Download Hi-Res ImageDownload to MS-PowerPointCite This:J. Med. Chem. 2015, 58, 2, 651-664

ArticleDecember 18, 2014

Design, Synthesis, Biochemical, and Antiviral Evaluations of C6 Benzyl and C6 Biarylmethyl Substituted 2-Hydroxylisoquinoline-1,3-diones: Dual Inhibition against HIV Reverse Transcriptase-Associated RNase H and Polymerase with Antiviral Activities
Click to copy article linkArticle link copied!

View Author Information

Open PDF Supporting Information (1)

Journal of Medicinal Chemistry

Cite this: J. Med. Chem. 2015, 58, 2, 651–664

Click to copy citationCitation copied!

https://doi.org/10.1021/jm501132s

Published December 18, 2014

Request reuse permissions

Abstract

Click to copy section linkSection link copied!

Reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not targeted by current chemotherapy against human immunodeficiency virus (HIV). Although numerous chemotypes have been reported to inhibit HIV RNase H biochemically, few show significant antiviral activity against HIV. We report herein the design, synthesis, and biological evaluations of a novel variant of 2-hydroxyisoquinoline-1,3-dione (HID) scaffold featuring a crucial C-6 benzyl or biarylmethyl moiety. The synthesis involved a recently reported metal-free direct benzylation between tosylhydrazone and boronic acid, which allowed the generation of structural diversity for the hydrophobic aromatic region. Biochemical studies showed that the C-6 benzyl and biarylmethyl HID analogues, previously unknown chemotypes, consistently inhibited HIV RT-associated RNase H and polymerase with IC₅₀s in low to submicromolar range. The observed dual inhibitory activity remained uncompromised against RT mutants resistant to non-nucleoside RT inhibitors (NNRTIs), suggesting the involvement of binding site(s) other than the NNRTI binding pocket. Intriguingly, these same compounds inhibited the polymerase, but not the RNase H function of Moloney Murine Leukemia Virus (MoMLV) RT and also inhibited Escherichia coli RNase H. Additional biochemical testing revealed a substantially reduced level of inhibition against HIV integrase. Molecular docking corroborates favorable binding of these analogues to the active site of HIV RNase H. Finally, a number of these analogues also demonstrated antiviral activity at low micromolar concentrations.

Subjects

Introduction

Click to copy section linkSection link copied!

HIV infects an estimated 35 million people worldwide. (1) With the lack of effective vaccines (2, 3) and challenges in achieving viral eradication, (4-6) managing HIV infection continues to rely heavily on antivirals for prophylaxis and therapy. Anti-HIV drugs targeting all three virally encoded enzymes: RT, integrase (IN), and protease, as well as viral entry proteins and cellular coreceptors, provide a large repertoire for the highly active antiretroviral therapy (HAART). Although largely efficacious, these regimens can be plagued by the emergence of resistant HIV mutants. Therefore, less explored and unvalidated viral targets key to HIV replication have become increasingly attractive for developing antivirals with novel mechanism of action to inhibit resistant viral strains. One such target is the RT associated RNase H activity. (7, 8) RT has two domains with distinct enzymatic functions essential for HIV replication: (8) a polymerase domain that carries out both RNA dependent DNA polymerization and DNA dependent DNA polymerization, and an RNase H domain that selectively degrades RNA from the RNA/DNA heteroduplex intermediate during reverse transcription. Current FDA-approved nucleoside RT inhibitors (NRTIs) (9) and non-nucleoside RT inhibitors (NNRTIs) (10) all target the DNA polymerase function of RT; inhibitors of RT-associated RNase H have yet to make it to the development pipeline.

The critical role of RNase H in HIV replication has long been recognized and efforts in targeting RNase H for antiviral development have identified a few active site inhibitor chemotypes (Figure 1), (11, 12) including HID (1), (13) β-thujaplicinol (2), (14) furan-2-carboxylic acid carbamoylmethyl ester (3), (15) diketoacid (4), (16) the Gilead pyrimidinol carboxylic acid (5), (17) the Merck naphthyridinone (6), (18) and the GSK pyridopyrimidinone (7). (19, 20) These chemotypes all have a chelating triad (magenta) for competitive binding to the active site divalent metals. Structurally more elaborate chemotypes (4–7) also feature a hydrophobic aromatic moiety, typically an aryl (4–5) or biaryl (6–7), connected to the chelating core through a methylene or amino linker, conferring potent and selective RNase H inhibition. The biaryl substituent proved to be particularly effective as compounds 6–7 are among the very few RNase H inhibitors that demonstrate potent antiviral activity. (18, 19)

Figure 1. Major chemotypes reported as HIV RNase H active site inhibitors. Chemotypes 4–7 reflect a pharmacophore model consisting of a chelating triad (magenta) and an aryl or biaryl moiety (cyan) connected through a methylene or amino linker.

We are particularly interested in the HID chelating core because we have previously constructed C6/C7 aryl-substituted HID scaffolds for inhibiting hepatitis C virus NS5B. (21) Other variants of HID have also been explored as HIV IN inhibitors. (22-25) Klumpp et al. first reported the ability of HID (1) to inhibit HIV, but not the Escherichia coli RNase H, (13) albeit without antiviral activity in cell-based assays (Figure 2). Improved inhibitory profile, including anti-HIV activity, was achieved by Billamboz et al. through C4 carboxylate substitution (Figure 2, compound 8). (26) As aforementioned, the best RNase H inhibitors known reflect a pharmacophore model that features a biaryl moiety. This pharmacophore model prompted us to design a previously unknown variant of HID (Figure 2, chemotype 9). We report herein the chemical synthesis, biochemical and aniviral evaluations, and molecular modeling of 9.

Figure 2. Design of a novel HID scaffold 9 based on the pharmacophore model of 4–7.

Results and Discussion

Click to copy section linkSection link copied!

Chemistry

The synthetic chemistry for constructing HID ring has been well established. The synthesis typically involves a Hurtley reaction for parent HID (1) or C4 carboxylated HID (8). (26, 27) A synthetic handle on C6/C7 position, particularly a halogen or amino group, also allowed variation of HID through similar synthetic routes. (21, 27) This general strategy, however, proved unsuccessful toward the synthesis of our newly designed HID chemotype 9. The C6 benzylation in this case turned out to be a major synthetic hurdle. After several unsuccessful attempts, we were able to work out a synthetic route that allowed the synthesis of a library of 20 6-benzyl or biarylmethyl substituted 2-hydroxyisoquinoline-1,3(2H,4H)-dione analogues in 9–10 steps (Scheme 1). Key to this approach was the adaptation of a one-pot benzylation procedure (28) for the formation of C–C bond reported by Valdés and co-workers, which involves a reductive coupling of aldehyde 12 with a boronic acid in the presence of a base (steps c–d, Scheme 1). The employment of various boronic acids in this step generated the structural diversity for the C6 benzyl series of analogues. Another prominent feature of this synthesis is the masking of the requisite dicarboxylic acid (17) with a alcohol handle (12) to facilitate the key benzylation. The diversity for the second series, the C6 biarylmethyl HID, was introduced much later in the synthesis (step h, Scheme 1) via Suzuki coupling.

Scheme 1. Synthesis of C6 Arylmethyl HID Analogues **20a**–t^a

The detailed synthesis is depicted in Scheme 1. To begin the synthesis, commercially available 5-bromoindan-1-one (10) was reduced to alcohol 11 with NaBH₄, followed by a direct formylation with N,N-dimethylformamide (DMF) and n-BuLi to afford aldehyde 12 in good yield. The subsequent benzylation was carried out via a two-step sequence: the formation of tosylhydrazone 13 by treating aldehyde 12 with tosylhydrazine, and the reductive coupling of 13 with various boronic acids to produce 5-arylmethylindanones (14a–g). (28) Although this two-step benzylation process worked with only moderate yields, it did tolerate a range of functional groups. The elaboration from alcohols 14a–g to diacids 17a–g was achieved in three steps: first, a dehydration by treating with pyridinium p-toluenesulfonate (PPTS) at reflux toluene furnished alkenes 15a–g in good to excellent yields, second, an Upjohn dihydroxylation (29, 30) of alkenes 15a–g yielded diols 16a–g under ambient temperature, and third, an oxidative cleavage of 1,2 diols 16a–g with NaIO₄ and RuCl₃ (31) resulted in intermediate homophthalic acid derivatives 17a–g in good yields. At this point, a series of C6 biarylmethyl diacids (18h–t) were obtained via Suzuki coupling from 4-Br intermediate diacid 17e. Finally, the target scaffold 9 as represented by analogues 20a–t was constructed by the condensation of diacids 17a–g and 18h–t with O-tetrahydropyran (THP) protected hydroxylamine in the presence of carbonyldiimidazole (CDI) in refluxing toluene. The isolation of cyclized products 19a–t from the reaction mixture proved to be rather straightforward by flash column chromatography. This cyclization followed by the deprotection of THP under p-toluenesulfonic acid (p-TSA) afforded target compounds 20a–t in 35–55% yield over two steps.

Biology

All newly synthesized analogues were evaluated biochemically for inhibition in RNase H and/or polymerase assays of HIV RT, MoMLV RT, and E. coli RNase H, as well as in an HIV IN strand transfer assay. Antiviral activity was assessed in cell-based assays and antiviral EC₅₀ and cytoxicity CC₅₀ values were generated for selected analogues.

All New C6 Benzyl and C6 Biarylmethyl HID Analogues Potently Inhibit HIV RT Associated RNase H and Polymerase

RNA cleavage by RNase H is required at multiple stages of reverse transcription and could involve at least three distinct modes of RNase H cleavages: (12) the random internal cleavages which likely represent the majority of RNase H event during reverse transcription, the DNA 3′ end directed and polymerase dependent cleavages which allow specific RNA cuts 17—18 nucleotides downstream from the polymerase active site, and the RNA 5′ end directed cleavages which degrade the recessed RNA template. The RNase H inhibitory activity of our compounds was assessed using three different oligonucleotide duplexes as described in the Experimental Section. Substrate HTS-1 is a short (18 bp) duplex that measures internal cleavages and is highly sensitive to inhibitors, (32-34) substrate HTS-2 assesses DNA 3′ end directed cleavages, and substrate HTS-3 evaluates RNA 5′ end directed cleavages. Detailed assay results are summarized in Table 1. Overall, our newly synthesized HID analogues, both the C6 benzyl series (20a–h) and C6 biarylmethyl series (20i–t), potently inhibited all three forms of RNase H cleavage with virtually equal potencies. Interestingly, while almost all compounds within the C6 benzyl series (20a–g) were active in low micromolar range, quite a few analogues of the C6 biarylmethyl series (20i, 20l, 20o, 20r, and 20t) demonstrated submicromolar activities, suggesting that the additional aromatic ring can be advantegous for the biochemical inhibitory activity. Another key observation was the relatively flat structure–activity relationship (SAR) around the C6 benzyl series where all analogues exhibited a similar IC₅₀ value (1.2—1.6 μM) except for the 4-cyclopropyl derivative (20h, IC₅₀ = 0.6 μM) and the 4-Cl analogue (20d, IC₅₀ = 3.9 μM). By contrast, the C6 biarylmethyl series showed greater variation in IC₅₀ values with two notable SAR trends: (1) a fluoro group on the terminal aromatic ring did not enhance biochemical inhibition (20k and 20q vs 20i), which represents a significant departure from the canonical IN inhibitor pharmacophore model where such a fluoro group typically benefit target binding substantially; (2) a strong electron-withdrawing group with H-bonding ability, such as cyano (20l) sulfonamide (20o), and pyridine (20t), appeared to confer the most potent biochemical inhibition. These observations corroborate an inhibitor binding mode where the terminal aromatic group makes critical contacts with the RNA/DNA substrate. Further biochemical evaluation with a reconstituted and catalytically active RNase H domain confirmed the observed potency and SAR trends (Table 1, RNase H fragment).

Table 1. Biochemical Inhibitory Activity of Compounds 20a–t against HIV RT RNase H and Polymerase

^{Table a}

IC₅₀: concentration of a compound producing 50% inhibition, expressed as mean ± standard deviation from at least three independent experiments.

^{Table b}

Substrate that measures internal cleavage.

^{Table c}

Substrate that measures DNA 3′ end directed cleavage.

^{Table d}

Substrate that measures RNA 5′ end directed cleavage.

^{Table e}

Reconstituted HIV RNase H domain.

In parallel to the RNase H assays, all compounds were also tested in a classic RT polymerase assay with poly(A) as template, poly(dT) as primer and [³H]dTTP. The results are listed in Table 1. Interestingly, our compounds inhibited polymerase with potencies nearly equal to RNase H inhibition while a control compound (1) showed a selective profile toward RNase H inhibition consistent with previous report. (13) Selected analogues were further tested against NNRTI-resistant HIV RT single (Y181C) and double (L100I/K103N) mutants. These assays yielded IC₅₀ values against both RNase H and polymerase largely in range with those of WT RT (Table 2), strongly suggesting that our compounds do not occupy the NNRTI pocket. Although the exact mechanism of polymerase inhibition is not clear, it is conceivable that, with the chelating triad, these compounds could compete for polymerase active site binding. It is also possible that they may bind at an unknown site of RT and affect both polymerase and RNase H activities. Nevertheless, previous work on similar HID scaffolds has reported selective inhibition against HIV RNase H, (13, 26) IN, (23) or dual inhibition against both. (22, 27) The unique and potent dual inhibition of our compounds against RT RNase H and polymerase will add to the activity profile of these important compounds and may contribute to achieving the elusive antiviral activity for RNase H-targeting HID compounds.

Table 2. Biochemical Inhibitory Activity of Selected Compounds against RNase H and Polymerase Functions of NNRTI-Resistant HIV RT Mutants

^{Table a}

IC₅₀: concentration of a compound producing 50% inhibition, expressed as mean ± standard deviation from at least three independent experiments.

