamem.2013.09.015
      19
      Budded baculoviruses as a tool for a homogeneous fluorescence anisotropy-based assay of ligand binding to G protein-coupled receptors: The case of melanocortin 4 receptors
      Veiksina, Santa; Kopanchuk, Sergei; Rinken, Ago
      Biochimica et Biophysica Acta, Biomembranes (2014), 1838 (1PB), 372-381CODEN: BBBMBS; ISSN:0005-2736. (Elsevier B.V.)
      We present here the implementation of budded baculoviruses that display G protein-coupled receptors on their surfaces for the investigation of ligand-receptor interactions using fluorescence anisotropy (FA). Melanocortin 4 (MC4) receptors and the fluorescent ligand Cy3B-NDP-α-MSH were used as the model system. The real-time monitoring of reactions and the high assay quality allow the application of global data anal. with kinetic mechanistic models that take into account the effect of nonspecific interactions and the depletion of the fluorescent ligand during the reaction. The receptor concn., affinity and kinetic parameters of fluorescent ligand binding as well as state anisotropies for different fluorescent ligand populations were detd. At low Cy3B-NDP-α-MSH concns., a one-site receptor-ligand binding model described the processes, whereas divergence from this model was obsd. at higher ligand concns., which indicated a more complex mechanism of interactions similar to those mechanisms that have been found in expts. with radioactive ligands. The information obtained from our kinetic expts. and the inherent flexibility of FA assays also allowed the estn. of binding parameters for several MC4 receptor-specific unlabeled compds. In summary, the FA assay that was developed with budded baculoviruses led the exptl. data to a level that would solve complex models of receptor-ligand interactions also for other receptor systems and would become as a valuable tool for the screening of pharmacol. active compds.
    20. 20
      Schiele, F.; Ayaz, P.; Fernández-Montalván, A. A universal homogeneous assay for high-throughput determination of binding kinetics. Anal. Biochem. 2015, 468, 42– 49,  DOI: 10.1016/j.ab.2014.09.007
      20
      A universal homogeneous assay for high-throughput determination of binding kinetics
      Schiele, Felix; Ayaz, Pelin; Fernandez-Montalvan, Amaury
      Analytical Biochemistry (2015), 468 (), 42-49CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
      There is an increasing demand for assay technologies that enable accurate, cost-effective, and high-throughput measurements of drug-target assocn. and dissocn. rates. Here the authors introduce a universal homogeneous kinetic probe competition assay (kPCA) that meets these requirements. The time-resolved fluorescence energy transfer (TR-FRET) procedure combines the versatility of radioligand binding assays with the advantages of homogeneous nonradioactive techniques while approaching the time resoln. of surface plasmon resonance (SPR) and related biosensors. The authors show application of kPCA for three important target classes: enzymes, protein-protein interactions, and G protein-coupled receptors (GPCRs). This method is capable of supporting early stages of drug discovery with large amts. of kinetic information.
    21. 21
      Antoine, T.; Ott, D.; Ebell, K.; Hansen, K.; Henry, L.; Becker, F.; Hannus, S. Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy. Anal. Biochem. 2016, 502, 24– 35,  DOI: 10.1016/j.ab.2016.02.017
      21
      Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy
      Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan
      Analytical Biochemistry (2016), 502 (), 24-35CODEN: ANBCA2; ISSN:0003-2697. (Elsevier B.V.)
      G protein-coupled receptors (GPCRs) mediate many important physiol. functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of exptl. approaches for screening compd. libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small mols., and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput detn. of receptor-ligand binding affinities and kinetic rate consts. for various therapeutically relevant GPCRs.
    22. 22
      Stoddart, L. A.; White, C. W.; Nguyen, K.; Hill, S. J.; Pfleger, K. D. Fluorescence- and bioluminescence-based approaches to study GPCR ligand binding. Br. J. Pharmacol. 2016, 173, 3028– 3037,  DOI: 10.1111/bph.13316
      22
      Fluorescence- and bioluminescence-based approaches to study GPCR ligand binding
      Stoddart, Leigh A.; White, Carl W.; Nguyen, Kim; Hill, Stephen J.; Pfleger, Kevin D. G.
      British Journal of Pharmacology (2016), 173 (20), 3028-3037CODEN: BJPCBM; ISSN:1476-5381. (Wiley-Blackwell)
      Ligand binding is a vital component of any pharmacologist's toolbox and allows the detailed investigation of how a mol. binds to its receptor. These studies enable the exptl. detn. of binding affinity of labeled and unlabeled compds. through kinetic, satn. (Kd) and competition (Ki) binding assays. Traditionally, these studies have used mols. labeled with radioisotopes; however, more recently, fluorescent ligands have been developed for this purpose. This review will briefly cover receptor ligand binding theory and then discuss the use of fluorescent ligands with some of the different technologies currently employed to examine ligand binding. Fluorescent ligands can be used for direct measurement of receptor-assocd. fluorescence using confocal microscopy and flow cytometry as well as in assays such as fluorescence polarization, where ligand binding is monitored by changes in the free rotation when a fluorescent ligand is bound to a receptor. Addnl., fluorescent ligands can act as donors or acceptors for fluorescence resonance energy transfer (FRET) with the development of assays based on FRET and time-resolved FRET (TR-FRET). Finally, we have recently developed a novel bioluminescence resonance energy transfer (BRET) ligand binding assay utilizing a small (19 kDa), super-bright luciferase subunit (NanoLuc) from a deep sea shrimp. In combination with fluorescent ligands, measurement of RET now provides an array of methodologies to study ligand binding. While each method has its own advantages and drawbacks, binding studies using fluorescent ligands are now a viable alternative to the use of radioligands.
    23. 23
      Stoddart, L. A.; Kilpatrick, L. E.; Hill, S. J. NanoBRET approaches to study ligand binding to GPCRs and RTKs. Trends Pharmacol. Sci. 2018, 39, 136– 147,  DOI: 10.1016/j.tips.2017.10.006
      23
      NanoBRET Approaches to Study Ligand Binding to GPCRs and RTKs
      Stoddart, Leigh A.; Kilpatrick, Laura E.; Hill, Stephen J.
      Trends in Pharmacological Sciences (2018), 39 (2), 136-147CODEN: TPHSDY; ISSN:0165-6147. (Elsevier Ltd.)
      Recent advances in the development of fluorescent ligands for G-protein-coupled receptors (GPCRs) and receptor tyrosine kinase receptors (RTKs) have facilitated the study of these receptors in living cells. A limitation of these ligands is potential uptake into cells and increased nonspecific binding. However, this can largely be overcome by using proximity approaches, such as bioluminescence resonance energy transfer (BRET), which localize the signal (within 10 nm) to the specific receptor target. The recent engineering of NanoLuc has resulted in a luciferase variant that is smaller and significantly brighter (up to tenfold) than existing variants. Here, we review the use of BRET from N-terminal NanoLuc-tagged GPCRs or a RTK to a receptor-bound fluorescent ligand to provide quant. pharmacol. of ligand-receptor interactions in living cells in real time.
    24. 24
      Iliopoulos-Tsoutsouvas, C.; Kulkarni, R. N.; Makriyannis, A.; Nikas, S. P. Fluorescent probes for G-protein-coupled receptor drug discovery. Expert Opin. Drug Discovery 2018, 13, 933– 947,  DOI: 10.1080/17460441.2018.1518975
      24
      Fluorescent probes for G-protein-coupled receptor drug discovery
      Iliopoulos-Tsoutsouvas, Christos; Kulkarni, Rohit N.; Makriyannis, Alexandros; Nikas, Spyros P.
      Expert Opinion on Drug Discovery (2018), 13 (10), 933-947CODEN: EODDBX; ISSN:1746-0441. (Taylor & Francis Ltd.)
      A review. G-protein-coupled receptors (GPCRs) mediate the effects of approx. 33% of all marketed drugs. The development of tools to study GPCR pharmacol. is urgently needed as it can lead to the discovery of safer and more effective medications. Fluorescent GPCR ligands represent highly sensitive and safe small-mol. tools for real-time exploration of the life of the receptor, cellular signaling, and ligand-/receptor-receptor interactions in cellulo and/or in vivo.: This review summarizes relevant information from published literature and provides crit. insights into the design of successful small-mol. fluorescent probes for Class A GPCRs as potential major targets for drug development.: Considering the rapid progress of fluorescence technologies, effective small-mol. fluorescent probes represent valuable pharmacol. tools for studying GPCRs. However, the design and development of such probes are challenging, largely due to the low affinity/specificity of the probe for its target, inadequate photophys. properties, extensive non-specific binding, and/or low signal-to-noise ratio. Generally speaking, fluorescent and luminescent small-mol. probes, receptors, and G proteins in combination with FRET and BRET technologies hold great promise for studying kinetic profiles of GPCR signaling.