^{Table b}

RNase H substrates as described in the Experimental Section.

To further establish the biochemical inhibitory profile of our compounds, we also tested selected compounds against E. coli RNase H and MoMLV RT RNase H and polymerase activities. As shown in Table 3, all analogues demonstrated single-digit μM activity against E. coli RNase H. For MoMLV RT, no inhibitory activity was detected against RNase H and low μM activity was observed against polymerase (Table 3). These results suggest that dual inhibition of both RT functions can be achieved with HIV RT only.

Table 3. Biochemical Inhibitory Activity of Selected Compounds against E. coli RNase H and MoMLV RT RNase H and Polymerase Activities

^{Table a}

IC₅₀: concentration of a compound producing 50% inhibition, expressed as mean ± standard deviation from two independent experiments of duplicates.

Some C6 Benzyl and C6 Biarylmethyl HID Analogues Moderately Inhibit HIV IN

RNase H enzymes form a signature fold at the active site that defines a whole family of highly homologous enzymes termed as retroviral integrase superfamily (RISF). (35) Members of this family of enzymes, including HIV IN, adopt a very similar active site fold as RNase H. As a result, achieving selective RNase H inhibition over IN inhibition represents a major challenge in RNase H inhibitor discovery. To gauge the selectivity profile of our new HID chemotype, we tested all compounds in an HIV IN strand transfer (ST) assay. The results are summarized in Table 4. Notably, with the exception of 20f, which did not show any activity at concentrations up to 100 μM, all compounds within the C6 benzyl HID series (20a–h) demonstrated significant activity against HIV IN at low micromolar concentrations with IC₅₀ values ranging between 3.8 and 36 μM. This observation conforms to the pharmacophore model of IN ST inhibitors where a chelating triad and a terminal benzyl group are the two major structural determiants. (36) Nevertheless, most compounds within this series inhibited IN with a considerably higher IC₅₀ than that for RNase H inhibition. Furthermore, the IN inhibitory activity was drastically reduced when a second aromatic ring was introduced to the benzyl terminus, resulting in the biarylmethyl HID series (20i–t). Seven out of the 12 analogues within this series showed no activity against IN at concentrations up to 100 μM, leading to excellent selectivity toward RNase H inhibition (Table 4, compounds 20i–m, 20q, and 20s). Others (20n–p, 20r, and 20t) inhibited IN in low micromolar range, yet still with a sizable nominal selectivity (3.8–16-fold, Table 4) toward RNase H inhibition. Although intractable variables involved in biochemical assays render it unreliable to quantitatively correlate distinct biochemical assays (IN vs RNase H and pol), the general lack of IN inhibition and the potent anti-RNase H and antipolymerase activities of the biarylmethyl series could indicate that it is possible to develop RT dual inhibitors without inhibiting IN based on this particular chemotype.

Table 4. Biochemical Inhibitory Activity of Compounds 20a–t against HIV IN

^{Table a}

Data with HTS-1 as substrate.

^{Table b}

Expressed as mean ± standard deviation from at least three independent experiments.

^{Table c}

Selectivity index defined by IC₅₀ IN/IC₅₀ RNase H.

Many C6 Benzyl and C6 Biarylmethyl HID Analogues Inhibit HIV-1 in Low Micromolar Range

To assess the ability of our new C6 benzyl and biarylmethyl HID chemotypes in inhibiting HIV replication in cell culture, we have carried out a single replication cycle antiviral assay. (37, 38) This assay quantitatively measures HIV infection in indicator cells (P4R5) through the expression of a Tat-dependent reporter (β-galactosidase) and quickly determines the infectivity/inhibition with only one replication cycle by colorimetric analysis after incubation with a β-galactosidase substrate. We tested all 20 newly synthesized HID analogues in this antiviral assay, and nine of them inhibited HIV replication in low micromolar range (Table 5), with compound 20i being the most potent with an antiviral EC₅₀ of 3.0 μM. Although compounds of a few chemotypes have been reported to biochemically inhibit HIV RNase H, a limited number demonstrated significant antiviral activities, which signifies the challenge for small molecules to compete against much larger RNA/DNA substrates for active site binding. Achieving antiviral activity with RNase H active site inhibitors entails exceptionally tight binding only achieved with a few compounds. (20) The consistent and low micromolar antiviral activity observed with our compounds may reflect the benefits of additional polymerase inhibition in overcoming the biochemical barrier of competing against endogenous substrates.

Table 5. Antiviral Potency of Selected Analogues^a

^{Table a}

All values are averages of two separate determinations.

^{Table b}

50 μM was the highest concentration tested.

^{Table c}

n.d., not determined.

RNase H Active Site Binding

To confirm the RNase H active site binding mode of our new chemotypes, we have conducted molecular modeling where a selected analogue 20i was docked along with the potent GSK-5724 (7) into the crystal structure of full length RT cocrystallized with napthyridinone-based scaffold MK2 (PDB code: 3LP1). (39) The full length RT consists of two domains, the p66 subunit with fingers (blue), palm (red), thumb (green), connection (yellow), and RNase H (magenta) subdomains, and the p51 subunit (orange) as shown in Figure 3, left. The above RT structure was subjected to analysis and found that the napthyridinone was bound to the active site of RNase H, which is ∼50 Å from the NNRTI site. The docking analysis was performed using Glide (Schrodinger Inc.). (40) The predicted binding modes of both the compounds within the active site of RNase H are shown in Figure 3, right.

Figure 3. Binding mode of compound **20i**. Left: structure of full length RT with two subunits p66 and p51 (orange). p66 subunit comprises fingers (blue), palm (red), thumb (green), connection (yellow), and RNase H (magenta) domains. Compounds 7 (green) and **20i** (cyan) are docked into the RNase H active site. Right: a close-up view of RNase H active site with predicted binding mode of compound 7 (green) and **20i** (cyan). Metal cofactors (Mn²⁺) are colored in gray, with the active site residues (D443, E478, D498 and D549) in yellow. Pictures were generated using PyMol. (41)

The predicted binding mode of compound 7 within the active site of RNase H suggests a potential interaction between the pyridopyrimidinone core (chelating triad) and the two metal cofactors (Mn²⁺), which are coordinated to the active site acidic residues D443, E478, D498, and D549. The binding pocket is lined up with the residues G444, S449, A538, H539, W535, V552, and S553 of the p61 subunit and N265, W266, F346, and W535 of the p51 subunit. The biaryl moiety is extended into the small hydrophobic region of the RNase H, which could potentially interact with the protein or nucleic acid substrate. A similar binding mode was postulated for compound 20i within the active site of RNase H where the chelating triad in HID interacts with both the metal cofactors (Mn²⁺), while the CH₂ and C–H groups at the C4 and C5 position of compound 20i respectively interacts with the small hydrophobic residue A538 at the beginning of the pocket close to H539. The biaryl linker extends from the C6 position into the pocket lined up with hydrophobic residues W535 of the p66 subunit and W266, F346, and W426 of the p51 subunit. The predicted binding mode of both the compounds (7 and 20i) appears to satisfy the typically required chelating triad interaction with both the metal cofactors and the biaryl linker extends into the hydrophobic pocket (Figure 3, right), hence corroborating the active site inhibition mechanism against RNase H. As for polymerase binding, the uncompromised biochemical inhibition against NNRTI-resistant RT mutants strongly indicates that the NNRTI binding pocket is not occupied, consistent with our inability to stably dock our HID analogues into the NNRTI-binding pocket (data not shown). The exact binding mode for inhibition of RT polymerase activity is still unclear.

Conclusions

Click to copy section linkSection link copied!

New HID chemotypes featuring a C-6 benzyl or biarylmethyl moiety were designed and synthesized as inhibitors of HIV RT associated RNase H domain. Key to the synthesis was the adaptation of a metal-free reductive benzylation and the masking of the requisite dicarboxylic acid. Primary biochemical assays with WT and NNRTI-resistant HIV RT showed that all analogues of our new chemotypes were dually active against RNase H and polymerase in sub- to low-micromolar range. Additional testing demonstrated that our compounds also inhibit E. coli RNase H, as well as the polymerase, but not the RNase H, of MoMLV RT. Some analogues were also found active against HIV IN in a strand transfer assay, although the vast majority of the newly synthesized compounds, particularly the 6-biarylmethyl series, demonstrated a discernible preference toward RNase H and polymerase inhibition. Importantly, many of these new analogues inhibited HIV-1 in cell culture at low micromolar concentrations. Although the polymerase inhibition mechanism is not clear, molecular docking corroborates a mechanism of active site binding for RNase H inhibition. Collectively these studies established our new C6 benzyl and biarylmethyl scaffolds as potent dual inhibitors of HIV RT RNase H and polymerase, and that the additional polymerase inhibition may benefit active site RNase H inhibitors in achieving antiviral activity.

Experimental Section

Click to copy section linkSection link copied!

Chemistry: General Procedures

All commercial chemicals were used as supplied unless otherwise indicated. Dry solvents were either purchased (toluene and dioxane) or dispensed under argon from an anhydrous solvent system with two packed columns of neutral alumina or molecular sieves (THF and DMF). Flash chromatography was performed on a Teledyne Combiflash RF-200 with RediSep columns (silica) and indicated mobile phase. All moisture sensitive reactions were performed under an inert atmosphere of ultrapure argon with oven-dried glassware. ¹H and ¹³C NMR spectra were recorded on a Varian 600 MHz spectrometer. Mass data were acquired on an Agilent TOF II TOS/MS spectrometer capable of ESI and APCI ion sources. Analysis of sample purity was performed on a Varian Prepstar SD-1 HPLC system with a Phenomenex Gemini, 5 μm C18 column (250 mm × 4.6 mm). HPLC conditions: solvent A = H₂O, solvent B = MeCN; flow rate = 1.0 mL/min; compounds were eluted with a gradient of 5% MeCN/H₂O to 100% MeCN for 25 min. Purity was determined by total absorbance at 254 nm. All tested compounds have a purity ≥96.

General Procedure 1 for the One-Pot Reductive Coupling of Aldehydes with Boronic Acids (14a–g)

To a solution of aldehyde 12 (17.4 mmol, 1.0 equiv) in toluene (15 mL) was added TsNHNH₂ (1.34 g, 7.4 mmol, 1.0 equiv) and stirred at 80 °C for 2–3 h. The reaction was monitored by TLC. After complete consumption of aldehyde, solvent was removed under vacuo. Tosylhydrazone was further dried under high vacuum for several hours and used in the next step without further purification. To a solution of tosylhydrazone in dioxane (20 mL) was added potassium carbonate (1.02 g, 11.1 mmol, 1.5 equiv) and boronic acid (11.1 mmol, 1.5 equiv). The reaction mixture was refluxed for 2–4 h and monitored by TLC. The solvent was removed under reduced pressure, and saturated solution of NaHCO₃ was added and extracted with DCM (3 × 50 mL). The combined organic layers were dried over Na₂SO₄, filtered, and concentrated. The crude product was purified by flash column chromatography (EtOAc/hexane, 1:6) to afford desired compound (14a–g) as a solid.

5-Benzyl-2,3-dihydro-1H-inden-1-ol (14a)

Yield 54%. ¹H NMR (CDCl₃, 600 MHz) δ 7.32–7.26 (m, 4H), 7.22–7.20 (m, 2H), 7.09–7.08 (m, 2H), 5.22 (t, J = 6.6 Hz, 1H), 3.98 (s, 2H), 3.04–2.99 (m, 1H), 2.80–2.75 (m, 1H), 2.50–2.45 (m, 1H), 1.97–1.94 (m, 1H), 1.61 (s, 1H, OH).

General Procedure 2 for the Synthesis of Alkene (15a–g)

To a solution of alcohol (3.45 mmol, 1.0 equiv) in toluene (20 mL) was added PPTS (10.37 mmol, 3.0 equiv). The reaction mixture was refluxed for 6–10 h and monitored by TLC and cooled to room temperature. The saturated NaHCO₃ solution was added, and the aqueous layer was extracted with EtOAc (3 × 25 mL). The combined organic layers were dried over Na₂SO₄, filtered, and concentrated. The crude product was purified by flash column chromatography (EtOAc/hexane, 1:99) to afford desired alkene (15a–g) as a solid.

6-Benzyl-1H-indene (15a)

Yield 90%. ¹H NMR (CDCl₃, 600 MHz) δ 7.23–7.17 (m, 4H), 7.14–7.12 (m, 3H), 7.03 (d, J = 7.8 Hz, 1H), 6.76–6.75 (m, 1H), 6.40–6.39 (m, 1H), 3.93 (s, 2H), 3.25 (s, 2H).

General Procedure 3 for the Synthesis of Diol (16a–g)

To a solution of alkene (2.81 mmol, 1.0 equiv) in (acetone/t-butanol/water; 3:3:4; 20 mL) was added osmium tetroxide (2.5% solution in t-BuOH, 0.28 mmol, 0.1 equiv) and N-methylmorpholineoxide (4.22 mmol, 1.5 equiv) and stirred at room temperature for 4–10 h, and the reaction was monitored by TLC. After complete consumption of the starting material, sodium sulfite (4 equiv) was added and stirred at room temperature for 1 h more. The solvent was evaporated, and the aqueous layer was extracted with EtOAc (3 × 25 mL). The combined organic layers were dried over Na₂SO₄, filtered, and concentrated. The crude product was purified by flash column chromatography (EtOAc/hexane; 1.5:3.5) to afford desired diol (16a–g) as a solid.