    25. 25
      Ziemek, R.; Schneider, E.; Kraus, A.; Cabrele, C.; Beck-Sickinger, A. G.; Bernhardt, G.; Buschauer, A. Determination of affinity and activity of ligands at the human neuropeptide Y Y4 receptor by flow cytometry and aequorin luminescence. J. Recept. Signal Transduction 2007, 27, 217– 233,  DOI: 10.1080/10799890701505206
      25
      Determination of Affinity and Activity of Ligands at the Human Neuropeptide Y Y4 Receptor by Flow Cytometry and Aequorin Luminescence
      Ziemek, Ralf; Schneider, Erich; Kraus, Anja; Cabrele, Chiara; Beck-Sickinger, Annette G.; Bernhardt, Guenther; Buschauer, Armin
      Journal of Receptors and Signal Transduction (2007), 27 (4), 217-233CODEN: JRSTCT ISSN:. (Informa Healthcare)
      Fluorescence-labeled neuropeptide Y (NPY) has been used in flow cytometric binding assays for the detn. of affinity consts. of NPY Y1, Y2, and Y5 receptor ligands. Because the binding of fluorescent NPY is insufficient for competition studies at the human Y4 receptor (hY4R), the authors replaced Glu 4 in hPP with Lys for the derivatization with cyanine-5. Because cy5-[K4]hPP has high affinity (Kd 5.6 nM) to the hY4R, it was used as a probe in a flow cytometric binding assay. Specific binding of cy5-[K4]hPP to hY4R was visualized by confocal microscopy. The hY4R, the chimeric G protein Gqi5 and mitochondrially targeted apoaequorin were stably coexpressed in CHO cells. Aequorin luminescence was quantified in a microplate reader and by a CCD camera. By application of these methods 3-cyclohexyl-N-[(3-1H-imidazol-4-ylpropylamino)(imino)methyl]propanamide (UR-AK49)was discovered as the first nonpeptidic Y4R antagonist (pKi 4.17), a lead to be optimized in terms of potency and selectivity.
    26. 26
      Dukorn, S.; Littmann, T.; Keller, M.; Kuhn, K.; Cabrele, C.; Baumeister, P.; Bernhardt, G.; Buschauer, A. Fluorescence- and radiolabeling of [Lys4,Nle17,30]hPP yields molecular tools for the NPY Y4 receptor. Bioconjugate Chem. 2017, 28, 1291– 1304,  DOI: 10.1021/acs.bioconjchem.7b00103
      26
      Fluorescence- and Radiolabeling of [Lys4,Nle17,30]hPP Yields Molecular Tools for the NPY Y4 Receptor
      Dukorn, Stefanie; Littmann, Timo; Keller, Max; Kuhn, Kilian; Cabrele, Chiara; Baumeister, Paul; Bernhardt, Guenther; Buschauer, Armin
      Bioconjugate Chemistry (2017), 28 (4), 1291-1304CODEN: BCCHES; ISSN:1043-1802. (American Chemical Society)
      The neuropeptide Y (NPY) Y4 receptor (Y4R) is involved in energy homeostasis and considered a potential drug target for the treatment of obesity. Only a few mol. tools, i.e., radiolabeled and fluorescent ligands, for the investigation of the Y4R were reported. Previously, [Lys4]hPP proved to be an appropriate full-length PP analog to prep. a fluorescent ligand by derivatization at the ε-amino group. To preclude oxidn. upon long-term storage, the authors replaced the two methionine residues in [Lys4]hPP by norleucine and prepd. the corresponding [3H]propionylated ([3H]12) and cyanine labeled (13) peptides, which were characterized and compared with a set of ref. compds. in binding (Y1, Y2, Y4, and Y5 receptors) and functional (luciferase gene reporter, beta-arrestin-1,2) Y4R assays. Both mol. probes proved to be useful in radiochem. and flow cytometric satn. and competition Y4R binding expts. Most strikingly, there was a different influence of the compn. of buffer on equil. binding and kinetics: [3H]12 affinity (Kd in Na+-free buffer: 1.1 nM) clearly decreased with increasing sodium ion concn., whereas dissocn. and Y4R-mediated internalization of 13 (Kd in Na+-free buffer: 10.8 nM) were strongly affected by the osmolarity of the buffer as demonstrated by confocal microscopy. Displacement of [3H]12 and 13 revealed a tendency to higher apparent affinities for a set of ref. peptides in hypotonic (Na+-free) compared to isotonic buffers. The differences were negligible in the case of hPP but up to 270-fold in the case of GW1229 (GR231118). By contrast, no relevant influence of Na+ on Y5R affinity became obvious, when the radioligands [H]12 and [3H]propionyl-pNPY were investigated in satn. binding and competition binding.
    27. 27
      Tang, T.; Tan, Q.; Han, S.; Diemar, A.; Löbner, K.; Wang, H.; Schüß, C.; Behr, V.; Mörl, K.; Wang, M.; Chu, X.; Yi, C.; Keller, M.; Kofoed, J.; Reedtz-Runge, S.; Kaiser, A.; Beck-Sickinger, A. G.; Zhao, Q.; Wu, B. Receptor-specific recognition of NPY peptides revealed by structures of NPY receptors. Sci. Adv. 2022, 8, eabm1232  DOI: 10.1126/sciadv.abm1232
      There is no corresponding record for this reference.
    28. 28
      Kuhn, K. K.; Littmann, T.; Dukorn, S.; Tanaka, M.; Keller, M.; Ozawa, T.; Bernhardt, G.; Buschauer, A. In search of NPY Y4R antagonists: Incorporation of carbamoylated arginine, aza-amino acids, or D-amino acids into oligopeptides derived from the C-termini of the endogenous agonists. ACS Omega 2017, 2, 3616– 3631,  DOI: 10.1021/acsomega.7b00451
      28
      In Search of NPY Y4R Antagonists: Incorporation of Carbamoylated Arginine, Aza-Amino Acids, or D-Amino Acids into Oligopeptides Derived from the C-Termini of the Endogenous Agonists
      Kuhn, Kilian K.; Littmann, Timo; Dukorn, Stefanie; Tanaka, Miho; Keller, Max; Ozawa, Takeaki; Bernhardt, Guenther; Buschauer, Armin
      ACS Omega (2017), 2 (7), 3616-3631CODEN: ACSODF; ISSN:2470-1343. (American Chemical Society)
      The crosslinked pentapeptides (2R,7R)-diaminooctanedioyl-bis(Tyr-Arg-Leu-Arg-Tyr-amide) ((2R,7R)-BVD-74D, (2R,7R)-1) and octanedioyl-bis(Tyr-Arg-Leu-Arg-Tyr-amide) (2) as well as the pentapeptide Ac-Tyr-Arg-Leu-Arg-Tyr-amide (3) were previously described as neuropeptide Y Y4 receptor (Y4R) partial agonists. Here the authors report on a series of analogs of (2R,7R)-1 and 2 in which Arg2, Leu3 or Arg4 were replaced by the resp. aza-amino acids. The replacement of Arg2 in 3 with a carbamoylated arginine building block and the extension of the N-terminus by an addnl. arginine led to the high-affinity hexapeptide Ac-Arg-Tyr-Nω-[(4-aminobutyl)aminocarbonyl]Arg-Leu-Arg-Tyr-amide that was used as a precursor for a D-amino acid scan. The target compds. were investigated for Y4R functional activity in assays with complementary readouts: aequorin Ca2+ and β-arrestin 1 or β-arrestin 2 assays. In contrast to the parent compds., which are Y4R agonists, several ligands were able to suppress the effect elicited by the endogenous ligand pancreatic polypeptide and therefore represent a novel class of peptide Y4R antagonists.
    29. 29
      Spinnler, K.; von Krüchten, L.; Konieczny, A.; Schindler, L.; Bernhardt, G.; Keller, M. An alkyne-functionalized arginine for solid-phase synthesis enabling “bioorthogonal” peptide conjugation. ACS Med. Chem. Lett. 2020, 11, 334– 339,  DOI: 10.1021/acsmedchemlett.9b00388
      29
      An alkyne-functionalized arginine for solid-phase synthesis enabling "bioorthogonal" peptide conjugation
      Spinnler, Katrin; von Kruechten, Lara; Konieczny, Adam; Schindler, Lisa; Bernhardt, Guenther; Keller, Max
      ACS Medicinal Chemistry Letters (2020), 11 (3), 334-339CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)
      Lately, amino-functionalized Nω-carbamoylated arginines were introduced as arginine surrogates enabling peptide labeling. However, this approach is hardly compatible with peptides also contg. lysine or cysteine. Here, we present the synthesis of an alkyne-functionalized, Nω-carbamoylated arginine building block, which is compatible with Fmoc-strategy solid-phase peptide synthesis. The alkynylated arginine was incorporated into three biol. active linear hexapeptides and into a cyclic pentapeptide. Peptide conjugation to an azido-functionalized fluorescent dye via "click" chem. was successfully demonstrated. In the case of a peptide also contg. lysine besides the alkyne-functionalized arginine, this was feasible in a "bioorthogonal" manner.