5-Benzyl-2,3-dihydro-1H-indene-1,2-diol (16a)

Yield 81%. ¹H NMR (CDCl₃, 600 MHz) δ 7.34 (d, J = 7.8 Hz, 1H), 7.29–7.26 (m, 3H), 7.21–7.17 (m, 2H), 7.11 (d, J = 7.8 Hz, 1H), 7.06 (s, 1H), 4.97 (d, J = 4.8 Hz, 1H), 4.50–4.48 (m, 1H), 3.96 (s, 2H), 3.08 (dd, J = 6.0 Hz, J = 16.2 Hz, 1H), 2.90 (dd, J = 4.2 Hz, J = 16.2 Hz, 1H), 2.27 (s, 2H, 2-OH).

General Procedure 4 for the Synthesis of Dicarboxylic Acid (17a–g)

The suspension of diol (1.86 mmol, 1.0 equiv) in CH₃CN/CCl₄/H₂O (2:2:3; 20 mL) was sonicated to make a clear solution. After the addition of NaIO₄ (11.2 mmol, 6.0 equiv), the reaction mixture was stirred for 10 min, then treated with RuCl₃·H₂O (0.19 mmol, 0.1 equiv). The reaction mixture was stirred for 30–40 min and monitored by TLC. The mixture was diluted with water and extracted with CH₂Cl₂ (3 × 25 mL), and the combined organic layers were dried over Na₂SO₄, filtered, and concentrated to give a black residue, then Et₂O was added to the residue and filtered through a short pad of Celite. The filtrate was concentrated to provide a brown oil and was triturated with ether to get dicarboxylic acid (17a–g) as a solid.

4-Benzyl-2-(carboxymethyl)benzoic Acid (17a)

Yield 81%. ¹H NMR (CD₃OD, 600 MHz) δ 7.93 (d, J = 8.4 Hz, 1H), 7.27–7.25 (m, 2H), 7.21–7.18 (s, 4H), 7.15 (s, 1H), 4.00 (s, 2H), 3.96 (s, 2H).

General Procedure 5 for Suzuki Coupling (18h–t)

The mixture of diacid 17e (150 mg, 0.43 mmol), boronic acid (0.86 mmol, 2.0 equiv), K₂CO₃ (1.7 mmol, 4.0 equiv), EtOH/H₂O (1:1, 4.0 mL), and Pd[P(Ph)₃]₄ (30 mg) were microwaved at 120 °C for 20–30 min. The reaction was monitored by TLC and MS. The black residue formed was filtered, and the filtrate was concentrated under reduced pressure to remove EtOH. The aqueous mixture was washed with Et₂O and then acidified to pH 3. The white precipitate was obtained via filtration, dried under high vacuum overnight, and used in the next step without further purification.

4-([1,1′-Biphenyl]-4-ylmethyl)-2-(carboxymethyl)benzoic Acid (18i)

Yield 75%. ¹H NMR (DMSO, 600 MHz) δ 7.83 (d, J = 7.8 Hz, 1H), 7.61 (d, J = 7.2 Hz, 2H), 7.57 (d, J = 8.4 Hz, 2H), 7.42 (t, J = 7.8 Hz, 2H), 7.33–7.31 (m, 3H), 7.25–7.23 (m, 2H), 3.99 (s, 2H), 3.88 (s, 2H).

General Procedure 6 for Cyclization and Deprotection (20a–t)

A solution of dicarboxylic acid (0.28 mmol, 1.0 equiv) and NH₂OTHP (0.34 mmol, 1.2 equiv) in toluene (15 mL) was refluxed for 5 min. To the mixture, a solution of CDI in DCM (0.28 mmol, 1.0 equiv) was added dropwise. The suspension turned clear and stirred at reflux for 12 h, a black solid separated from solution, and the reaction monitored by TLC and MS. The reaction mixture was passed through a short pad of silica gel which then rinsed with (EtOAc/hexane, 1:3), the combined filtrate was evaporated to dryness. The product was used for the next reaction without further purification. The cyclized product was dissolved in MeOH (5.0 mL) and treated with pTSA hydrate (1.0 equiv) and stirred at room temperature for 2–3 h. Upon the disappearance of starting material by TLC, the mixture was evaporated to dryness to get pale-yellow solid. The solid obtained was triturated with water and then with ether and dried at room temperature to afford a desired pure compound (20a–t) as a solid.

6-Benzyl-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20a)

Yield 55% (for two steps from 17a). ¹H NMR (CD₃OD, 600 MHz) δ 8.02 (d, J = 8.4 Hz, 1H), 7.32 (d, J = 7.8 Hz, 1H), 7.28–7.25 (m, 2H), 7.22–7.18 (m, 4H), 4.84 (s, 2H), 4.03 (s, 2H). ¹³C NMR (CD₃OD, 150 MHz) δ 167.1, 162.2, 148.2, 139.9, 134.4, 128.6, 128.2, 128.1, 128.0, 127.5, 126.0, 122.8, 47.2, 41.2. HRMS-ESI(−) m/z calcd for C₁₆H₁₂NO₃, 266.0817 [M – H]⁻; found, 266.0808.

2-Hydroxy-6-(4-methylbenzyl)isoquinoline-1,3(2H,4H)-dione (20b)

Yield 54% (for two steps from 17b). ¹H NMR (CD₃OD, 600 MHz) δ 8.02 (d, J = 8.4 Hz, 1H), 7.30–7.29 (m, 1H), 7.20 (s, 1H), 7.09–7.08 (m, 4H), 4.15 (s, 2H), 3.98 (s, 2H), 2.27 (s, 3H). ¹³C NMR (CD₃OD, 150 MHz) δ 167.1, 162.2, 148.5, 136.8, 135.7, 134.3, 128.8, 128.5, 128.1, 127.4, 122.8, 40.8, 19.6. HRMS-ESI(−) m/z calcd for C₁₇H₁₄NO₃, 280.0974 [M – H]⁻; found, 280.0961.

6-(4-Fluorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20c)

Yield 51% (for two steps from 17c). ¹H NMR (DMSO, 600 MHz) δ 10.31 (s, 1H, OH), 7.92 (d, J = 7.8 Hz, 1H), 7.32 (d, J = 8.4 Hz, 1H), 7.28–7.26 (m, 2H), 7.23 (s, 1H), 7.10 (t, J = 9.0 Hz, 2H), 4.19 (s, 2H), 3.99 (s, 2H). ¹³C NMR (DMSO, 150 MHz) δ 166.7, 162.0, 147.6, 135.4, 131.1, 128.5, 128.3, 128.0, 123.6, 115.8, 115.6, 47.5, 37.3. HRMS-ESI(−) m/z calcd for C₁₆H₁₁NFO₃, 284.0723 [M – H]⁻; found, 284.0722.

6-(4-Chlorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20d)

Yield 51% (for two steps from 17d). ¹H NMR (CD₃OD, 600 MHz) δ 8.03 (d, J = 8.4 Hz, 1H), 7.31 (d, J = 3.9 Hz, 1H), 7.27–7.26 (m, 2H), 7.21–7.18 (m, 3H), 4.84 (s, 2H), 4.02 (s, 2H). ¹³C NMR (CD₃OD, 150 MHz) δ 167.1, 162.1, 147.6, 138.7, 134.5, 131.9, 130.2, 128.3, 128.2, 127.9, 127.5, 123.0, 48.1, 40.4. HRMS-ESI(−) m/z calcd for C₁₆H₁₁ClNO₃, 300.0427 [M – H]⁻; found, 300.0420.

6-(4-Bromobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20e)

Yield 48% (for two steps from 17e). ¹H NMR (CD₃OD, 600 MHz) δ 7.95 (d, J = 7.8 Hz, 1H), 7.32–7.33 (m, 2H), 7.34–7.22 (m, 1H), 7.13 (s, 1H), 7.05 (d, J = 7.8 Hz, 2H), 4.75 (s, 2H), 3.92 (s, 2H). ¹H NMR (DMSO, 600 MHz) δ 10.39 (s, 1H, OH), 8.01 (d, J = 7.8 Hz, 1H), 7.55 (d, J = 7.8 Hz, 2H), 7.40 (d, J = 8.4 Hz, 1H), 7.30–7.27 (m, 3H), 4.27 (s, 2H), 4.06 (s, 2H). ¹³C NMR (CD₃OD, 150 MHz) δ 167.4, 162.2, 147.5, 139.3, 134.5, 131.3, 130.5, 128.3, 128.3, 127.9, 127.5, 125.5, 123.0, 119.8 48.1, 40.4. HRMS-ESI(−) m/z calcd for C₁₆H₁₁BrNO₃, 343.9922 [M – H]⁻; found, 343.9911.

2-Hydroxy-6-(4-(trifluoromethyl)benzyl)isoquinoline-1,3(2H,4H)-dione (20f)

Yield 49% (for two steps from 17f). ¹H NMR (CD₃OD, 600 MHz) δ 8.06 (d, J = 8.4 Hz, 1H), 7.58 (d, J = 7.8 Hz, 2H), 7.42 (d, J = 7.8 Hz, 2H), 7.35 (d, J = 7.8 Hz, 1H), 7.25 (s, 1H), 4.84 (s, 2H), 4.14 (s, 2H). ¹³C NMR (CD₃OD, 150 MHz) δ 162.1, 147.0, 144.6, 134.6, 129.2, 128.3, 128.0, 127.6, 125.1, 123.2, 47.1, 40.4. HRMS-ESI(−) m/z calcd for C₁₇H₁₁F₃NO₃, 334.0691 [M – H]⁻; found, 334.0679.

6-(2,4-Difluorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20g)

Yield 50% (for two steps from 17g). ¹H NMR (CD₃OD, 600 MHz) δ 8.04 (d, J = 7.2 Hz, 1H), 7.32–7.28 (m, 2H), 7.22 (s, 1H), 6.97–6.89 (m, 2H), 4.17 (s, 2H), 4.04 (s, 2H). ¹³C NMR (CD₃OD, 150 MHz) δ 162.1, 146.5, 134.5, 131.8, 131.7, 128.2, 127.7, 127.3, 123.1, 111.0 110.9, 103.4, 103.2, 103.0, 33.6. HRMS-ESI(−) m/z calcd for C₁₆H₁₀F₂NO₃, 302.0629 [M – H]⁻; found, 302.0616.

6-(4-Cyclopropylbenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20h)

Yield 54% (for two steps from 18h). ¹H NMR (CDCl₃, 600 MHz) δ 8.11 (d, J = 8.4 Hz, 1H), 7.24 (d, J = 8.4 Hz, 1H), 7.09 (s, 1H), 7.05 (d, J = 8.4 Hz, 2H), 7.02 (d, J = 8.4 Hz, 2H), 4.12 (s, 2H), 3.99 (s, 2H), 1.88–1.85 (m, 1H), 0.96–0.93 (m, 2H), 0.68–0.65 (m, 2H). HRMS-ESI(−) m/z calcd for C₁₉H₁₆NO₃, 306.1130 [M – H]⁻; found, 306.1115.

6-([1,1′-Biphenyl]-4-ylmethyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20i)

Yield 47% (for two steps from 18i). ¹H NMR (CDCl₃, 600 MHz) δ 8.15 (d, J = 7.8 Hz, 1H), 7.57–7.54 (m, 4H), 7.43 (t, J = 7.8 Hz, 2H), 7.38–7.34 (m, 2H), 7.24 (d, J = 7.8 Hz, 2H), 7.15 (s, 1H), 4.14 (s, 2H), 4.09 (s, 2H). ¹³C NMR (CDCl₃, 150 MHz) δ 163.5, 160.1, 148.4, 140.6, 139.7, 138.2, 133.3, 129.3, 129.2, 129.0, 128.8, 127.8, 127.5, 127.3, 126.9, 122.0, 41.5, 36.4. HRMS-ESI(−) m/z calcd for C₂₂H₁₆NO₃, 342.1130 [M – H]⁻; found, 342.1111.

2-Hydroxy-6-(4-(thiophen-2-yl)benzyl)isoquinoline-1,3(2H,4H)-dione (20j)

Yield 47% (for two steps from 18j). ¹H NMR (CDCl₃, 600 MHz) δ 8.14 (d, J = 7.2 Hz, 1H), 7.56 (d, J = 7.8 Hz, 2H), 7.35 (d, J = 8.4 Hz, 1H), 7.29–7.28 (m, 2H), 7.18 (d, J = 7.2 Hz, 2H), 7.12 (s, 1H), 7.07–7.06 (m, 1H), 4.14 (s, 2H), 4.05 (s, 2H). ¹³C NMR (CDCl₃, 150 MHz) δ 163.5, 160.2, 148.2, 143.8, 138.4, 133.3, 129.4, 129.2, 128.9, 128.0, 127.8, 126.3, 124.8, 123.1, 122.0, 44.6, 41.5, 36.4. HRMS-ESI(−) m/z calcd for C₂₀H₁₄NSO₃, 348.0694 [M – H]⁻; found, 348.0677.

6-((4′-Fluoro-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20k)

Yield 45% (for two steps from 18k). ¹H NMR (CDCl₃/DMSO, 600 MHz) δ 8.20 (d, J = 7.2 Hz, 1H), 7.62–7.58 (m, 5H), 7.45 (d, J = 6.6 Hz, 1H), 7.35 (d, J = 6.6 Hz, 2H), 7.21–7.19 (m, 2H), 4.23 (s, 2H), 4.17 (s, 2H). ¹³C NMR (CDCl₃/DMSO, 150 MHz) δ 162.1, 161.5, 148.0, 138.5, 136.8, 133.6, 132.7, 131.7, 129.3, 128.9, 128.6, 128.3, 127.8, 127.6, 122.9, 115.4, 115.2, 41.2, 36.7. HRMS-ESI(−) m/z calcd for C₂₂H₁₅FNO₃, 360.1036 [M – H]⁻; found, 360.1023.