    30. 30
      Konieczny, A.; Conrad, M.; Ertl, F. J.; Gleixner, J.; Gattor, A. O.; Grätz, L.; Schmidt, M. F.; Neu, E.; Horn, A. H. C.; Wifling, D.; Gmeiner, P.; Clark, T.; Sticht, H.; Keller, M. N-terminus to arginine side-chain cyclization of linear peptidic neuropeptide Y Y4 receptor ligands results in picomolar binding constants. J. Med. Chem. 2021, 64, 16746– 16769,  DOI: 10.1021/acs.jmedchem.1c01574
      30
      N-Terminus to arginine side-chain cyclization of linear peptidic neuropeptide Y Y4 receptor ligands results in picomolar binding constants
      Konieczny, Adam; Conrad, Marcus; Ertl, Fabian J.; Gleixner, Jakob; Gattor, Albert O.; Graetz, Lukas; Schmidt, Maximilian F.; Neu, Eduard; Horn, Anselm H. C.; Wifling, David; Gmeiner, Peter; Clark, Timothy; Sticht, Heinrich; Keller, Max
      Journal of Medicinal Chemistry (2021), 64 (22), 16746-16769CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      The family of neuropeptide Y (NPY) receptors comprises four subtypes (Y1R, Y2R, Y4R, Y5R), which are addressed by at least three endogenous peptides, i.e., NPY, peptide YY, and pancreatic polypeptide (PP), the latter showing a preference for Y4R. A series of cyclic oligopeptidic Y4R ligands were prepd. by applying a novel approach, i.e., N-terminus to arginine side-chain cyclization. Most peptides acted as Y4R partial agonists, showing up to 60-fold higher Y4R affinity compared to the linear precursor peptides. Two cyclic hexapeptides (I) [cyclo[succinyl-Arg-Tyr-Arg(CO-NH-(CH2)4-NH)]-Leu-Arg-Tyr-NH2] and (II) [cyclo[succinyl-Arg-Trp-Arg(CO-NH-(CH2)4-NH)]-Leu-Arg-Tyr-NH2] showed higher Y4R potency (Ca2+ aequorin assay) and, with pKi values >10, also higher Y4R affinity compared to human pancreatic polypeptide (hPP). Compds. such as I and II exhibiting considerably lower mol. wt. and considerably more pronounced Y4R selectivity than PP and previously described dimeric peptidic ligands with high Y4R affinity, represent promising leads for the prepn. of labeled tool compds. and might support the development of drug-like Y4R ligands.
    31. 31
      Gleixner, J.; Gattor, A. O.; Humphrys, L. J.; Brunner, T.; Keller, M. 3H]UR-JG102 - a radiolabeled cyclic peptide with high affinity and excellent selectivity for the neuropeptide Y Y4 receptor. J. Med. Chem. 2023, 66, 13788– 13808,  DOI: 10.1021/acs.jmedchem.3c01224
      There is no corresponding record for this reference.
    32. 32
      Keller, M.; Kuhn, K. K.; Einsiedel, J.; Hübner, H.; Biselli, S.; Mollereau, C.; Wifling, D.; Svobodová, J.; Bernhardt, G.; Cabrele, C.; Vanderheyden, P. M. L.; Gmeiner, P.; Buschauer, A. Mimicking of arginine by functionalized Nω-carbamoylated arginine as a new broadly applicable approach to labeled bioactive peptides: high affinity angiotensin, neuropeptide Y, neuropeptide FF, and neurotensin receptor ligands as examples. J. Med. Chem. 2016, 59, 1925– 1945,  DOI: 10.1021/acs.jmedchem.5b01495
      32
      Mimicking of Arginine by Functionalized Nω-Carbamoylated Arginine As a New Broadly Applicable Approach to Labeled Bioactive Peptides: High Affinity Angiotensin, Neuropeptide Y, Neuropeptide FF, and Neurotensin Receptor Ligands As Examples
      Keller, Max; Kuhn, Kilian K.; Einsiedel, Juergen; Huebner, Harald; Biselli, Sabrina; Mollereau, Catherine; Wifling, David; Svobodova, Jaroslava; Bernhardt, Guenther; Cabrele, Chiara; Vanderheyden, Patrick M. L.; Gmeiner, Peter; Buschauer, Armin
      Journal of Medicinal Chemistry (2016), 59 (5), 1925-1945CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Derivatization of biol. active peptides by conjugation with fluorophores or radionuclide-bearing moieties is an effective and commonly used approach to prep. mol. tools and diagnostic agents. Whereas lysine, cysteine, and N-terminal amino acids have been mostly used for peptide conjugation, we describe a new, widely applicable approach to peptide conjugation based on the nonclassical bioisosteric replacement of the guanidine group in arginine by a functionalized carbamoylguanidine moiety. Four arginine-contg. peptide receptor ligands (angiotensin II, neurotensin(8-13), an analog of the C-terminal pentapeptide of neuropeptide Y, and a neuropeptide FF analog) were subject of this proof-of-concept study. The Nω-carbamoylated arginines, bearing spacers with a terminal amino group, were incorporated into the peptides by std. Fmoc solid phase peptide synthesis. The synthesized chem. stable peptide derivs. showed high receptor affinities with Ki values in the low nanomolar range, even when bulky fluorophores had been attached. Two new tritiated tracers for angiotensin and neurotensin receptors are described.
    33. 33
      Keller, M.; Weiss, S.; Hutzler, C.; Kuhn, K. K.; M?llereau, C.; Dukorn, S.; Schindler, L.; Bernhardt, G.; König, B.; Buschauer, A. Nω-carbamoylation of the argininamide moiety: An avenue to insurmountable NPY Y1 receptor antagonists and a radiolabeled selective high-affinity molecular tool ([3H]UR-MK299) with extended residence time. J. Med. Chem. 2015, 58, 8834– 8849,  DOI: 10.1021/acs.jmedchem.5b00925
      33
      Nω-Carbamoylation of the Argininamide Moiety: An Avenue to Insurmountable NPY Y1 Receptor Antagonists and a Radiolabeled Selective High-Affinity Molecular Tool ([3H]UR-MK299) with Extended Residence Time
      Keller, Max; Weiss, Stefan; Hutzler, Christoph; Kuhn, Kilian K.; Mollereau, Catherine; Dukorn, Stefanie; Schindler, Lisa; Bernhardt, Guenther; Koenig, Burkhard; Buschauer, Armin
      Journal of Medicinal Chemistry (2015), 58 (22), 8834-8849CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Analogs of the argininamide-type NPY Y1 receptor (Y1R) antagonist BIBP3226, bearing carbamoyl moieties at the guanidine group, revealed subnanomolar Ki values and caused depression of the maximal response to NPY (calcium assay) by up to 90% in a concn.- and time-dependent manner, suggesting insurmountable antagonism. To gain insight into the mechanism of binding of the synthesized compds., a tritiated antagonist, (R)-Nα-diphenylacetyl-Nω-[2-([2,3-3H]propionylamino)ethyl]aminocarbonyl-(4-hydroxybenzyl)arginin-amide ([3H]UR-MK299, [3H]38), was prepd. [3H]38 revealed a dissocn. const. in the picomolar range (Kd 0.044 nM, SK-N-MC cells) and very high Y1R selectivity. Apart from superior affinity, a considerably lower target off-rate (t1/2 95 min) was characteristic of [3H]38 compared to that of the higher homolog contg. a tetramethylene instead of an ethylene spacer (t1/2 3 min, Kd 2.0 nM). Y1R binding of [3H]38 was fully reversible and fully displaceable by nonpeptide antagonists and the agonist pNPY. Therefore, the insurmountable antagonism obsd. in the functional assay has to be attributed to the extended target-residence time, a phenomenon of relevance in drug research beyond the NPY receptor field.
    34. 34
      Konieczny, A.; Braun, D.; Wifling, D.; Bernhardt, G.; Keller, M. Oligopeptides as neuropeptide Y Y4 receptor ligands: identification of a high-affinity tetrapeptide agonist and a hexapeptide antagonist. J. Med. Chem. 2020, 63, 8198– 8215,  DOI: 10.1021/acs.jmedchem.0c00426
      34
      Oligopeptides as Neuropeptide Y Y4 Receptor Ligands: Identification of a High-Affinity Tetrapeptide Agonist and a Hexapeptide Antagonist
      Konieczny, Adam; Braun, Diana; Wifling, David; Bernhardt, Guenther; Keller, Max
      Journal of Medicinal Chemistry (2020), 63 (15), 8198-8215CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Within the family of neuropeptide Y (NPY) receptors, the Y4 receptor (Y4R) is unique as it prefers pancreatic polypeptide (PP) over NPY and peptide YY (PYY). Today, low mol. wt. Y4R ligands are lacking, in particular antagonists. We synthesized a series of peptidic NPY Y4R ligands, derived from the hexapeptide acetyl-Arg-Tyr-Arg-Leu-Arg-Tyr-NH2 (1), reported to be a Y4R partial agonist with high affinity (pKi Y4R: 8.43). Peptide 1 was N-terminally extended as well as truncated, subjected to a D-amino acid scan, and Leu was replaced by different amino acids. Compds. were characterized by radioligand competition binding and functional studies (Cai2+ mobilization and β-arrestin 1/2 recruitment). N-terminal truncation of 1 resulted in a tetrapeptide (Arg-Leu-Arg-Tyr-NH2) being a Y4R partial agonist with retained Y4R affinity (pKi: 8.47). Remarkably, replacement of Leu in 1 and in derivs. of 1 by Trp turned Y4R agonism to antagonism, giving Y4R antagonists with pKi values ≤ 7.57.
    35. 35
      Kuhn, K. K.; Ertl, T.; Dukorn, S.; Keller, M.; Bernhardt, G.; Reiser, O.; Buschauer, A. High affinity agonists of the neuropeptide Y (NPY) Y4 receptor derived from the C-terminal pentapeptide of human pancreatic polypeptide (hPP): Synthesis, stereochemical discrimination, and radiolabeling. J. Med. Chem. 2016, 59, 6045– 6058,  DOI: 10.1021/acs.jmedchem.6b00309
      35
      High Affinity Agonists of the Neuropeptide Y (NPY) Y4 Receptor Derived from the C-Terminal Pentapeptide of Human Pancreatic Polypeptide (hPP): Synthesis, Stereochemical Discrimination, and Radiolabeling
      Kuhn, Kilian K.; Ertl, Thomas; Dukorn, Stefanie; Keller, Max; Bernhardt, Guenther; Reiser, Oliver; Buschauer, Armin
      Journal of Medicinal Chemistry (2016), 59 (13), 6045-6058CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      The diastereomeric mixt. of D/L-2,7-diaminooctanedioyl-bis(YRLRY-NH2) (BVD-74D, 2) was described in the literature as a high affinity Y4 receptor agonist. Here we report on the synthesis and pharmacol. characterization of the pure diastereomers (2R,7R)- and (2S,7S)-2 and a series of homo- and heterodimeric analogs in which octanedioic acid was used as an achiral linker. To investigate the role of the Arg residues, one or two arginines were replaced by Ala. Moreover, Nω-(6-aminohexylaminocarbonyl)Arg was introduced as an arginine replacement (17). (2R,7R)-2 was superior to (2S,7S)-2 in binding and functional cellular assays and equipotent with 17. [3H]Propionylation of one amino group in the linker of (2R,7R)-2 or at the primary amino group in 17 resulted in high affinity Y4R radioligands ([3H]-(2R,7R)-10, [3H]18) with subnanomolar Kd values.