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-carbonitrile (20l)

Yield 37% (for two steps from 18l). ¹H NMR (DMSO, 600 MHz) δ 10.28 (br s, 1H), 7.95 (d, J = 8.4 Hz, 1H), 7.89 (d, J = 8.4 Hz, 2H), 7.84 (d, J = 8.4 Hz, 2H), 7.67 (d, J = 7.2 Hz, 2H), 7.39–7.36 (m, 3H), 7.28 (s, 1H), 4.21 (s, 2H), 4.06 (s, 2H). ¹³C NMR (DMSO, 150 MHz) δ 166.7, 162.0, 147.4, 144.8, 141.5, 136.7, 135.4, 133.3, 130.0, 128.5, 128.4, 128.1, 127.8, 123.6, 119.3, 110.3, 40.9, 37.4. HRMS-ESI(−) m/z calcd for C₂₃H₁₅N₂O₃, 367.1083 [M – H]⁻; found, 367.1068.

2-Hydroxy-6-((4′-methoxy-[1,1′-biphenyl]-4-yl)methyl)isoquinoline-1,3(2H,4H)-dione (20m)

Yield 41% (for two steps from 18m). ¹H NMR (CDCl₃/DMSO, 600 MHz) δ 8.14 (d, J = 6.6 Hz, 1H), 7.50–7.48 (m, 4H), 7.37 (d, J = 6.6 Hz, 1H), 7.21 (d, J = 7.2 Hz, 2H), 7.14 (s, 1H), 6.79 (d, J = 8.4 Hz, 2H), 4.13 (s, 2H), 4.07 (s, 2H), 3.84 (s, 3H). ¹³C NMR (CDCl₃/DMSO, 150 MHz) δ 166.4, 161.9, 159.1, 148.2, 139.2, 137.8, 133.5, 133.3, 129.3, 129.1, 128.8, 128.0, 127.7, 127.0, 122.9, 114.2, 55.3, 49.4, 41.5. HRMS-ESI(−) m/z calcd for C₂₃H₁₈NO₄, 372.1236 [M – H]⁻; found, 372.1223.

2-Hydroxy-6-((4′-(methylsulfonyl)-[1,1′-biphenyl]-4-yl)methyl)isoquinoline-1,3(2H,4H)-dione (20n)

Yield 48% (for two steps from 18n). ¹H NMR (CDCl₃, 600 MHz) δ 8.16 (d, J = 8.4 Hz, 1H), 8.00 (d, J = 7.8 Hz, 2H), 7.75 (d, J = 9.0 Hz, 2H), 7.56 (d, J = 8.4 Hz, 2H), 7.37 (d, J = 8.4 Hz, 1H), 7.29 (d, J = 8.4 Hz, 2H), 7.15 (s, 1H), 4.15 (s, 2H), 4.11 (s, 2H), 3.09 (s, 3H). ¹³C NMR (CDCl₃, 150 MHz) δ 163.4, 159.9, 147.8, 146.0, 139.9, 139.2, 137.6, 133.4, 129.7, 129.3, 128.9, 127.9, 127.8, 122.2, 44.6, 41.5, 36.4. HRMS-ESI(−) m/z calcd for C₂₃H₁₈NSO₅, 420.0906 [M – H]⁻; found, 420.0891.

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-sulfonamide (20o)

Yield 36% (for two steps from 18o). ¹H NMR (DMSO, 600 MHz) δ 10.21 (br s, 1H), 7.95 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 7.8 Hz, 2H), 7.81 (d, J = 7.8 Hz, 2H), 7.65 (d, J = 8.4 Hz, 2H), 7.38–7.36 (m, 4H), 4.21 (s, 2H), 4.06 (s, 2H). ¹³C NMR (DMSO, 150 MHz) δ 166.7, 162.0, 147.5, 143.5, 143.2, 141.0, 137.1, 135.2, 130.0, 128.5, 128.4, 128.1, 127.7, 127.4, 126.7, 123.6, 40.9, 37.4. HRMS-ESI(−) m/z calcd for C₂₂H₁₇N₂SO₅, 421.0858 [M – H]⁻; found, 421.0851.

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-carboxamide (20p)

Yield 35% (for two steps from 18p). ¹H NMR (DMSO, 600 MHz) δ 7.95 (d, J = 7.8 Hz, 1H), 7.92 (d, J = 8.4 Hz, 2H), 7.71 (d, J = 7.8 Hz, 2H), 7.65 (d, J = 8.4 Hz, 2H), 7.38–7.35 (m, 3H), 7.29 (s, 1H), 4.21 (s, 2H), 4.05 (s, 2H). ¹³C NMR (DMSO, 150 MHz) δ 167.9, 166.7, 162.0, 147.5, 142.8, 140.6, 137.7, 135.4, 133.4, 129.9, 128.5, 128.4, 128.1, 127.6, 127.5, 126.7, 125.9, 123.6, 40.9, 37.3. HRMS-ESI(−) m/z calcd for C₂₃H₁₇N₂O₄, 385.1188 [M – H]⁻; found, 385.1173.

6-((2′,4′-Difluoro-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20q)

Yield 42% (for two steps from 18q). ¹H NMR (CDCl₃, 600 MHz) δ 8.08 (d, J = 7.8 Hz, 1H), 7.38 (d, J = 8.4 Hz, 2H), 7.31–7.29 (m, 2H), 7.17 (d, J = 7.8 Hz, 2H), 7.08 (s, 1H), 6.88–6.82 (m, 2H), 4.08 (s, 2H), 4.02 (s, 2H). ¹³C NMR (CDCl₃, 150 MHz) δ 163.5, 160.0, 148.1, 138.7, 133.4, 133.3, 131.3, 129.3, 129.2, 129.0, 127.8, 126.7, 122.1, 111.7, 111.5, 104.4, 41.6, 36.4. HRMS-ESI(−) m/z calcd for C₂₂H₁₄F₂NO₂, 378.0942 [M – H]⁻; found, 378.0929.

6-((2′,4′-Bis(trifluoromethyl)-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20r)

Yield 39% (for two steps from 18r). ¹H NMR (CDCl₃, 600 MHz) δ 8.10 (d, J = 7.8 Hz, 1H), 7.93 (s, 1H), 7.75 (d, J = 8.4 Hz, 1H), 7.40 (d, J = 7.8 Hz, 1H), 7.31 (d, J = 7.8 Hz, 1H), 7.20 (d, J = 8.4 Hz, 2H), 7.16 (d, J = 8.4 Hz, 2H), 7.09 (s, 1H), 4.10 (s, 2H), 4.05 (s, 2H). ¹³C NMR (CDCl₃, 150 MHz) δ 163.5, 160.0, 147.9, 144.6, 139.4, 136.8, 133.4, 132.8, 129.9, 129.2, 129.1, 129.0, 128.6, 128.5, 128.2, 128.1, 127.9, 123.4, 122.2, 41.6, 36.4. HRMS-ESI(−) m/z calcd for C₂₄H₁₄F₆NO₃, 478.0878 [M – H]⁻; found, 478.0874.

6-((3′-Fluoro-4′-methoxy-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20s)

Yield 41% (for two steps from 18s). ¹H NMR (CDCl₃, 600 MHz) δ 8.14 (d, J = 7.2 Hz, 1H), 7.48 (d, J = 7.2 Hz, 2H), 7.36 (d, J = 7.2 Hz, 1H), 7.31–7.26 (m, 3H), 7.22 (d, J = 7.2 Hz, 2H), 7.01 (t, J = 8.4 Hz, 1H), 4.14 (s, 2H), 4.07 (s, 2H), 3.92 (s, 3H). ¹³C NMR (CDCl₃, 150 MHz) δ 160.2, 153.4, 148.3, 138.2, 133.8, 133.3, 129.4, 129.2, 128.9, 127.8, 127.1, 122.5, 120.0, 114.7, 113.7, 56.4, 41.5, 36.4. HRMS-ESI(−) m/z calcd for C₂₃H₁₇FNO₄, 390.1142 [M – H]⁻; found, 390.1130.

4-(4-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)phenyl)pyridin-1-ium 4-methylbenzenesulfonate (20t)

Yield 49% (for two steps from 18t). ¹H NMR (CDCl₃, 600 MHz) δ 8.92 (d, J = 6.0 Hz, 2H), 8.37 (d, J = 6.0 Hz, 2H), 7.98–7.94 (m, 3H), 7.52 (d, J = 7.8 Hz, 2H), 7.46 (d, J = 7.8 Hz, 2H), 7.39 (d, J = 8.4 Hz, 1H), 7.30 (s, 1H), 7.09 (d, J = 7.8 Hz, 2H), 4.20 (s, 2H), 4.13 (s, 2H), 2.26 (s, 3H). ¹³C NMR (CDCl₃, 150 MHz) δ 166.7, 162.0, 155.7, 146.9, 146.2, 144.9, 142.8, 138.0, 135.4, 132.7, 130.5, 128.8, 128.6, 128.5, 128.4, 128.2, 125.9, 123.9, 123.7, 40.9, 37.4, 21.2. HRMS-ESI(−) m/z calcd for C₂₁H₁₅N₂O₃, 343.1083 [M – H]⁻; found, 343.1070.

Biology

Reagents

Biologicals

Recombinant HIV-1 reverse transcriptase (RT) was expressed and purified as previously described. (42) The catalytically active RNase H domain fragment of HIV-1 RT was expressed from plasmid pCSR231 (a generous gift from Dr. Daria Hazuda, Merck, West Point, PA) and purified as previously described. (43) P4R5 HIV infection indicator cells were obtained from the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH (p4R5.MAGI from Dr. Nathaniel Landau). These cells express CD4, CXCR4, and CCR5 as well as a β-galactosidase reporter gene under the control of an HIV LTR promoter.

The Escherichia coli RNase H plasmid pSM101 was obtained from Dr. Susan Marqusee (University of California Berkeley) and E. coli RNase H was expressed and purified as previously described. (44) Recombinant Moloney Murine Leukemia Virus (MoMLV) reverse transcriptase (RT) was expressed and purified as previously described. (45)

Chemicals

DNA and RNA oligonucleotides for the preparation of RNA/DNA duplexes for assay of RNase H activity were purchased from Trilink (San Diego, CA).

RNase H Assay

RNase H activity was measured essentially as previously described. (32) Three different RNA/DNA duplex substrates were used, each assessing a different mode of RNase H cleavage. HTS-1 (RNA 5′-gaucugagccugggagcu-3′–fluorescein annealed to DNA 3′-CTAGACTCGGACCCTCGA-5–Dabcyl) is a high sensitivity duplex that assesses nonspecific internal cleavage. HTS-2 (RNA 5′-cugguuagaccagaucugagccugggagcu-3′–fluorescein annealed to DNA 3′-GGTCTAGACTCGGACCCTCGA-5′–Dabcyl) provides a duplex with a recessed DNA 3′-terminus and measures 3′-DNA directed or polymerase directed RNase H cleavage. HTS-3 (RNA 5′-accagaucugagccugggagcu-3–fluorescein annealed to DNA 3′-GACCAATCTGGTCTAGACTCGGACCCTCGA-5′–Dabcyl) measures 5′-RNA-directed RNase H cleavage.

For E. coli RNase H assays, 4 nM of enzyme was incubated with 6 mM MgCl₂ and 1, 7, or 30 μM inhibitor (final concentration of DMSO was 2%) in 50 mM Tris pH 7.8, 50 mM NaCl for 10 min at room temperature before initiation of the reaction by addition of 100 nM HTS-1 RNA/DNA substrate. Reactions were carried out at 37 °C and were stopped after 5 min by the addition of EDTA at a final concentration of 33 mM. For MoMLV RT RNase H assays, 20 nM enzyme was incubated with 1 mM MnCl₂ and 1, 7, or 30 μM inhibitor (final concentration of DMSO was 2%) in 50 mM Tris pH 7.8, 60 mM KCl, 0.1 mg/mL BSA, 0.01% NP-40, and 1 mM DTT for 10 min at room temperature before initiation of the reaction by addition of 100 nM HTS-1 RNA/DNA substrate. Reactions were carried out at 37 °C and were stopped after 15 min by the addition of EDTA at a final concentration of 33 mM. Fluorescence signals were measured 485/528 nm excitation/emission wavelengths in an EnSpire multimode plate reader (PerkinElmer, Waltham, MA). The results were plotted using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA), and 50% inhibitory concentrations (IC₅₀s) were obtained at midpoint concentrations. (46) Duplicate reactions were performed in at least two independent experiments.

RT Polymerase Assay

HIV RT polymerase activity was determined in the presence and the absence of inhibitor using 10 μM [³H]-TTP and 40 nM poly(rA)-oligo(dT)16 (both obtained from PerkinElmer, Waltham, MA) in 50 mM Tris-HCl, pH 7.4 (37 °C) containing 60 mM KCl and 5 mM MgCl₂. Reactions were initiated by the addition of 10 nM WT or mutant RT and carried out for 20 min at 37 °C. Reactions were quenched by 200 μL od ice-cold 10% TCA containing 20 mM sodium pyrophosphate and filtered using a 1.2 μm glass fiber filter 96-well plates (Millipore, Billerica, MA), followed by sequentially washing with 10% TCA and ethanol. The extent of radionucleotide incorporation was determined by liquid scintillation spectrometry.

For MoMLV RT polymerase assays, a 100 nt template DNA (5′-ATGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAATATCTCATAGCTTGGCGCCCGAACAGGGAC) was annealed in an equimolar amount to an 18 nt DNA primer (5′-GTCCCTGTTCGGGCGCCA) to yield a T_d100/P_d18 DNA–DNA substrate as previously described. (47) Reactions containing 20 nM MoMLV RT, 40 nM T_d100/P_d18 DNA/DNA substrate, 50 μM dNTPs, 0.5 mM EDTA, 1 mM MnCl₂, and 1, 7, or 30 μM inhibitor (final concentration of DMSO was 2%) in 50 mM Tris pH 7.8, 60 mM KCl, 0.1 mg/mL BSA, 0.01% NP-40, and 1 mM DTT were incubated for 30 min at 37 °C. All reactions were quenched by the addition of 50 μL of 100 mM EDTA and 2× QuantiFluor dsDNA reagent (Promega, Madison, WI) to quantify the amount of dsDNA in solution. Fluorescence signals were measured 504/531 nm excitation/emission wavelengths in an EnSpire multimode plate reader. The results were plotted using GraphPad Prism 5, and 50% inhibitory concentrations (IC₅₀s) were obtained at midpoint concentrations. (46) Duplicate reactions were performed in at least two independent experiments.

HIV IN Assay

HIV integrase was expressed and purified as previously reported. (48) Inhibition assays were performed using a modified protocol of our reported method. (48) Briefly, 2.1 μL of compound suspended in DMSO was placed in duplicate into a Black 96-well nonbinding plate (corning 3991). Compounds were plated in duplicate to a final concentration of 0.13—100 μM. To each well of the plate 186.9 μL of reaction mixture without DNA substrate was added (10 mM HEPES pH 7.5, 10% glycerol w/v, 10 mM MnCl2, 1 mM DTT, 1 μM integrase). The enzyme was incubated with inhibitor for 10 min at 25 °C, after which the reaction was initiated by the addition of 21 μL of 500 nM oligo (5′ biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3′ Cy5). Reactions were incubated at 37 °C for 30 min and then quenched by the addition of 5.2 μL of 500 mM EDTA. Each reaction was moved (200 μL) to a MultiScreen HTS PCR plate (Millipore MSSLBPC10) containing 20 μL of streptavidin agarose beads (Life Technologies S951) and incubated with shaking for 30 min. A vacuum manifold was used to remove the reaction mixture, and the beads were similarly washed 3 times with wash buffer (0.05% SDS, 1 mM EDTA in PBS). The plates were further washed 3 times with 200 μL of 50 mM NaOH to denature DNA not covalently linked to the biotin modification. For each denaturation step, the plate was incubated with shaking at 25 °C for 5 min, and the NaOH was removed by centrifugation at 1000g for 1 min. The reaction products were eluted from the beads by the addition of 150 μL of formamide. The plate was incubated at 25 °C for 10 min and read directly at 635/675 in a SpectraMax i3 plate reader (Molecular Devices).

Antiviral Assays

Antiviral assays were carried out using P4R5 indicator cells essentially as previously described. (49) P4R5 cells were cultured in 96-well microplates (5 × 10³ cells per well and maintained in DMEM/10% FBS supplemented with puromycin (0.5 μg/mL)). Cells were incubated in the presence or the absence of drug for 16 h then exposed to HIV followed by an additional incubation period of 48 h. The extent of infection was assessed using a fluorescence-based β-galactosidase detection assay, as previously described. (37)

Modeling and Docking

Molecular modeling was performed using the Schrodinger small molecule Drug Discovery Suite 2013-2. The crystal structure of full length RT cocrystallized with napthyridinone-based scaffold MK2 (PDB code: 3LP1) was obtained from Protein Data Bank (50) as reported by Munsi et al. (39) The above RT structure was subjected to analysis and found that the native ligand MK2 was bound to the active site of RNase H, which is ∼50 Å from the NNRTI site. This model was subjected to Protein Preparation Wizard (51, 52) (Schrodinger Inc.) in which missing hydrogens atoms were added, zero-order bonds to metals were created followed by the generation of metal binding states. The structure of protein was minimized using OPLS 2005 force field (53) to optimize hydrogen bonding network and converge heavy atoms to the RMSD of 0.3 Å. The processed model indicates that the interaction between the naphthyridinone and RNase H is mediated by two metals cations (Mn²⁺) coordinated by the active site residues D443, E478, D498, and D549.

The receptor grid generation tool in Maestro (Schrodinger Inc.) (54) was used to define an active site around the MK2 ligand to cover all the residues within 12 Å from it with both the metal cofactors (Mn²⁺) as a constraint to identify the chelating triad during docking. The ligands compounds 7 and 20i were drawn using Maestro and subjected to Lig Prep (55) to generate conformers, possible protonation at pH of 7 ± 3 and metal binding states which serves as an input for docking process. All the dockings were performed using Glide XP (40) (Glide, version 6.0) mode with both the Mn²⁺ metal cofactors as a constraint. The van der Waals radii of nonpolar atoms for each of the ligands were scaled by a factor of 0.8. The predicted highly scored binding mode of both the compounds 7 and 20i features the critical interaction between the chelating triad to the divalent metal cofactors, suggesting a possible conformation. All the ligands within the active site of RNase H were further refined post docking by minimizing under implicit solvent to account for the local protein flexibility.

Supporting Information

Click to copy section linkSection link copied!

Characterization data, including ¹H NMR, ¹³C NMR, and HRMS data, of all intermediates. This material is available free of charge via the Internet at http://pubs.acs.org.

jm501132s_si_001.pdf (171.73 kb)

Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Author Information

Click to copy section linkSection link copied!

Corresponding Author
- Zhengqiang Wang - Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, PWB 7-224, MMC 204 Minneapolis, Minnesota 55455, United States; Email: [email protected]
Authors
- Sanjeev Kumar V. Vernekar - Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, PWB 7-224, MMC 204 Minneapolis, Minnesota 55455, United States
- Zheng Liu - Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, PWB 7-224, MMC 204 Minneapolis, Minnesota 55455, United States
- Eva Nagy - Department of Microbiology & Molecular Genetics, University of Pittsburgh School of Medicine, 450 Technology Drive, Pittsburgh, Pennsylvania 15219, United States
- Lena Miller - Department of Microbiology & Molecular Genetics, University of Pittsburgh School of Medicine, 450 Technology Drive, Pittsburgh, Pennsylvania 15219, United States
- Karen A. Kirby - Department of Molecular Microbiology and Immunology and Department of Biochemistry, University of Missouri School of Medicine, Christopher S. Bond Life Sciences Center, Columbia, Missouri 65211, United States
- Daniel J. Wilson - Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, PWB 7-224, MMC 204 Minneapolis, Minnesota 55455, United States
- Jayakanth Kankanala - Center for Drug Design, Academic Health Center, University of Minnesota, 516 Delaware Street SE, PWB 7-224, MMC 204 Minneapolis, Minnesota 55455, United States
- Stefan G. Sarafianos - Department of Molecular Microbiology and Immunology and Department of Biochemistry, University of Missouri School of Medicine, Christopher S. Bond Life Sciences Center, Columbia, Missouri 65211, United States
- Michael A. Parniak - Department of Microbiology & Molecular Genetics, University of Pittsburgh School of Medicine, 450 Technology Drive, Pittsburgh, Pennsylvania 15219, United States
Notes
The authors declare no competing financial interest.

Acknowledgment

Click to copy section linkSection link copied!

This research was supported in part by the National Institutes of Health (AI100890 to S.G.S., M.A.P., and Z.W.), and by the Research Development and Seed Grant Program of the Center for Drug Design, University of Minnesota.

Abbreviations Used

Click to copy section linkSection link copied!

RT	reverse transcriptase
HIV	human immunodeficiency virus
RNase H	ribonuclease H
HID	2-hydroxyisoquinoline-1,3-dione
IN	integrase
NRTIs	nucleoside RT inhibitors
NNRTIs	nonnucleoside RT inhibitors
WT	wild-type
DMF	N,N-dimethylformamide
PPTS	pyridinium p-toluenesulfonate
THP	tetrahydropyran
p-TSA	p-toluenesulfonic acid
SAR	structure–activity relationship
RISF	retroviral integrase superfamily
ST	strand transfer

References

Click to copy section linkSection link copied!

This article references 55 other publications.