    36. 36
      Berlicki, Ł.; Kaske, M.; Gutiérrez-Abad, R.; Bernhardt, G.; Illa, O.; Ortuño, R. M.; Cabrele, C.; Buschauer, A.; Reiser, O. Replacement of Thr32 and Gln34 in the C-terminal neuropeptide Y fragment 25–36 by cis-cyclobutane and cis-cyclopentane β-amino acids shifts selectivity toward the Y4 receptor. J. Med. Chem. 2013, 56, 8422– 8431,  DOI: 10.1021/jm4008505
      36
      Replacement of Thr32 and Gln34 in the C-Terminal Neuropeptide Y Fragment 25-36 by cis-Cyclobutane and cis-Cyclopentane β Amino Acids Shifts Selectivity toward the Y4 Receptor
      Berlicki, Lukasz; Kaske, Melanie; Gutierrez-Abad, Raquel; Bernhardt, Guenther; Illa, Ona; Ortuno, Rosa M.; Cabrele, Chiara; Buschauer, Armin; Reiser, Oliver
      Journal of Medicinal Chemistry (2013), 56 (21), 8422-8431CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Neuropeptide Y (NPY) and pancreatic polypeptide (PUP) control central and peripheral processes by activating the G protein coupled receptors YxR (x = 1, 2, 4, 5). We present analogs of the C-terminal fragments 25-36 and 32-36 of NPY and PP contg. (1R,2S)-cyclobutane (βCbu) or (1R,2S)-cyclopentane (βCpe) β-amino acids, which display exclusively Y4R affinity. In particular, [βCpe34]-NPY-(25-36) is a Y4R selective partial agonist (EC50 41 nM, Emax 71%) that binds Y4R with a Ki of 10 nM and a selectivity >100-fold relative to Y1R and Y2R and >50-fold relative to Y5R. Comparably, [Y32, βCpe34]-NPY-(PP)-(32-36) selectively binds and activates Y4R (EC50 94 nM, Emax 73%). The NMR structure of [βCpe34]-NPY-(25-36) in dodecylphosphatidylcholine micelles shows a short helix at residues 27-32, while the C-terminal segment R33βCpe34R35Y36 is extended. The biol. properties of the βCbu- or βCpe-contg. NPY and PP C-terminal fragments encourage the future application of these β-amino acids in the synthesis of selective Y4R ligands.
    37. 37
      Wirth, U.; Erl, J.; Azzam, S.; Höring, C.; Skiba, M.; Singh, R.; Hochmuth, K.; Keller, M.; Wegener, J.; König, B. Monitoring the reversibility of GPCR signaling by combining photochromic ligands with label-free impedance analysis. Angew. Chem., Int. Ed. 2023, 62, e202215547  DOI: 10.1002/anie.202215547
      37
      Monitoring the Reversibility of GPCR Signaling by Combining Photochromic Ligands with Label-free Impedance Analysis
      Wirth, Ulrike; Erl, Julia; Azzam, Saphia; Horing, Carina; Skiba, Michael; Singh, Ritu; Hochmuth, Kathrin; Keller, Max; Wegener, Joachim; Konig, Burkhard
      Angewandte Chemie, International Edition (2023), 62 (21), e202215547CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)
      G protein-coupled cell surface receptors (GPCR) trigger complex intracellular signaling cascades upon agonist binding. Classic pharmacol. assays provide information about binding affinities, activation or blockade at different stages of the signaling cascade, but real time dynamics and reversibility of these processes remain often disguised. We show that combining photochromic NPY receptor ligands, which can be toggled in their receptor activation ability by irradn. with light of different wavelengths, with whole cell label-free impedance assays allows observing the cell response to receptor activation and its reversibility over time. The concept demonstrated on NPY receptors may be well applicable to many other GPCRs providing a deeper insight into the time course of intracellular signaling processes.
    38. 38
      Archipowa, N.; Wittmann, L.; Köckenberger, J.; Ertl, F. J.; Gleixner, J.; Keller, M.; Heinrich, M. R.; Kutta, R. J. Characterization of fluorescent dyes frequently used for bioimaging: Photophysics and photocatalytical reactions with proteins. J. Phys. Chem. B 2023, 127, 9532– 9542,  DOI: 10.1021/acs.jpcb.3c04484
      There is no corresponding record for this reference.
    39. 39
      Keller, M.; Mahuroof, S. A.; Yee, V. H.; Carpenter, J.; Schindler, L.; Littmann, T.; Pegoli, A.; Hübner, H.; Bernhardt, G.; Gmeiner, P.; Holliday, N. D. Fluorescence labeling of neurotensin(8–13) via arginine residues gives molecular tools with high receptor affinity. ACS Med. Chem. Lett. 2020, 11, 16– 22,  DOI: 10.1021/acsmedchemlett.9b00462
      39
      Fluorescence labeling of neurotensin(8-13) via arginine residues gives molecular tools with high receptor affinity
      Keller, Max; Mahuroof, Shahani A.; Hong Yee, Vivyanne; Carpenter, Jessica; Schindler, Lisa; Littmann, Timo; Pegoli, Andrea; Huebner, Harald; Bernhardt, Guenther; Gmeiner, Peter; Holliday, Nicholas D.
      ACS Medicinal Chemistry Letters (2020), 11 (1), 16-22CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)
      Fluorescence-labeled receptor ligands have emerged as valuable mol. tools, being indispensable for studying receptor-ligand interactions by fluorescence-based techniques such as high-content imaging, fluorescence microscopy, and fluorescence polarization. Through application of a new labeling strategy for peptides, a series of fluorescent neurotensin(8-13) derivs. was synthesized by attaching red-emitting fluorophores (indolinium- and pyridinium-type cyanine dyes) to carbamoylated arginine residues in neurotensin(8-13) analogs, yielding fluorescent probes with high NTS1R affinity (pKi values: 8.15-9.12) and potency (pEC50 values (Ca2+ mobilization): 8.23-9.43). Selected fluorescent ligands were investigated by flow cytometry and high-content imaging (satn. binding, kinetic studies, and competition binding) as well as by confocal microscopy using intact CHO-hNTS1R cells. The study demonstrates the applicability of the fluorescent probes as mol. tools to obtain, for example, information about the localization of receptors in cells and to det. binding affinities of nonlabeled ligands.
    40. 40
      Müller, C.; Gleixner, J.; Tahk, M.-J.; Kopanchuk, S.; Laasfeld, T.; Weinhart, M.; Schollmeyer, D.; Betschart, M. U.; Lüdeke, S.; Koch, P.; Rinken, A.; Keller, M. Structure-based design of high-affinity fluorescent probes for the neuropeptide Y Y1 receptor. J. Med. Chem. 2022, 65, 4832– 4853,  DOI: 10.1021/acs.jmedchem.1c02033
      40
      Structure-based design of high-affinity fluorescent probes for the neuropeptide Y Y1 receptor
      Mueller, Christoph; Gleixner, Jakob; Tahk, Maris-Johanna; Kopanchuk, Sergei; Laasfeld, Tonis; Weinhart, Michael; Schollmeyer, Dieter; Betschart, Martin U.; Luedeke, Steffen; Koch, Pierre; Rinken, Ago; Keller, Max
      Journal of Medicinal Chemistry (2022), 65 (6), 4832-4853CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      The recent crystn. of the neuropeptide Y Y1 receptor (Y1R) in complex with the argininamide-type Y1R selective antagonist UR-MK299 (2) opened up a new approach toward structure-based design of nonpeptidic Y1R ligands. We designed novel fluorescent probes showing excellent Y1R selectivity and, in contrast to previously described fluorescent Y1R ligands, considerably higher (~ 100-fold) binding affinity. This was achieved through the attachment of different fluorescent dyes to the diphenylacetyl moiety in 2 via an amine-functionalized linker. The fluorescent ligands exhibited picomolar Y1R binding affinities (pKi values of 9.36-9.95) and proved to be Y1R antagonists, as validated in a Fura-2 calcium assay. The versatile applicability of the probes as tool compds. was demonstrated by flow cytometry- and fluorescence anisotropy-based Y1R binding studies (satn. and competition binding and assocn. and dissocn. kinetics) as well as by widefield and total internal reflection fluorescence (TIRF) microscopy of live tumor cells, revealing that fluorescence was mainly localized at the plasma membrane.