1
AIDSinfo; UNAIDS: Geneva 2013; http://www.unaids.org/en/dataanalysis/datatools/aidsinfo/.
Google Scholar
There is no corresponding record for this reference.
2
Barouch, D. H. Challenges in the development of an HIV-1 vaccine Nature 2008, 455, 613– 619
Google Scholar
There is no corresponding record for this reference.
3
Schiffner, T.; Sattentau, Q. J.; Dorrell, L. Development of prophylactic vaccines against HIV-1 Retrovirology 2013, 10, 72
Google Scholar
There is no corresponding record for this reference.
4
Zhang, J.; Crumpacker, C. Eradication of HIV and Cure of AIDS, Now and How? Front. Immunol. 2013, 4, 337
Google Scholar
4
Eradication of HIV and Cure of AIDS, Now and How?
Zhang Jielin; Crumpacker Clyde
Frontiers in immunology (2013), 4 (), 337 ISSN:1664-3224.
Recent studies have highlighted the importance of eradication of human immunodeficiency virus (HIV) and cure of acquired immunodeficiency syndrome (AIDS). However, a pivotal point that the patient immunity controls HIV reactivation after highly active anti-retroviral therapy [HAART or combination anti-retroviral therapy (cART)] remains less well addressed. In spite of the fact that both innate and adaptive immunities are indispensable and numerous cells participate in the anti-HIV immunity, memory CD4 T-cells are indisputably the key cells organizing all immune actions against HIV while being the targets of HIV. Here we present a view and multidisciplinary approaches to HIV/AIDS eradication and cure. We aim at memory CD4 T-cells, utilizing the stem cell properties of these cells to reprogram an anti-HIV memory repertoire to eliminate the viral reservoir, toward achieving an AIDS-free world.
5
Siliciano, J. D.; Siliciano, R. F. HIV-1 eradication strategies: design and assessment Curr. Opin. HIV AIDS 2013, 8, 318– 325
Google Scholar
5
HIV-1 eradication strategies: design and assessment
Siliciano Janet D; Siliciano Robert F
Current opinion in HIV and AIDS (2013), 8 (4), 318-25 ISSN:.
PURPOSE OF REVIEW: Recent developments have generated renewed interest in the possibility of curing HIV-1 infection. This review describes some of the practical challenges that will need to be overcome if curative strategies are to be successful. RECENT FINDINGS: The latent reservoir for HIV-1 in resting memory CD4 T cells is the major barrier to curing the infection. The most widely discussed approach to curing the infection involves finding agents that reverse latency in resting CD4 T cells, with the assumption that the cells will then die from viral cytopathic effects or be lysed by host cytolytic T lymphocytes (CTLs). A major challenge is the development of in-vitro models that can be used to explore mechanisms and identify latency-reversing agents (LRAs). Although several models have been developed, including primary cell models, none of them may fully capture the quiescent state of the cells that harbour latent HIV-1 in vivo. An additional problem is that LRAs that do not cause T-cell activation may not lead to the death of infected cells. Finally, measuring the effects of LRAs in vivo is complicated by the lack of correlation between different assays for the latent reservoir. SUMMARY: Progress on these practical issues is essential to finding a cure.
6
Xing, S.; Siliciano, R. F. Targeting HIV latency: pharmacologic strategies toward eradication Drug Discovery Today 2013, 18, 541– 551
Google Scholar
There is no corresponding record for this reference.
7
Beilhartz, G. L.; Gotte, M. HIV-1 Ribonuclease H: Structure, Catalytic Mechanism and Inhibitors Viruses 2010, 2, 900– 926
Google Scholar
7
HIV-1 ribonuclease H: structure, catalytic mechanism and inhibitors
Beilhartz, Greg L.; Gotte, Matthias
Viruses (2010), 2 (), 900-926CODEN: VIRUBR; ISSN:1999-4915. (Molecular Diversity Preservation International)
A review. Since the human immunodeficiency virus (HIV) was discovered as the etiol. agent of acquired immunodeficiency syndrome (AIDS), it has encouraged much research into antiviral compds. The reverse transcriptase (RT) of HIV has been a main target for antiviral drugs. However, all drugs developed so far inhibit the polymerase function of the enzyme, while none of the approved antiviral agents inhibit specifically the necessary RNase H (RNase H) function of RT. This review provides a background on structure-function relationships of HIV-1 RNase H, as well as an outline of current attempts to develop novel, potent chemotherapeutics against a difficult drug target.
8
Sarafianos, S. G.; Marchand, B.; Das, K.; Himmel, D. M.; Parniak, M. A.; Hughes, S. H.; Arnold, E. Structure and function of HIV-1 reverse transcriptase: molecular mechanisms of polymerization and inhibition J. Mol. Biol. 2009, 385, 693– 713
Google Scholar
8
Structure and function of HIV-1 reverse transcriptase: Molecular mechanisms of polymerization and inhibition
Sarafianos, Stefan G.; Marchand, Bruno; Das, Kalyan; Himmel, Daniel M.; Parniak, Michael A.; Hughes, Stephen H.; Arnold, Eddy
Journal of Molecular Biology (2009), 385 (3), 693-713CODEN: JMOBAK; ISSN:0022-2836. (Elsevier Ltd.)
A review. The rapid replication of the HIV-1 virus and errors made during viral replication cause the virus to evolve rapidly in patients, making the problems of vaccine development and drug therapy particularly challenging. In the absence of an effective vaccine, drugs are the only useful treatment. Anti-HIV drugs work; so far drug therapy has saved more than 3 × 106 yr of life. Unfortunately, HIV-1 virus develops resistance to all of the available drugs. Although a no. of useful anti-HIV drugs have been approved for use in patients, the problems assocd. with drug toxicity and the development of resistance means that the search for new drugs is an ongoing process. The 3 viral enzymes, reverse transcriptase (RT), integrase (IN), and protease (PR) are all good drug targets. Two distinct types of RT inhibitors, both of which block the polymerase activity of RT, have been approved to treat HIV-1 infections, nucleoside analogs (NRTIs) and non-nucleosides (NNRTIs), and there are promising leads for compds. that either block the RNase H activity or block the polymerase in other ways. A better understanding of the structure and function(s) of RT and of the mechanism(s) of inhibition can be used to generate better drugs; in particular, drugs that are effective against the current drug-resistant strains of HIV-1.
9
Cihlar, T.; Ray, A. S. Nucleoside and nucleotide HIV reverse transcriptase inhibitors: 25 years after zidovudine Antiviral Res. 2010, 85, 39– 58
Google Scholar
9
Nucleoside and nucleotide HIV reverse transcriptase inhibitors: 25 years after zidovudine
Cihlar, Tomas; Ray, Adrian S.
Antiviral Research (2010), 85 (1), 39-58CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)
A review. Twenty-five years ago, nucleoside analog 3'-azidothymidine (AZT) was shown to efficiently block the replication of HIV in cell culture. Subsequent studies demonstrated that AZT acts via the selective inhibition of HIV reverse transcriptase (RT) by its triphosphate metabolite. These discoveries have established the first class of antiretroviral agents: nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs). Over the years that followed, NRTIs evolved into the main component of antiretroviral drug combinations that are now used for the treatment of all populations of HIV infected patients. A total of thirteen NRTI drug products are now available for clin. application: eight individual NRTIs, four fixed-dose combinations of two or three NRTIs, and one complete fixed-dose regimen contg. two NRTIs and one non-nucleoside RT inhibitor. Multiple NRTIs or their prodrugs are in various stages of clin. development and new potent NRTIs are still being identified through drug discovery efforts. This article will review basic principles of the in vitro and in vivo pharmacol. of NRTIs, discuss their clin. use including limitations assocd. with long-term NRTI therapy, and describe newly identified NRTIs with promising pharmacol. profiles highlighting those in the development pipeline. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010.
10
de Bethune, M. P. Non-nucleoside reverse transcriptase inhibitors (NNRTIs), their discovery, development, and use in the treatment of HIV-1 infection: a review of the last 20 years (1989–2009) Antiviral Res. 2010, 85, 75– 90
Google Scholar
There is no corresponding record for this reference.
11
Corona, A.; Masaoka, T.; Tocco, G.; Tramontano, E.; Le Grice, S. F. Active site and allosteric inhibitors of the ribonuclease H activity of HIV reverse transcriptase Future Med. Chem. 2013, 5, 2127– 2139
Google Scholar
11
Active site and allosteric inhibitors of the ribonuclease H activity of HIV reverse transcriptase
Corona, Angela; Masaoka, Takashi; Tocco, Graziella; Tramontano, Enzo; Le Grice, Stuart FJ
Future Medicinal Chemistry (2013), 5 (18), 2127-2139CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)
A review. Despite the wealth of information available for the reverse transcriptase (RT)-assocd. RNase H (RNaseH) domain of lentiviruses, gamma-retroviruses and long terminal repeat contg. retrotransposons, exploiting this information in the form of an RNaseH inhibitor with high specificity and low cellular toxicity has been disappointing. However, it is now becoming increasingly evident that the two-subunit HIV-1 RT is a highly versatile enzyme, undergoing major structural alterations in order to interact with, position and ultimately hydrolyze the RNA component of an RNA/DNA hybrid. Thus, in addn. to targeting the RNaseH active site, identifying small mols. that bind elsewhere and disrupt catalysis allosterically by impairing conformational flexibility is gaining increased attention. This review summarizes current progress towards development of both active site and allosteric RNaseH inhibitors.
12
Ilina, T.; Labarge, K.; Sarafianos, S. G.; Ishima, R.; Parniak, M. A. Inhibitors of HIV-1 Reverse Transcriptase-Associated Ribonuclease H Activity Biology (Basel, Switzerland) 2012, 1, 521– 541
Google Scholar
12
Inhibitors of HIV-1 reverse transcriptase - associated ribonuclease H activity
Ilina, Tatiana; LaBarge, Krystal; Sarafianos, Stefan G.; Ishima, Rieko; Parniak, Michael A.
Biology (Basel, Switzerland) (2012), 1 (3), 521-541CODEN: BBSIBX; ISSN:2079-7737. (MDPI AG)
A review. HIV-1 enzyme reverse transcriptase (RT) is a major target for antiviral drug development, with over half of current FDA-approved therapeutics against HIV infection targeting the DNA polymerase activity of this enzyme. HIV-1 RT is a multifunctional enzyme that has RNA and DNA dependent polymerase activity, along with RNase H (RNase H) activity. The latter is responsible for degrdn. of the viral genomic RNA template during first strand DNA synthesis to allow completion of reverse transcription and the viral dsDNA. While the RNase H activity of RT has been shown to be essential for virus infectivity, all currently used drugs directed at RT inhibit the polymerase activity of the enzyme; none target RNase H. In the last decade, the increasing prevalence of HIV variants resistant to clin. used antiretrovirals has stimulated the search for inhibitors directed at stages of HIV replication different than those targeted by current drugs. HIV RNase H is one such novel target and, over the past few years, significant progress has been made in identifying and characterizing new RNase H inhibitor pharmacophores. In this review we focus mainly on the most potent low micromolar potency compds., as these provide logical bases for further development. We also discuss why HIV RNase H has been a difficult target for antiretroviral drug development.
13
Klumpp, K.; Hang, J. Q.; Rajendran, S.; Yang, Y. L.; Derosier, A.; In, P. W. K.; Overton, H.; Parkes, K. E. B.; Cammack, N.; Martin, J. A. Two-metal ion mechanism of RNA cleavage by HIV RNase H and mechanism-based design of selective HIV RNase H inhibitors Nucleic Acids Res. 2003, 31, 6852– 6859
Google Scholar
13
Two-metal ion mechanism of RNA cleavage by HIV RNase H and mechanism-based design of selective HIV RNase H inhibitors
Klumpp, Klaus; Hang, Julie Qi; Rajendran, Surendran; Yang, Yanli; Derosier, Andre; In, Philippe Wong Kai; Overton, Hilary; Parkes, Kevin E. B.; Cammack, Nick; Martin, Joseph A.
Nucleic Acids Research (2003), 31 (23), 6852-6859CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)
Human immunodeficiency virus (HIV) RNase H activity is essential for the synthesis of viral DNA by HIV reverse transcriptase (HIV-RT). RNA cleavage by RNase H requires the presence of divalent metal ions, but the role of metal ions in the mechanism of RNA cleavage has not been resolved. We measured HIV RNase H activity assocd. with HIV-RT protein in the presence of different concns. of either Mg2+, Mn2+, Co2+ or a combination of these divalent metal ions. Polymerase-independent HIV RNase H was similar to or more active with Mn2+ and Co2+ compared with Mg2+. Activation of RNase H by these metal ions followed sigmoidal dose-response curves suggesting cooperative metal ion binding. Titrn. of Mg2+-bound HIV RNase H with Mn2+ or Co2+ ions generated bell-shaped activity dose-response curves. Higher activity could be achieved through simultaneous binding of more than one divalent metal ion at intermediate Mn2+ and Co2+ concns., and complete replacement of Mg2+ occurred at higher Mn2+ or Co2+ concns. These results are consistent with a two-metal ion mechanism of RNA cleavage as previously suggested for a no. of polymerase-assocd. nucleases. In contrast, the structurally highly homologous RNase HI from Escherichia coli is most strongly activated by Mg2+, is significantly inhibited by submillimolar concns. of Mn2+ and most probably cleaves RNA via a one-metal ion mechanism. Based on this difference in active site structure, a series of small mol. N-hydroxyimides was identified with significant enzyme inhibitory potency and selectivity for HIV RNase H.
14
Himmel, D. M.; Sarafianos, S. G.; Dharmasena, S.; Hossain, M. M.; McCoy-Simandle, K.; Ilina, T.; Clark, A. D.; Knight, J. L.; Julias, J. G.; Clark, P. K.; Krogh-Jespersen, K.; Levy, R. M.; Hughes, S. H.; Parniak, M. A.; Arnold, E. HIV-1 reverse transcriptase structure with RNase H inhibitor dihydroxy benzoyl naphthyl hydrazone bound at a novel site ACS Chem. Biol. 2006, 1, 702– 712
Google Scholar
14
HIV-1 Reverse Transcriptase Structure with RNase H Inhibitor Dihydroxy Benzoyl Naphthyl Hydrazone Bound at a Novel Site
Himmel, Daniel M.; Sarafianos, Stefan G.; Dharmasena, Sanjeewa; Hossain, Mohammed M.; McCoy-Simandle, Kessler; Ilina, Tatiana; Clark, Arthur D., Jr.; Knight, Jennifer L.; Julias, John G.; Clark, Patrick K.; Krogh-Jespersen, Karsten; Levy, Ronald M.; Hughes, Stephen H.; Parniak, Michael A.; Arnold, Eddy
ACS Chemical Biology (2006), 1 (11), 702-712CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)