    41. 41
      Keller, M.; Erdmann, D.; Pop, N.; Pluym, N.; Teng, S.; Bernhardt, G.; Buschauer, A. Red-fluorescent argininamide-type NPY Y1 receptor antagonists as pharmacological tools. Biorg. Med. Chem. 2011, 19, 2859– 2878,  DOI: 10.1016/j.bmc.2011.03.045
      41
      Red-fluorescent argininamide-type NPY Y1 receptor antagonists as pharmacological tools
      Keller, Max; Erdmann, Daniela; Pop, Nathalie; Pluym, Nikola; Teng, Shangjun; Bernhardt, Guenther; Buschauer, Armin
      Bioorganic & Medicinal Chemistry (2011), 19 (9), 2859-2878CODEN: BMECEP; ISSN:0968-0896. (Elsevier B.V.)
      Fluorescently labeled NPY Y1 receptor (Y1R) ligands were synthesized by connecting pyrylium and cyanine dyes with the argininamide-type Y1R antagonist core structure by linkers, covering a wide variety in length and chem. nature, attached to the guanidine group. The most promising fluorescent probes had Y1R affinities (radioligand binding) and antagonistic activities (calcium assay) in the one- to two-digit nanomolar range. These compds. turned out to be stable under assay conditions and to be appropriate for the detection of Y1Rs by confocal microscopy in live cells. To improve the signal-to-noise ratio by shifting the emission into the near IR, a new benzothiazolium-type fluorescent cyanine dye (UR-DE99) was synthesized and attached to the parent antagonist via a carbamoyl linker yielding UR-MK131, a highly potent fluorescent Y1R probe, which was also successfully applied in flow cytometry.
    42. 42
      She, X.; Pegoli, A.; Gruber, C. G.; Wifling, D.; Carpenter, J.; Hübner, H.; Chen, M.; Wan, J.; Bernhardt, G.; Gmeiner, P.; Holliday, N. D.; Keller, M. Red-emitting dibenzodiazepinone derivatives as fluorescent dualsteric probes for the muscarinic acetylcholine M2 receptor. J. Med. Chem. 2020, 63, 4133– 4154,  DOI: 10.1021/acs.jmedchem.9b02172
      42
      Red-Emitting Dibenzodiazepinone Derivatives as Fluorescent Dualsteric Probes for the Muscarinic Acetylcholine M2 Receptor
      She, Xueke; Pegoli, Andrea; Gruber, Corinna G.; Wifling, David; Carpenter, Jessica; Huebner, Harald; Chen, Mengya; Wan, Jianfei; Bernhardt, Guenther; Gmeiner, Peter; Holliday, Nicholas D.; Keller, Max
      Journal of Medicinal Chemistry (2020), 63 (8), 4133-4154CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Fluorescently labeled dibenzodiazepinone-type muscarinic acetylcholine receptor (MR) antagonists, including dimeric ligands, were prepd. using red-emitting cyanine dyes. Probes contg. a fluorophore with neg. charge showed high M2R affinities (pKi (radioligand competition binding): 9.10-9.59). Binding studies at M1 and M3-M5 receptors indicated a M2R preference. Flow cytometric and high-content imaging satn. and competition binding (M1R, M2R, and M4R) confirmed occupation of the orthosteric site. Confocal microscopy revealed that fluorescence was located mainly at the cell membrane (CHO-hM2R cells). Results from dissocn. and satn. binding expts. (M2R) in the presence of allosteric M2R modulators (dissocn.: W84, LY2119620, and alcuronium; satn. binding: W84) were consistent with a competitive mode of action between the fluorescent probes and the allosteric ligands. Taken together, these lines of evidence indicate that these ligands are useful fluorescent mol. tools to label the M2R in imaging and binding studies and suggest that they have a dualsteric mode of action.
    43. 43
      Katritch, V.; Fenalti, G.; Abola, E. E.; Roth, B. L.; Cherezov, V.; Stevens, R. C. Allosteric sodium in class A GPCR signaling. Trends Biochem. Sci. 2014, 39, 233– 244,  DOI: 10.1016/j.tibs.2014.03.002
      43
      Allosteric sodium in class A GPCR signaling
      Katritch, Vsevolod; Fenalti, Gustavo; Abola, Enrique E.; Roth, Bryan L.; Cherezov, Vadim; Stevens, Raymond C.
      Trends in Biochemical Sciences (2014), 39 (5), 233-244CODEN: TBSCDB; ISSN:0968-0004. (Elsevier Ltd.)
      A review. Despite their functional and structural diversity, G-protein-coupled receptors (GPCRs) share a common mechanism of signal transduction via conformational changes in the seven-transmembrane (7TM) helical domain. New major insights into this mechanism come from the recent crystallog. discoveries of a partially hydrated sodium ion that is specifically bound in the middle of the 7TM bundle of multiple class A GPCRs. This review discusses the remarkable structural conservation and distinct features of the Na+ pocket in this most populous GPCR class, as well as the conformational collapse of the pocket upon receptor activation. New insights help to explain allosteric effects of sodium on GPCR agonist binding and activation, and sodium's role as a potential co-factor in class A GPCR function.
    44. 44
      White, K. L.; Eddy, M. T.; Gao, Z. G.; Han, G. W.; Lian, T.; Deary, A.; Patel, N.; Jacobson, K. A.; Katritch, V.; Stevens, R. C. Structural connection between activation microswitch and allosteric sodium site in GPCR Signaling. Structure 2018, 26, 259– 269,  DOI: 10.1016/j.str.2017.12.013
      44
      Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling
      White, Kate L.; Eddy, Matthew T.; Gao, Zhan-Guo; Han, Gye Won; Lian, Tiffany; Deary, Alexander; Patel, Nilkanth; Jacobson, Kenneth A.; Katritch, Vsevolod; Stevens, Raymond C.
      Structure (Oxford, United Kingdom) (2018), 26 (2), 259-269.e5CODEN: STRUE6; ISSN:0969-2126. (Elsevier Ltd.)
      Sodium ions are endogenous allosteric modulators of many G-protein-coupled receptors (GPCRs). Mutation of key residues in the sodium binding motif causes a striking effect on G-protein signaling. We report the crystal structures of agonist complexes for two variants in the first sodium coordination shell of the human A2A adenosine receptor, D522.50N and S913.39A. Both structures present an overall active-like conformation; however, the variants show key changes in the activation motif NPxxY. Changes in the hydrogen bonding network in this microswitch suggest a possible mechanism for modified G-protein signaling and enhanced thermal stability. These structures, signaling data, and thermal stability anal. with a panel of pharmacol. ligands provide a basis for understanding the role of the sodium-coordinating residues on stability and G-protein signaling. Utilizing the D2.50N variant is a promising method for stabilizing class A GPCRs to accelerate structural efforts and drug discovery.
    45. 45
      DeVree, B. T.; Mahoney, J. P.; Velez-Ruiz, G. A.; Rasmussen, S. G.; Kuszak, A. J.; Edwald, E.; Fung, J. J.; Manglik, A.; Masureel, M.; Du, Y.; Matt, R. A.; Pardon, E.; Steyaert, J.; Kobilka, B. K.; Sunahara, R. K. Allosteric coupling from G protein to the agonist-binding pocket in GPCRs. Nature 2016, 535, 182– 186,  DOI: 10.1038/nature18324
      45
      Allosteric coupling from G protein to the agonist-binding pocket in GPCRs
      DeVree, Brian T.; Mahoney, Jacob P.; Velez-Ruiz, Gisselle A.; Rasmussen, Soren G. F.; Kuszak, Adam J.; Edwald, Elin; Fung, Juan-Jose; Manglik, Aashish; Masureel, Matthieu; Du, Yang; Matt, Rachel A.; Pardon, Els; Steyaert, Jan; Kobilka, Brian K.; Sunahara, Roger K.
      Nature (London, United Kingdom) (2016), 535 (7610), 182-186CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)
      G protein-coupled receptors (GPCRs) remain the primary conduit by which cells detect environmental stimuli and communicate with each other. Upon activation by extracellular agonists, these seven-transmembrane-domain-contg. receptors interact with heterotrimeric G proteins to regulate downstream second messenger and/or protein kinase cascades. Crystallog. evidence from a prototypic GPCR, the β2-adrenergic receptor (β2AR), in complex with its cognate G protein, Gs, has provided a model for how agonist binding promotes conformational changes that propagate through the GPCR and into the nucleotide-binding pocket of the G protein α-subunit to catalyze GDP release, the key step required for GTP binding and activation of G proteins. The structure also offers hints about how G protein binding may, in turn, allosterically influence ligand binding. Here we provide functional evidence that G protein coupling to the β2AR stabilizes a 'closed' receptor conformation characterized by restricted access to and egress from the hormone-binding site. Surprisingly, the effects of G protein on the hormone-binding site can be obsd. in the absence of a bound agonist, where G protein coupling driven by basal receptor activity impedes the assocn. of agonists, partial agonists, antagonists and inverse agonists. The ability of bound ligands to dissoc. from the receptor is also hindered, providing a structural explanation for the G protein-mediated enhancement of agonist affinity, which has been obsd. for many GPCR-G protein pairs. Our data also indicate that in contrast to agonist binding alone, coupling of a G protein in the absence of an agonist stabilizes large structural changes in a GPCR. The effects of nucleotide-free G protein on ligand-binding kinetics are shared by other members of the superfamily of GPCRs, suggesting that a common mechanism may underlie G protein-mediated enhancement of agonist affinity.
    46. 46
      Wingler, L. M.; Lefkowitz, R. J. Conformational basis of G protein-coupled receptor signaling versatility. Trends Cell Biol. 2020, 30, 736– 747,  DOI: 10.1016/j.tcb.2020.06.002
      46
      Conformational Basis of G Protein-Coupled Receptor Signaling Versatility
      Wingler, Laura M.; Lefkowitz, Robert J.
      Trends in Cell Biology (2020), 30 (9), 736-747CODEN: TCBIEK; ISSN:0962-8924. (Elsevier Ltd.)
      A review. G protein-coupled receptors (GPCRs) are privileged structural scaffolds in biol. that have the versatility to regulate diverse physiol. processes. Interestingly, many GPCR ligands exhibit significant 'bias' - the ability to preferentially activate subsets of the many cellular pathways downstream of these receptors. Recently, complementary information from structural and spectroscopic approaches has made significant inroads into understanding the mechanisms of these biased ligands. The consistently emerging theme is that GPCRs are highly dynamic proteins, and ligands with varying pharmacol. properties differentially modulate the equil. among multiple conformations. Biased signaling and other recently appreciated complexities of GPCR signaling thus appear to be a natural consequence of the conformational heterogeneity of GPCRs and GPCR-transducer complexes.
    47. 47
      Copeland, R. A. Conformational adaptation in drug–target interactions and residence time. Future Med. Chem. 2011, 3, 1491– 1501,  DOI: 10.4155/fmc.11.112
      47
      Conformational adaptation in drug-target interactions and residence time
      Copeland, Robert A.
      Future Medicinal Chemistry (2011), 3 (12), 1491-1501CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)
      A review. Although drug-target interactions are commonly illustrated in terms of structurally static binding and dissocn. events, such descriptions are inadequate to explain the impact of conformational dynamics on these processes. For high-affinity interactions, both the assocn. and dissocn. of drug mols. to and from their targets are often controlled by conformational changes of the target. Conformational adaptation can greatly influence the residence time of a drug on its target (i.e., the lifetime of the binary drug-target complex); long residence time can lead to sustained pharmacol. and may also mitigate off-target toxicity. In this perspective, the kinetics of drug-target assocn. and dissocn. reactions are explored, with particular emphasis on the impact of conformational adaptation on drug-target residence time.
    48. 48
      Vauquelin, G. Simplified models for heterobivalent ligand binding: when are they applicable and which are the factors that affect their target residence time. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2013, 386, 949– 962,  DOI: 10.1007/s00210-013-0881-0
      48
      Simplified models for heterobivalent ligand binding: when are they applicable and which are the factors that affect their target residence time
      Vauquelin, Georges
      Naunyn-Schmiedeberg's Archives of Pharmacology (2013), 386 (11), 949-962CODEN: NSAPCC; ISSN:0028-1298. (Springer)
      Bivalent ligands often display high affinity/avidity for and long residence time at their target. Thereto responsible is the synergy that emanates from the simultaneous binding of their two pharmacophores to their resp. target sites. Thermodn. cycle models permit the most complete description of the binding process, and thereto, corresponding differential equation-based simulations link the "microscopic" rate consts. that govern the individual binding steps to the "macroscopic" bivalent ligand's binding properties. Present simulations of heterobivalent ligand binding led to an appreciably simpler description thereof. The thermodn. cycle model can be split into two pathways/lanes that the bivalent ligand can solicit to reach fully bound state. Since the first binding event prompts the still free pharmacophore to stay into "forced proximity" of its target site, such lanes can be looked into by the equations that also apply to induced fit binding mechanisms. Interestingly, the simplest equations apply when bivalency goes along with a large gain in avidity. The overall bivalent ligand assocn. and dissocn. will be swifter than via each lane apart, but it is the lane that allows the fastest bidirectional "transit" between the free and the fully bound target that is chiefly solicited. The bivalent ligand's residence time is governed not only by the stability of the fully bound complex but also by the ability of freshly dissocd. pharmacophores to successfully rebind. Hence, the presence of a slow-assocg. pharmacophore could be counterproductive. Yet, a long residence time is unfortunately also responsible for the slow attainment of binding equil.
    49. 49
      Palmberger, D.; Wilson, I. B.; Berger, I.; Grabherr, R.; Rendic, D. SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells. PLoS One 2012, 7, e34226  DOI: 10.1371/journal.pone.0034226
      49
      SweetBac: a new approach for the production of mammalianised glycoproteins in insect cells
      Palmberger, Dieter; Wilson, Iain B. H.; Berger, Imre; Grabherr, Reingard; Rendic, Dubravko
      PLoS One (2012), 7 (4), e34226CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)
      Recombinant prodn. of therapeutically active proteins has become a central focus of contemporary life science research. These proteins are often produced in mammalian cells, in order to obtain products with post-translational modifications similar to their natural counterparts. However, in cases where a fast and flexible system for recombinant prodn. of proteins is needed, the use of mammalian cells is limited. The baculoviral insect cell system has proven to be a powerful alternative for the expression of a wide range of recombinant proteins in short time frames. The major drawback of baculoviral systems lies in the inability to perform mammalian-like glycosylation required for the prodn. of therapeutic glycoproteins. In this study we integrated sequences encoding Caenorhabditis elegans N-acetylglucosaminyl-transferase II and bovine β1,4-galactosyltransferase I into the backbone of a baculovirus genome. The thereby generated SweetBac virus was subsequently used for the prodn. of the human HIV anti-gp41 antibody 3D6 by integrating heavy and light chain open reading frames into the SweetBac genome. The parallel expression of target genes and glycosyltransferases reduced the yield of secreted antibody. However, the overall expression rate, esp. in the recently established Tnao38 cell line, was comparable to that of transient expression in mammalian cells. In order to evaluate the ability of SweetBac to generate mammalian-like N-glycan structures on 3D6 antibody, we performed SDS-PAGE and tested for the presence of terminal galactose using Riccinus communis agglutinin I. The mammalianized variants of 3D6 showed highly specific binding to the lectin, indicating proper functionality. To confirm these results, PNGase A released N-glycans were analyzed by MALDI-TOF-MS and shown to contain structures with mainly one or two terminal galactose residues. Since the presence of specific N-glycans has an impact on antibodies' ability to exert different effector functions, we tested the binding to human Fc gamma receptor I present on U937 cells.
    50. 50
      Schneider, E. H.; Seifert, R. Sf9 cells: A versatile model system to investigate the pharmacological properties of G protein-coupled receptors. Pharmacol. Ther. 2010, 128, 387– 418,  DOI: 10.1016/j.pharmthera.2010.07.005
      50
      Sf9 cells: A versatile model system to investigate the pharmacological properties of G protein-coupled receptors
      Schneider, Erich H.; Seifert, Roland
      Pharmacology & Therapeutics (2010), 128 (3), 387-418CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)
      A review. The Sf9 cell/baculovirus expression system is widely used for high-level protein expression, often with the purpose of purifn. However, proteins may also be functionally expressed in the defined Sf9 cell environment. According to the literature, the pharmacol. of G-protein-coupled receptors (GPCRs) functionally reconstituted in Sf9 cells is similar to the receptor properties in mammalian cells. Sf9 cells express both recombinant GPCRs and G-proteins at much higher levels than mammalian cells. Sf9 cells can be grown in suspension culture, providing an inexpensive way of obtaining large protein amts. Co-infection with various baculoviruses allows free combination of GPCRs with different G-proteins. The absence of constitutively active receptors in Sf9 cells provides an excellent signal-to background ratio in functional assays, allowing the detection of agonist-independent receptor activity and of small ligand-induced signals including partial agonistic and inverse agonistic effects. Insect cell Gαi-like proteins mostly do not couple productively to mammalian GPCRs. Thus, unlike in mammalian cells, Sf9 cells do not require pertussis toxin treatment to obtain a Gαi-free environment. Co-expression of GPCRs with Gαi1, Gαi2, Gαi3 or Gαo in Sf9 cells allows the generation of a selectivity profile for these Gαi/o-isoforms. Addnl., GPCR-G-protein combinations can be compared with defined 1:1 stoichiometry by expressing GPCR-Gα fusion proteins. Sf9 cells can also be employed for ligand screening in medicinal chem. programs, using radioligand binding assays or functional assays, like the steady-state GTPase- or [35S]GTPγS binding assay. This review shows that Sf9 cells are a versatile model system to investigate the pharmacol. properties of GPCRs.
    51. 51
      Grätz, L.; Müller, C.; Pegoli, A.; Schindler, L.; Bernhardt, G.; Littmann, T. Insertion of Nanoluc into the extracellular loops as a complementary method to establish BRET-based binding assays for GPCRs. ACS Pharmacol. Transl. Sci. 2022, 5, 1142– 1155,  DOI: 10.1021/acsptsci.2c00162
      There is no corresponding record for this reference.
    52. 52
      Calderón, J. C.; Plut, E.; Keller, M.; Cabrele, C.; Reiser, O.; Gervasio, F. L.; Clark, T. Extended metadynamics protocol for binding/unbinding free energies of peptide ligands to class A G-protein-coupled receptors. J. Chem. Inf. Model. 2024, 64, 205– 218,  DOI: 10.1021/acs.jcim.3c01574
      There is no corresponding record for this reference.