The rapid emergence of drug-resistant variants of human immunodeficiency virus, type 1 (HIV-1), has limited the efficacy of anti-acquired immune deficiency syndrome (AIDS) treatments, and new lead compds. that target novel binding sites are needed. The authors have detd. the 3.15 Å resoln. crystal structure of HIV-1 reverse transcriptase (RT) complexed with dihydroxy benzoyl naphthyl hydrazone (DHBNH), an HIV-1 RT RNase H (RNH) inhibitor (RNHI). DHBNH is effective against a variety of drug-resistant HIV-1 RT mutants. While DHBNH has little effect on most aspects of RT-catalyzed DNA synthesis, at relatively high concns. it does inhibit the initiation of RNA-primed DNA synthesis. Although primarily an RNHI, DHBNH binds >50 Å away from the RNH active site, at a novel site near both the polymerase active site and the nonnucleoside RT inhibitor (NNRTI) binding pocket. When DHBNH binds, both Tyr181 and Tyr188 remain in the conformations seen in unliganded HIV-1 RT. DHBNH interacts with conserved residues (Asp186, Trp229) and has substantial interactions with the backbones of several less well-conserved residues. On the basis of this structure, the authors designed substituted DHBNH derivs. that interact with the NNRTI-binding pocket. These compds. inhibit both the polymerase and RNH activities of RT.
15
Fuji, H.; Urano, E.; Futahashi, Y.; Hamatake, M.; Tatsumi, J.; Hoshino, T.; Morikawa, Y.; Yamamoto, N.; Komano, J. Derivatives of 5-nitro-furan-2-carboxylic acid carbamoylmethyl ester inhibit RNase H activity associated with HIV-1 reverse transcriptase J. Med. Chem. 2009, 52, 1380– 1387
Google Scholar
There is no corresponding record for this reference.
16
Tramontano, E.; Esposito, F.; Badas, R.; Di Santo, R.; Costi, R.; La Colla, P. 6-[1-(4-Fluorophenyl)methyl-1H-pyrrol-2-yl)]-2,4-dioxo-5-hexenoic acid ethyl ester a novel diketo acid derivative which selectively inhibits the HIV-1 viral replication in cell culture and the ribonuclease H activity in vitro Antiviral Res. 2005, 65, 117– 124
Google Scholar
16
6-[1-(4-Fluorophenyl)methyl-1H-pyrrol-2-yl]-2,4-dioxo-5-hexenoic acid ethyl ester a novel diketo acid derivative which selectively inhibits the HIV-1 viral replication in cell culture and the ribonuclease H activity in vitro
Tramontano, Enzo; Esposito, Francesca; Badas, Roberta; Di Santo, Roberto; Costi, Roberta; La Colla, Paolo
Antiviral Research (2005), 65 (2), 117-124CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)
The human immunodeficiency virus-type 1 (HIV-1) reverse transcriptase (RT) is a multifunctional enzyme which displays DNA polymerase activity, which recognizes RNA and DNA templates, and a degradative RNase H activity. While both RT functions are required for retroviral replication, until now only the polymerase function has been widely explored as drug target. We have identified a novel diketo acid deriv., 6-[1-(4-fluorophenyl)methyl-1H-pyrrol-2-yl]-2,4-dioxo-5-hexenoic acid Et ester (RDS 1643), which inhibits in enzyme assays the HIV-1 RT-assocd. polymerase-independent RNase H activity but has no effect on the HIV-1 RT-assocd. RNA-dependent DNA polymerase (RDDP) activity and on the RNase H activities displayed by the Avian Myeloblastosis Virus and E. coli. Time-dependence studies revealed that the compd. is active independently on the order of its addn. to the reaction mixt., and inhibition kinetics studies demonstrated that RDS 1643 inhibits the RNase H activity noncompetitively, with a KI value of 17 μM. When RDS 1643 was combined with non-nucleoside RT inhibitors (NNRTI), such as efavirenz and nevirapine, results indicated that RDS 1643 does not affect the NNRTIs anti-RDDP activity and that, vice versa, the NNRTIs do not alter the RNase H inhibition by RDS 1643. When assayed on the viral replication in cell-based assays, RDS 1643 inhibited the HIV-1IIIB strain with an EC50 of 14 μM. Similar results were obtained against the Y181C and Y181C/K103N HIV-1 NNRTI resistant mutant strains. RDS 1643 may be the first HIV-1 inhibitor selectively targeted to the viral RT-assocd. RNase-H function.
17
Lansdon, E. B.; Liu, Q.; Leavitt, S. A.; Balakrishnan, M.; Perry, J. K.; Lancaster-Moyer, C.; Kutty, N.; Liu, X.; Squires, N. H.; Watkins, W. J.; Kirschberg, T. A. Structural and binding analysis of pyrimidinol carboxylic acid and N-hydroxy quinazolinedione HIV-1 RNase H inhibitors Antimicrob. Agents Chemother. 2011, 55, 2905– 2915
Google Scholar
There is no corresponding record for this reference.
18
Williams, P. D.; Staas, D. D.; Venkatraman, S.; Loughran, H. M.; Ruzek, R. D.; Booth, T. M.; Lyle, T. A.; Wai, J. S.; Vacca, J. P.; Feuston, B. P.; Ecto, L. T.; Flynn, J. A.; DiStefano, D. J.; Hazuda, D. J.; Bahnck, C. M.; Himmelberger, A. L.; Dornadula, G.; Hrin, R. C.; Stillmock, K. A.; Witmer, M. V.; Miller, M. D.; Grobler, J. A. Potent and selective HIV-1 ribonuclease H inhibitors based on a 1-hydroxy-1,8-naphthyridin-2(1H)-one scaffold Bioorg. Med. Chem. Lett. 2010, 20, 6754– 6757
Google Scholar
There is no corresponding record for this reference.
19
Gerondelis, P.; Johns, B. A., The development of novel pyrido-pyrimidinone antiretrovirals with selective activity against HIV ribonuclease H. , Cold Spring Harbor Laboratories Conference on Retroviruses, Cold Spring Harbor, NY, May 21–26, 2012; Cold Spring Harbor Press: Cold Spring Harbor, NY, 2012.
Google Scholar
There is no corresponding record for this reference.
20
Beilhartz, G. L.; Ngure, M.; Johns, B. A.; DeAnda, F.; Gerondelis, P.; Gotte, M. Inhibition of the Ribonuclease H Activity of HIV-1 Reverse Transcriptase by GSK5750 Correlates with Slow Enzyme–Inhibitor Dissociation J. Biol. Chem. 2014, 289, 16270– 16277
Google Scholar
There is no corresponding record for this reference.
21
Chen, Y. L.; Tang, J.; Kesler, M. J.; Sham, Y. Y.; Vince, R.; Geraghty, R. J.; Wang, Z. Q. The design, synthesis and biological evaluations of C-6 or C-7 substituted 2-hydroxyisoquinoline-1,3-diones as inhibitors of hepatitis C virus Bioorg. Med. Chem. 2012, 20, 467– 479
Google Scholar
There is no corresponding record for this reference.
22
Billamboz, M.; Bailly, F.; Lion, C.; Calmels, C.; Andreola, M. L.; Witvrouw, M.; Christ, F.; Debyser, Z.; De Luca, L.; Chimirri, A.; Cotelle, P. 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as inhibitors of HIV-1 integrase and reverse transcriptase RNase H domain: influence of the alkylation of position 4 Eur. J. Med. Chem. 2011, 46, 535– 546
Google Scholar
There is no corresponding record for this reference.
23
Billamboz, M.; Suchaud, V.; Bailly, F.; Lion, C.; Demeulemeester, J.; Calmels, C.; Andreola, M. L.; Christ, F.; Debyser, Z.; Cotelle, P. 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors ACS Med. Chem. Lett. 2013, 4, 41– 46
Google Scholar
There is no corresponding record for this reference.
24
Desimmie, B. A.; Demeulemeester, J.; Suchaud, V.; Taltynov, O.; Billamboz, M.; Lion, C.; Bailly, F.; Strelkov, S. V.; Debyser, Z.; Cotelle, P.; Christ, F. 2-Hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs), Novel Inhibitors of HIV Integrase with a High Barrier to Resistance ACS Chem. Biol. 2013, 8, 1187– 1194
Google Scholar
There is no corresponding record for this reference.
25
Suchaud, V.; Bailly, F.; Lion, C.; Calmels, C.; Andréola, M.-L.; Christ, F.; Debyser, Z.; Cotelle, P. Investigation of a Novel Series of 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as Human Immunodeficiency Virus Type 1 Integrase Inhibitors J. Med. Chem. 2014, 57, 4640– 4660http://dx.doi.org/10.1021/jm500109z
Google Scholar
There is no corresponding record for this reference.
26
Billamboz, M.; Bailly, F.; Lion, C.; Touati, N.; Vezin, H.; Calmels, C.; Andreola, M. L.; Christ, F.; Debyser, Z.; Cotelle, P. Magnesium Chelating 2-Hydroxyisoquinoline-1,3(2H,4H)-diones, as Inhibitors of HIV-1 Integrase and/or the HIV-1 Reverse Transcriptase Ribonuclease H Domain: Discovery of a Novel Selective Inhibitor of the Ribonuclease H Function J. Med. Chem. 2011, 54, 1812– 1824
Google Scholar
26
Magnesium Chelating 2-Hydroxyisoquinoline-1,3(2H,4H)-diones, as Inhibitors of HIV-1 Integrase and/or the HIV-1 Reverse Transcriptase Ribonuclease H Domain: Discovery of a Novel Selective Inhibitor of the Ribonuclease H Function
Billamboz, Muriel; Bailly, Fabrice; Lion, Cedric; Touati, Nadia; Vezin, Herve; Calmels, Christina; Andreola, Marie-Line; Christ, Frauke; Debyser, Zeger; Cotelle, Philippe
Journal of Medicinal Chemistry (2011), 54 (6), 1812-1824CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
2-Hydroxyisoquinoline-1,3(2H,4H)-dione was recently discovered as a scaffold for the inhibition of HIV-1 integrase and the RNase H function of HIV-1 reverse transcriptase. First, we investigate its interaction with Mg2+ and Mn2+ using different spectroscopic techniques and report that 2-hydroxyisoquinoline-1,3(2H,4H)-dione forms a 1:1 complex with Mg2+ but a 1:2 complex with Mn2+. The complex formation requires enolization of the ligand. ESR spectroscopy shows a redox reaction between the ligand and Mn2+ producing superoxide anions. Second, 2-hydroxyisoquinoline-1,3(2H,4H)-dione, its magnesium complex, and its 4-Me and 2-hydroxy-4-methoxycarbonylisoquinoline-1,3(2H,4H)-diones were tested as inhibitors of HIV-1 integrase, reverse transcriptase RNase H, and DNA polymerase functions. Their antiviral activities were evaluated and 2-hydroxy-4-methoxycarbonyl-isoquinoline-1,3(2H,4H)-dione was found to inhibit the viral replication of HIV-1 in MT-4 cells. Cross-resistance was measured for this compd. on three different viral strains. Exptl. data suggest that the antiviral activity of 2-hydroxy-4-methoxycarbonylisoquinoline-1,3(2H,4H)-dione is probably due to the RNase H inhibition.
27
Billamboz, M.; Bailly, F.; Barreca, M. L.; De Luca, L.; Mouscadet, J. F.; Calmels, C.; Andreola, M. L.; Witvrouw, M.; Christ, F.; Debyser, Z.; Cotelle, P. Design, Synthesis, and Biological Evaluation of a Series of 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as Dual Inhibitors of Human Immunodeficiency Virus Type 1 Integrase and the Reverse Transcriptase RNase H Domain J. Med. Chem. 2008, 51, 7717– 7730
Google Scholar
There is no corresponding record for this reference.
28
Barluenga, J.; Tomas-Gamasa, M.; Aznar, F.; Valdes, C. Metal-free carbon–carbon bond-forming reductive coupling between boronic acids and tosylhydrazones Nature Chem. 2009, 1, 494– 499
Google Scholar
28
Metal-free carbon-carbon bond-forming reductive coupling between boronic acids and tosylhydrazones
Barluenga, Jose; Tomas-Gamasa, Maria; Aznar, Fernando; Valdes, Carlos
Nature Chemistry (2009), 1 (6), 494-499, S494/1-S494/46CODEN: NCAHBB; ISSN:1755-4330. (Nature Publishing Group)
The formation of carbon-carbon bonds is a fundamental transformation in org. synthesis. In spite of the myriad methods available, advantageous methodologies in terms of selectivity, availability of starting materials, operational simplicity, functional-group tolerance, environmental sustainability and economy are in const. demand. In this context, the development of new cross-coupling reactions that use catalysts based on inexpensive and non-toxic metals is attracting increasing attention. Similarly, efficient processes that do not require a metal catalyst are of extraordinary interest. Here, we report a new and efficient metal-free carbon-carbon bond-forming coupling between tosylhydrazones and boronic acids. This reaction is very general and functional-group tolerant. As the required tosylhydrazones are easily generated from carbonyl compds., it can be seen as a reductive coupling of carbonyls, a process of high synthetic relevance that requires several steps using other methodologies.
29
Vanrheenen, V.; Cha, D. Y.; Hartley, W. M. Catalytic Osmium-Tetroxide Oxidation of Olefins—cis-1,2-Cyclohexanediol Org. Synth. 1988, 50–9, 342– 348
Google Scholar
There is no corresponding record for this reference.
30
Vanrheenen, V.; Kelly, R. C.; Cha, D. Y. Improved Catalytic OsO₄ Oxidation of Olefins to cis-1,2-Glycols Using Tertiary Amine Oxides as Oxidant Tetrahedron Lett. 1976, 1973– 1976
Google Scholar
There is no corresponding record for this reference.
31
Yang, D.; Zhang, C. Ruthenium-catalyzed oxidative cleavage of olefins to aldehydes J. Org. Chem. 2001, 66, 4814– 4818
Google Scholar
31
Ruthenium-Catalyzed Oxidative Cleavage of Olefins to Aldehydes
Yang, Dan; Zhang, Chi
Journal of Organic Chemistry (2001), 66 (14), 4814-4818CODEN: JOCEAH; ISSN:0022-3263. (American Chemical Society)
Three oxidn. protocols have been developed to cleave olefins to carbonyl compds. with ruthenium trichloride as catalyst (3.5 mol %). These methods convert olefins that are not fully substituted to aldehydes rather than carboxylic acids. While aryl olefins were cleaved to arom. aldehydes in excellent yields by using the system of RuCl3-Oxone-NaHCO3 in CH3CN-H2O (1.5:1), aliph. olefins were converted into alkyl aldehydes with RuCl3-NaIO4 in 1,2-dichloroethane-H2O (1:1) in good to excellent yields. It is noteworthy that terminal aliph. olefins were cleaved to the corresponding aldehydes in excellent yields by using RuCl3-NaIO4 in CH3CN-H2O (6:1).
32
Parniak, M. A.; Min, K. L.; Budihas, S. R.; Le Grice, S. F.; Beutler, J. A. A fluorescence-based high-throughput screening assay for inhibitors of human immunodeficiency virus-1 reverse transcriptase-associated ribonuclease H activity Anal. Biochem. 2003, 322, 33– 39
Google Scholar
There is no corresponding record for this reference.
33
Parniak, M. A.; Min, K. L. Substrate for assaying ribonuclease H activity. US 7,186,520 March6, 2007.
Google Scholar
There is no corresponding record for this reference.
34
Parniak, M. A.; Min, K. L. Method of identifying or characterizing a compound that modulates ribonuclease H activity. US 7,439,035 October21, 2008.
Google Scholar
There is no corresponding record for this reference.
35
Nowotny, M. Retroviral integrase superfamily: the structural perspective EMBO Rep. 2009, 10, 144– 151
Google Scholar
35
Retroviral integrase superfamily: the structural perspective
Nowotny, Marcin
EMBO Reports (2009), 10 (2), 144-151CODEN: ERMEAX; ISSN:1469-221X. (Nature Publishing Group)
A review. The retroviral integrase superfamily (RISF) comprises numerous important nucleic acid-processing enzymes, including transposases, integrases and various nucleases. These enzymes are involved in a wide range of processes such as transposition, replication and repair of DNA, homologous recombination, and RNA-mediated gene silencing. Two out of the four enzymes that are encoded by the human immunodeficiency virus, RNase H1 and integrase, are members of this superfamily. RISF enzymes act on various substrates, and yet show remarkable mechanistic and structural similarities. All share a common fold of the catalytic core and the active site, which is composed primarily of carboxylate residues. Here, RISF proteins are presented from a structural perspective, describing the individual members and the common and divergent elements of their structures, as well as the mechanistic insights gained from the structures of RNase H1 enzyme complexes with RNA/DNA hybrids.
36
Barreca, M. L.; Ferro, S.; Rao, A.; De Luca, L.; Zappala, M.; Monforte, A. M.; Debyser, Z.; Witvrouw, M.; Chimirri, A. Pharmacophore-based design of HIV-1 integrase strand-transfer inhibitors J. Med. Chem. 2005, 48, 7084– 7088
Google Scholar
There is no corresponding record for this reference.
37
Abram, M. E.; Parniak, M. A. Virion instability of human immunodeficiency virus type 1 reverse transcriptase (RT) mutated in the protease cleavage site between RT p51 and the RT RNase H domain J. Virol. 2005, 79, 11952– 11961
Google Scholar
37
Virion instability of human immunodeficiency virus type 1 reverse transcriptase (RT) mutated in the protease cleavage site between RT p51 and the RT RNase H domain