    53. 53
      Hall, M. P.; Unch, J.; Binkowski, B. F.; Valley, M. P.; Butler, B. L.; Wood, M. G.; Otto, P.; Zimmerman, K.; Vidugiris, G.; Machleidt, T.; Robers, M. B.; Benink, H. A.; Eggers, C. T.; Slater, M. R.; Meisenheimer, P. L.; Klaubert, D. H.; Fan, F.; Encell, L. P.; Wood, K. V. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 2012, 7, 1848– 1857,  DOI: 10.1021/cb3002478
      53
      Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate
      Hall, Mary P.; Unch, James; Binkowski, Brock F.; Valley, Michael P.; Butler, Braeden L.; Wood, Monika G.; Otto, Paul; Zimmerman, Kristopher; Vidugiris, Gediminas; Machleidt, Thomas; Robers, Matthew B.; Benink, Helene A.; Eggers, Christopher T.; Slater, Michael R.; Meisenheimer, Poncho L.; Klaubert, Dieter H.; Fan, Frank; Encell, Lance P.; Wood, Keith V.
      ACS Chemical Biology (2012), 7 (11), 1848-1857CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)
      Bioluminescence methodologies have been extraordinarily useful due to their high sensitivity, broad dynamic range, and operational simplicity. These capabilities have been realized largely through incremental adaptations of native enzymes and substrates, originating from luminous organisms of diverse evolutionary lineages. We engineered both an enzyme and substrate in combination to create a novel bioluminescence system capable of more efficient light emission with superior biochem. and phys. characteristics. Using a small luciferase subunit (19 kDa) from the deep sea shrimp Oplophorus gracilirostris, we have improved luminescence expression in mammalian cells ∼2.5 million-fold by merging optimization of protein structure with development of a novel imidazopyrazinone substrate (furimazine). The new luciferase, NanoLuc, produces glow-type luminescence (signal half-life >2 h) with a specific activity ∼150-fold greater than that of either firefly (Photinus pyralis) or Renilla luciferases similarly configured for glow-type assays. In mammalian cells, NanoLuc shows no evidence of post-translational modifications or subcellular partitioning. The enzyme exhibits high phys. stability, retaining activity with incubation up to 55 °C or in culture medium for >15 h at 37 °C. As a genetic reporter, NanoLuc may be configured for high sensitivity or for response dynamics by appending a degrdn. sequence to reduce intracellular accumulation. Appending a signal sequence allows NanoLuc to be exported to the culture medium, where reporter expression can be measured without cell lysis. Fusion onto other proteins allows luminescent assays of their metab. or localization within cells. Reporter quantitation is achievable even at very low expression levels to facilitate more reliable coupling with endogenous cellular processes.
    54. 54
      Keller, M.; Kaske, M.; Holzammer, T.; Bernhardt, G.; Buschauer, A. Dimeric argininamide-type neuropeptide Y receptor antagonists: Chiral discrimination between Y1 and Y4 receptors. Biorg. Med. Chem. 2013, 21, 6303– 6322,  DOI: 10.1016/j.bmc.2013.08.065
      There is no corresponding record for this reference.
    55. 55
      Pegoli, A.; She, X.; Wifling, D.; Hubner, H.; Bernhardt, G.; Gmeiner, P.; Keller, M. Radiolabeled dibenzodiazepinone-type antagonists give evidence of dualsteric binding at the M(2) muscarinic acetylcholine receptor. J. Med. Chem. 2017, 60, 3314– 3334,  DOI: 10.1021/acs.jmedchem.6b01892
      55
      Radiolabeled Dibenzodiazepinone-Type Antagonists Give Evidence of Dualsteric Binding at the M2 Muscarinic Acetylcholine Receptor
      Pegoli Andrea; She Xueke; Wifling David; Bernhardt Gunther; Keller Max; Hubner Harald; Gmeiner Peter
      Journal of medicinal chemistry (2017), 60 (8), 3314-3334 ISSN:.
      The dualsteric ligand approach, aiming at ligands with improved subtype selectivity, has been increasingly applied to muscarinic receptors (MRs). In this article, we present the synthesis and characterization of a M2R subtype-preferring radiolabeled dibenzodiazepinone-type antagonist ([(3)H]UNSW-MK259, [(3)H]19) and its homodimeric analogue [(3)H]UR-AP060 ([(3)H]33). Saturation binding studies at the M2R, using the orthosteric antagonist atropine to determine unspecific binding, proved that the monomeric and the dimeric compound bind to the orthosteric binding site (apparent Kd: 0.87 and 0.31 nM, respectively). Various binding studies with [(3)H]19 and [(3)H]33 at the M2R, for instance, saturation binding experiments in the presence of the allosteric MR modulators W84 (8) or LY2119620 (9) (Schild-like analysis) suggested a competitive mechanism between the allosteric modulator and the dibenzodiazepinone derivatives, and thus a dualsteric binding mode of both 19 and 33. This was consistent with the results of M2R MD simulations (≥2 μs) performed with 19 and 33.
    56. 56
      Schindler, L.; Moosbauer, J.; Schmidt, D.; Spruss, T.; Grätz, L.; Lüdeke, S.; Hofheinz, F.; Meister, S.; Echtenacher, B.; Bernhardt, G.; Pietzsch, J.; Hellwig, D.; Keller, M. Development of a neurotensin-derived 68Ga-labeled PET ligand with high in vivo stability for imaging of NTS1 receptor-expressing tumors. Cancers 2022, 14, 4922  DOI: 10.3390/cancers14194922
      There is no corresponding record for this reference.
    57. 57
      Schindler, L.; Wohlfahrt, K.; von Krüchten, L. G.; Prante, O.; Keller, M.; Maschauer, S. Neurotensin analogs by fluoroglycosylation at Nω-carbamoylated arginines for PET imaging of NTS1-positive tumors. Sci. Rep. 2022, 12, 15028  DOI: 10.1038/s41598-022-19296-0
      There is no corresponding record for this reference.
    58. 58
      Höfelschweiger, B. K. The pyrylium dyes: A new class of biolabels. Synthesis, spectroscopy, and application as labels and in general protein assay. Doctoral thesis, University of Regensburg, Regensburg, 2005.
      There is no corresponding record for this reference.
    59. 59
      Moser, C.; Bernhardt, G.; Michel, J.; Schwarz, H.; Buschauer, A. Cloning and functional expression of the hNPY Y5 receptor in human endometrial cancer (HEC-1B) cells. Can. J. Physiol. Pharmacol. 2000, 78, 134– 142,  DOI: 10.1139/y99-125
      59
      Cloning and functional expression of the hNPY Y5 receptor in human endometrial cancer (HEC-1B) cells
      Moser, C.; Bernhardt, G.; Michel, J.; Schwarz, H.; Buschauer, A.
      Canadian Journal of Physiology and Pharmacology (2000), 78 (2), 134-142CODEN: CJPPA3; ISSN:0008-4212. (National Research Council of Canada)
      Aiming to develop a functional assay for the human NPY Y5 receptor based on adenylyl cyclase activity, HEC-1B cells, in which cAMP synthesis can be efficiently stimulated with forskolin, were selected for the transfection with the pcDNA3-Y5-FLAG and the pcDEF3-Y5 vectors. After optimization of the transfection procedure, the binding of [3H]propionyl-NPY to transiently and stably expressed Y5 receptors was detd. The affinities of NPY, NPY derivs., and rPP (pNPY ≥ p(Leu31Pro34)NPY = p(2-36)NPY ≥ p(D-Trp32)NPY > p(13-36)NPY > rPP) were in accordance with the NPY Y5 receptor subtype. For [3H]propionyl-pNPY approx. 1.7×105 and 1×106 binding sites per transiently and stably transfected cell, resp., were detd. The KD values were 2.4±0.4 and 1.7±0.2 nM, resp. Due to the high expression of the receptor protein, both stably and transiently transfected cells can be conveniently used in routine radioligand binding studies. By contrast, functional assays were only feasible with HEC-1B cells stably expressing the Y5 receptor. In these cells, 10 nM pNPY inhibited the forskolin-stimulated cAMP synthesis by 75%. This effect was partially antagonized by the Y5 antagonist N-{trans-[4-(2-naphthylmethylamino)-methyl]cyclohexylmethyl}naphthalene-2-sulfonamide. Although the genetic variability of cancer cells is in principle incompatible with a stable phenotype, both ligand binding characteristics and functionality of the Y5 receptor remained unchanged for more than 30 passages.
    60. 60
      Bartole, E.; Grätz, L.; Littmann, T.; Wifling, D.; Seibel, U.; Buschauer, A.; Bernhardt, G. UR-DEBa242: A Py-5-labeled fluorescent multipurpose probe for investigations on the histamine H3 and H4 receptors. J. Med. Chem. 2020, 63, 5297– 5311,  DOI: 10.1021/acs.jmedchem.0c00160
      60
      UR-DEBa242: A Py-5-Labeled Fluorescent Multipurpose Probe for Investigations on the Histamine H3 and H4 Receptors
      Bartole, Edith; Graetz, Lukas; Littmann, Timo; Wifling, David; Seibel, Ulla; Buschauer, Armin; Bernhardt, Guenther
      Journal of Medicinal Chemistry (2020), 63 (10), 5297-5311CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
      Comprehensively characterized fluorescent probes for the histamine H3 receptor (H3R) and esp. for the H4R orthologs [e.g., human (h) and mouse (m)] are highly needed as versatile complementary tools to radioligands. In view of fluorescent probes for BRET-based binding studies and for localizing the H4R in live cells, we synthesized and biol. characterized Py-5-labeled histamine derivs. The most notable compd. was UR-DEBa242 (26, 1-[4-(1H-Imidazol-4-yl)butyl]-4-{(1E,3E)-4-[4-(dimethylamino)phenyl]buta-1,3-dienyl}-2, 6-dimethylpyridinium hydrotrifluoroacetate trifluoroacetate), acting as a partial agonist at the hH3R [pEC50 (reporter gene) 8.77] and as an inverse agonist/antagonist at the h/mH4Rs [pIC50(reporter gene) 8.76/7.08; pIC50/pKb (β-arrestin2) 7.81/7.30]. In confocal microscopy, 26 proved suitable for hH4R localization and trafficking studies in live cells. BRET-based binding at the NLuc-hH3,4Rs/mH4R [pKd 8.78/7.75/7.18, comparable to binding consts. from radioligand binding/flow cytometry; fast assocn./dissocn. (~ 2 min)] revealed 26 as a useful mol. tool to det. hH3,4Rs/mH4R binding affinities of ligands binding to these receptors.
    61. 61
      Mansouri, M.; Bellon-Echeverria, I.; Rizk, A.; Ehsaei, Z.; Cosentino, C. C.; Silva, C. S.; Xie, Y.; Boyce, F. M.; Davis, M. W.; Neuhauss, S. C. F.; Taylor, V.; Ballmer-Hofer, K.; Berger, I.; Berger, P. Highly efficient baculovirus-mediated multigene delivery in primary cells. Nat. Commun. 2016, 7, 11529  DOI: 10.1038/ncomms11529
      61
      Highly efficient baculovirus-mediated multigene delivery in primary cells
      Mansouri, Maysam; Bellon-Echeverria, Itxaso; Rizk, Aurelien; Ehsaei, Zahra; Cianciolo Cosentino, Chiara; Silva, Catarina S.; Xie, Ye; Boyce, Frederick M.; Davis, M. Wayne; Neuhauss, Stephan C. F.; Taylor, Verdon; Ballmer-Hofer, Kurt; Berger, Imre; Berger, Philipp
      Nature Communications (2016), 7 (), 11529CODEN: NCAOBW; ISSN:2041-1723. (Nature Publishing Group)
      Multigene delivery and subsequent cellular expression is emerging as a key technol. required in diverse research fields including, synthetic and structural biol., cellular reprogramming and functional pharmaceutical screening. Current viral delivery systems such as retro- and adenoviruses suffer from limited DNA cargo capacity, thus impeding unrestricted multigene expression. We developed MultiPrime, a modular, non-cytotoxic, non-integrating, baculovirus-based vector system expediting highly efficient transient multigene expression from a variety of promoters. MultiPrime viruses efficiently transduce a wide range of cell types, including non-dividing primary neurons and induced-pluripotent stem cells (iPS). We show that MultiPrime can be used for reprogramming, and for genome editing and engineering by CRISPR/Cas9. Moreover, we implemented dual-host-specific cassettes enabling multiprotein expression in insect and mammalian cells using a single reagent. Our expts. establish MultiPrime as a powerful and highly efficient tool, to deliver multiple genes for a wide range of applications in primary and established mammalian cells.
    62. 62
      Nie, Y.; Chaillet, M.; Becke, C.; Haffke, M.; Pelosse, M.; Fitzgerald, D.; Collinson, I.; Schaffitzel, C.; Berger, I. ACEMBL tool-kits for high-throughput multigene delivery and expression in prokaryotic and eukaryotic hosts. Adv. Exp. Med. Biol. 2016, 896, 27– 42,  DOI: 10.1007/978-3-319-27216-0_3
      There is no corresponding record for this reference.
    63. 63
      Cheng, Y.-C.; Prusoff, W. H. Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50% inhibition (IC50) of an enzymatic reaction. Biochem. Pharmacol. 1973, 22, 3099– 3108,  DOI: 10.1016/0006-2952(73)90196-2
      63
      Relation between the inhibition constant K1) and the concentration of inhibitor which causes fifty per cent inhibition (I50) of an enzymic reaction
      Cheng, Yung-Chi; Prusoff, William H.
      Biochemical Pharmacology (1973), 22 (23), 3099-108CODEN: BCPCA6; ISSN:0006-2952.
      The Ki and I50 values are equal where the kinetics are non- or uncompetitive, but not where they are competitive. The relation between the 2 values was analyzed for non- and uncompetitive bi- and monosubstrate reactions and for competitive bisubstrate reactions.
    64. 64
      Laasfeld, T.; Kopanchuk, S.; Rinken, A. Image-based cell-size estimation for baculovirus quantification. BioTechniques 2017, 63, 161– 168,  DOI: 10.2144/000114595
      64
      Image-based cell-size estimation for baculovirus quantification
      Laasfeld, Tanis; Kopanchuk, Sergei; Rinken, Ago
      BioTechniques (2017), 63 (4), 161-168CODEN: BTNQDO; ISSN:0736-6205. (Informa Healthcare)
      Measurement of virus concn. is essential for effective virus-based transfection technologies. Here, we describe a user-friendly, image-based cell-size estn. (ICSE) assay for bacufovirus quantification that relies on automated detn. of celf diams. from bright-field microscopy images. In the !CSC assay, microplate-based imaging systems and our custom ICSE-Tools software enable measurement of cell morphol. parameters over time. Results from the ICSE assay were in agreement with virus concn. measurements obtained using the traditional plaque assay as well as the Coulter principle- based cell-size measurement assay. ICSE-Tools is designed for data organization and image anal. from microplate-based imaging systems, and is freely available at www.gper.ut.eelsoftware.html.
    65. 65
      Veiksina, S.; Tahk, M.-J.; Laasfeld, T.; Link, R.; Kopanchuk, S.; Rinken, A. Fluorescence Anisotropy-Based Assay for Characterization of Ligand Binding Dynamics to GPCRs: The Case of Cy3B-Labeled Ligands Binding to MC4 Receptors in Budded Baculoviruses. In G Protein-Coupled Receptor Screening Assays: Methods and Protocols; Martins, S. A. M.; Prazeres, D. M. F., Eds.; Springer: US, New York, NY, 2021; pp 119– 136.
      There is no corresponding record for this reference.
    66. 66
      Kopanchuk, S.; Vavers, E.; Veiksina, S.; Ligi, K.; Zvejniece, L.; Dambrova, M.; Rinken, A. Intracellular dynamics of the Sigma-1 receptor observed with super-resolution imaging microscopy. PLoS One 2022, 17, e0268563  DOI: 10.1371/journal.pone.0268563
      There is no corresponding record for this reference.
    67. 67
      Soulez, F. In A “Learn 2D, Apply 3D” Method for 3D Deconvolution Microscopy, 2014 IEEE 11th International Symposium on Biomedical Imaging (ISBI); IEEE, 2014; pp 1075– 1078.
      There is no corresponding record for this reference.
    68. 68
      Chenouard, N.; Bloch, I.; Olivo-Marin, J. C. Multiple hypothesis tracking for cluttered biological image sequences. IEEE Trans. Pattern Anal. Mach. Intell. 2013, 35, 2736– 3750,  DOI: 10.1109/TPAMI.2013.97
      68
      Multiple hypothesis tracking for cluttered biological image sequences
      Chenouard Nicolas; Bloch Isabelle; Olivo-Marin Jean-Christophe
      IEEE transactions on pattern analysis and machine intelligence (2013), 35 (11), 2736-3750 ISSN:.
      In this paper, we present a method for simultaneously tracking thousands of targets in biological image sequences, which is of major importance in modern biology. The complexity and inherent randomness of the problem lead us to propose a unified probabilistic framework for tracking biological particles in microscope images. The framework includes realistic models of particle motion and existence and of fluorescence image features. For the track extraction process per se, the very cluttered conditions motivate the adoption of a multiframe approach that enforces tracking decision robustness to poor imaging conditions and to random target movements. We tackle the large-scale nature of the problem by adapting the multiple hypothesis tracking algorithm to the proposed framework, resulting in a method with a favorable tradeoff between the model complexity and the computational cost of the tracking procedure. When compared to the state-of-the-art tracking techniques for bioimaging, the proposed algorithm is shown to be the only method providing high-quality results despite the critically poor imaging conditions and the dense target presence. We thus demonstrate the benefits of advanced Bayesian tracking techniques for the accurate computational modeling of dynamical biological processes, which is promising for further developments in this domain.

  • Supporting Information

    Supporting Information

    The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsptsci.4c00013.

    • Preparation of the azido-functionalized Py-5 derivative 15; chromatograms of the investigation of the chemical stability of 16–18 in PBS pH 7.4 (Figure S1); radioligand displacement curves from competition binding experiments with [3H]UR-KK200 (Figure S2); concentration–response curves of hPP, 11 and 16–19 obtained from a hY4R Ca2+ aequorin assay (Figure S3); concentration–response curves of hPP, 5, 11, and 16–19 obtained from a hY4R mini-Gsi protein recruitment assay (Figure S4); concentration–response curves of hPP, 16 and 17 obtained from a hY4R CAMYEN cAMP assay (Figure S5); study of dummy fluorescent ligands in functional assays (Figure S6); excitation and emission spectra (Figure S7); viability of CHO-hY4R-Gqi5-mtAEQ cells (Figure S8); analyses of flow cytometric saturation binding data of 16 based on nonviable and viable cell populations (Figure S9); syntax of the equation used to fit FA equilibrium binding data (GraphPad Prism 5); RP-HPLC chromatograms of compounds 11 and 16–19; and 1H NMR spectra of compound 11 (PDF)

    • TIRF video sequence (recorded and shown at a 30 Hz resolution, shown at double speed) showing the interactions of 16 with the basal plasma membrane of adherent SK-OV-3-Y4R cells including single-particle tracking (magnified region) (AVI)


    Terms & Conditions

    Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.