Abram, Michael E.; Parniak, Michael A.
Journal of Virology (2005), 79 (18), 11952-11961CODEN: JOVIAM; ISSN:0022-538X. (American Society for Microbiology)
Each of the human immunodeficiency virus type 1 (HIV-1) pol-encoded enzymes, protease (PR), reverse transcriptase (RT), and integrase (IN), is active only as a dimer (or higher-order oligomer in the case of IN), but only RT comprises subunits of different masses. RT is a heterodimer of 66-kDa and 51-kDa subunits. The latter is formed by HIV PR-catalyzed cleavage of p66 during virion maturation, resulting in the removal of the RNase H (RNH) domain of a p66 subunit. In order to study the apparent need for RT heterodimers in the context of the virion, we introduced a variety of mutations in the RT p51-RNH protease cleavage site of an infectious HIV-1 mol. clone. Surprisingly, rather than leading to virions with increased RT p66 content, most of the mutations resulted in significantly attenuated virus that contained greatly decreased levels of RT that in many cases was primarily p51 RT. IN levels were also reduced in several mutants. However, most mutants showed normal levels of the Pr160gag-pol precursor polyprotein, suggesting that reduced virion RT arose from proteolytic instability rather than decreased incorporation. Mutant virion p24 Gag levels were equiv. to wild type, indicating that Gag incorporation and processing were not affected. Repeated passage of MT-2 cells exposed to mutant viruses led to the appearance of virus with improved replication capacity; these virions contained normally processed RT at near-wild-type levels. These results imply that addnl. proteolytic processing of RT to the p66/p51 heterodimer is essential to provide proteolytic stability of RT during HIV-1 maturation.
38
Parikh, U. M.; Koontz, D. L.; Chu, C. K.; Schinazi, R. F.; Mellors, J. W. In vitro activity of structurally diverse nucleoside analogs against human immunodeficiency virus type 1 with the K65R mutation in reverse transcriptase Antimicrob. Agents Chemother. 2005, 49, 1139– 1144
Google Scholar
There is no corresponding record for this reference.
39
Su, H.-P.; Yan, Y.; Prasad, G. S.; Smith, R. F.; Daniels, C. L.; Abeywickrema, P. D.; Reid, J. C.; Loughran, H. M.; Kornienko, M.; Sharma, S.; Grobler, J. A.; Xu, B.; Sardana, V.; Allison, T. J.; Williams, P. D.; Darke, P. L.; Hazuda, D. J.; Munshi, S. Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors J. Virol. 2010, 84, 7625– 7633
Google Scholar
39
Structural basis for the inhibition of RNase H activity of HIV-1 reverse transcriptase by RNase H active site-directed inhibitors
Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev
Journal of Virology (2010), 84 (15), 7625-7633CODEN: JOVIAM; ISSN:0022-538X. (American Society for Microbiology)
HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are crit. to the HIV life cycle. Although a no. of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-contg. inhibitors bound to the RNase H active site. This class of compds. binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addn., one of the naphthyridinone-based compds. was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compd. can also bind the RNase H site and retains the metal-dependent binding mode of this class of mols. These structures provide a means for structurally guided design of novel RNase H inhibitors.
40
Friesner, R. A.; Murphy, R. B.; Repasky, M. P.; Frye, L. L.; Greenwood, J. R.; Halgren, T. A.; Sanschagrin, P. C.; Mainz, D. T. Extra precision glide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes J. Med. Chem. 2006, 49, 6177– 6196
Google Scholar
40
Extra Precision Glide: Docking and Scoring Incorporating a Model of Hydrophobic Enclosure for Protein-Ligand Complexes
Friesner, Richard A.; Murphy, Robert B.; Repasky, Matthew P.; Frye, Leah L.; Greenwood, Jeremy R.; Halgren, Thomas A.; Sanschagrin, Paul C.; Mainz, Daniel T.
Journal of Medicinal Chemistry (2006), 49 (21), 6177-6196CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
A novel scoring function to est. protein-ligand binding affinities has been developed and implemented as the Glide 4.0 XP scoring function and docking protocol. In addn. to unique water desolvation energy terms, protein-ligand structural motifs leading to enhanced binding affinity are included:(1) hydrophobic enclosure where groups of lipophilic ligand atoms are enclosed on opposite faces by lipophilic protein atoms, (2) neutral-neutral single or correlated hydrogen bonds in a hydrophobically enclosed environment, and (3) five categories of charged-charged hydrogen bonds. The XP scoring function and docking protocol have been developed to reproduce exptl. binding affinities for a set of 198 complexes (RMSDs of 2.26 and 1.73 kcal/mol over all and well-docked ligands, resp.) and to yield quality enrichments for a set of fifteen screens of pharmaceutical importance. Enrichment results demonstrate the importance of the novel XP mol. recognition and water scoring in sepg. active and inactive ligands and avoiding false positives.
41
PyMOL, The PyMOL Molecular Graphics System, version 1.5.0.4; Schrödinger, LLC: New York 2013.
Google Scholar
There is no corresponding record for this reference.
42
Fletcher, R. S.; Holleschak, G.; Nagy, E.; Arion, D.; Borkow, G.; Gu, Z.; Wainberg, M. A.; Parniak, M. A. Single-step purification of recombinant wild-type and mutant HIV-1 reverse transcriptase Protein Express. Purif. 1996, 7, 27– 32
Google Scholar
42
Single-step purification of recombinant wild-type and mutant HIV-1 reverse transcriptase
Fletcher, Ronald S.; Holleschak, Gyula; Nagy, Eva; Arion, Dominique; Borkow, Gadi; Gu, Zhengxian; Wainberg, Mark A.; Parniak, Michael A.
Protein Expression and Purification (1996), 7 (1), 27-32CODEN: PEXPEJ; ISSN:1046-5928. (Academic)
A single-step method that enables the purifn. of HIV-1 recombinant reverse transcriptase (RT) directly from bacterial lysates in <2 h is described. Clarified lysates were applied to com. Q- and S-matrix cartridge columns connected in series. The columns were washed with low-salt buffer to remove unbound protein, then the Q column was removed and RT was eluted from the S column using a salt gradient. The purifn. was carried out with both medium-pressure and high-pressure chromatog. systems. The purifns. were carried out at room temp. near neutral pH, providing enzyme with high DNA polymerase specific activity. A crucial aspect of the procedure was the use of Tris buffer, a buffer that is normally incompatible in cation-exchange methods. The method was applicable for the purifn. of the p51/p66 heterodimer and the p51 and p66 homodimer forms of RT. This method was used to purify wild-type RT and several recombinant RT proteins contg. mutations correlated with dideoxynucleoside drug resistance.
43
Gong, Q.; Menon, L.; Ilina, T.; Miller, L. G.; Ahn, J.; Parniak, M. A.; Ishima, R. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor Chem. Biol. Drug Des. 2011, 77, 39– 47
Google Scholar
43
Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor
Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G.; Ahn, Jinwoo; Parniak, Michael A.; Ishima, Rieko
Chemical Biology & Drug Design (2010), 77 (1), 39-47CODEN: CBDDAL; ISSN:1747-0277. (Wiley-Blackwell)
HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and RNase H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clin. used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase RNase H are on the market or in preclin. development. Several drug-like small mol. inhibitors of reverse transcriptase RNase H have been described, but little structural information is available about the interactions between reverse transcriptase RNase H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new RNase H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase RNase H domain fragment. We carried out soln. NMR expts. to identify the interaction interface of BHMP07 with the RNase H domain fragment. Chem. shift changes of backbone amide signals at different BHMP07 concns. clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the RNase H fragment. Using RNase H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the RNase H inhibitor interaction and are likely to be useful for further improvements of the inhibitors.
44
Dabora, J. M.; Marqusee, S. Equilibrium unfolding of Escherichia coli ribonuclease H: characterization of a partially folded state Protein Sci. 1994, 3, 1401– 1408
Google Scholar
44
Equilibrium unfolding of Escherichia coli ribonuclease H: characterization of a partially folded state
Dabora, Jonathan M.; Marqusee, Susan
Protein Science (1994), 3 (9), 1401-8CODEN: PRCIEI; ISSN:0961-8368.
The equil. unfolding of Escherichia coli RNase HI (RNase H), a member of a family of enzymes the cleaves RNA from RNA:DNA hybrids, was examd. A completely synthetic gene was constructed that expresses a variant of the wild-type sequence with all 3 cysteines replaced with alanine. The resulting recombinant protein is active and folds reversibly. Denaturation studies monitored by CD and tryptophan fluorescence yield coincident curves that suggest that the equil. unfolding reaction is a 2-state process. Acid denaturation, however, reveals a cooperative transition at pH ∼1.8 to a partially folded state. This acid state can be further denatured in a reversible manner by the addn. of heat or urea as monitored by either CD or tryptophan fluorescence. Anal. ultracentrifugation studies indicate that the acid state of RNase H is both compact and monomeric. Although compact, the acid state does not resemble the native protein: the acid state displays a near-UV CD spectrum similar to the unfolded state and binds to and enhances the fluorescence of the dye 1-anilinonaphthalene 8-sulfonate much more than either the native or unfolded states. Therefore, the acid state of E. coli RNase H has the characteristics of a molten globule: it retains a high degree of secondary structure, remains compact, yet does not appear to contain a tightly packed core.
45
Ndongwe, T. P.; Adedeji, A. O.; Michailidis, E.; Ong, Y. T.; Hachiya, A.; Marchand, B.; Ryan, E. M.; Rai, D. K.; Kirby, K. A.; Whatley, A. S.; Burke, D. H.; Johnson, M.; Ding, S.; Zheng, Y. M.; Liu, S. L.; Kodama, E.; Delviks-Frankenberry, K. A.; Pathak, V. K.; Mitsuya, H.; Parniak, M. A.; Singh, K.; Sarafianos, S. G. Biochemical, inhibition and inhibitor resistance studies of xenotropic murine leukemia virus-related virus reverse transcriptase Nucleic Acids Res. 2012, 40, 345– 359
Google Scholar
There is no corresponding record for this reference.
46
Kirby, K. A.; Marchand, B.; Ong, Y. T.; Ndongwe, T. P.; Hachiya, A.; Michailidis, E.; Leslie, M. D.; Sietsema, D. V.; Fetterly, T. L.; Dorst, C. A.; Singh, K.; Wang, Z.; Parniak, M. A.; Sarafianos, S. G. Structural and inhibition studies of the RNase H function of xenotropic murine leukemia virus-related virus reverse transcriptase Antimicrob. Agents Chemother. 2012, 56, 2048– 2061
Google Scholar
There is no corresponding record for this reference.
47
Michailidis, E.; Marchand, B.; Kodama, E. N.; Singh, K.; Matsuoka, M.; Kirby, K. A.; Ryan, E. M.; Sawani, A. M.; Nagy, E.; Ashida, N.; Mitsuya, H.; Parniak, M. A.; Sarafianos, S. G. Mechanism of inhibition of HIV-1 reverse transcriptase by 4′-ethynyl-2-fluoro-2′-deoxyadenosine triphosphate, a translocation-defective reverse transcriptase inhibitor J. Biol. Chem. 2009, 284, 35681– 35691
Google Scholar
There is no corresponding record for this reference.
48
Wang, Z.; Bennett, E. M.; Wilson, D. J.; Salomon, C.; Vince, R. Rationally designed dual inhibitors of HIV reverse transcriptase and integrase J. Med. Chem. 2007, 50, 3416– 3419
Google Scholar
There is no corresponding record for this reference.
49
Sirivolu, V. R.; Vernekar, S. K. V.; Ilina, T.; Myshakina, N. S.; Parniak, M. A.; Wang, Z. Q. Clicking 3′-Azidothymidine into Novel Potent Inhibitors of Human Immunodeficiency Virus J. Med. Chem. 2013, 56, 8765– 8780
Google Scholar
There is no corresponding record for this reference.
50
HIV-1 reverse transcriptase with inhibitor; RCSB Protein Data Bank: Piscataway, NJ, 2010; http://www.rcsb.org/pdb/explore.do?structureId=3LP1, DOI: DOI: 10.2210/pdb3lp1/pdb .
Google Scholar
There is no corresponding record for this reference.
51
Sastry, G. M.; Adzhigirey, M.; Day, T.; Annabhimoju, R.; Sherman, W. Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments J. Comput.-Aided Mol. Des. 2013, 27, 221– 234
Google Scholar
51
Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments
Sastry G Madhavi; Adzhigirey Matvey; Day Tyler; Annabhimoju Ramakrishna; Sherman Woody
Journal of computer-aided molecular design (2013), 27 (3), 221-34 ISSN:.
Structure-based virtual screening plays an important role in drug discovery and complements other screening approaches. In general, protein crystal structures are prepared prior to docking in order to add hydrogen atoms, optimize hydrogen bonds, remove atomic clashes, and perform other operations that are not part of the x-ray crystal structure refinement process. In addition, ligands must be prepared to create 3-dimensional geometries, assign proper bond orders, and generate accessible tautomer and ionization states prior to virtual screening. While the prerequisite for proper system preparation is generally accepted in the field, an extensive study of the preparation steps and their effect on virtual screening enrichments has not been performed. In this work, we systematically explore each of the steps involved in preparing a system for virtual screening. We first explore a large number of parameters using the Glide validation set of 36 crystal structures and 1,000 decoys. We then apply a subset of protocols to the DUD database. We show that database enrichment is improved with proper preparation and that neglecting certain steps of the preparation process produces a systematic degradation in enrichments, which can be large for some targets. We provide examples illustrating the structural changes introduced by the preparation that impact database enrichment. While the work presented here was performed with the Protein Preparation Wizard and Glide, the insights and guidance are expected to be generalizable to structure-based virtual screening with other docking methods.
52
(a) Schrödinger Release 2013-2: Schrödinger Suite 2013 Protein Preparation Wizard; Schrödinger, LLC: New York, 2013;
Google Scholar
There is no corresponding record for this reference.
(b) Schrödinger Release 2013-2: Epik, version 2.5; Schrödinger, LLC: New York, 2013;
Google Scholar
There is no corresponding record for this reference.
(c) Schrödinger Release 2013-2: Impact, version 6.0; Schrödinger, LLC: New York, 2013;
Google Scholar
There is no corresponding record for this reference.
(d) Schrödinger Release 2013-2: Prime, version 3; Schrödinger, LLC: New York, 2013.
Google Scholar
There is no corresponding record for this reference.
53
Jorgensen, W. L.; Maxwell, D. S.; TiradoRives, J. Development and testing of the OPLS all-atom force field on conformational energetics and properties of organic liquids J. Am. Chem. Soc. 1996, 118, 11225– 11236
Google Scholar
53
Development and Testing of the OPLS All-Atom Force Field on Conformational Energetics and Properties of Organic Liquids
Jorgensen, William L.; Maxwell, David S.; Tirado-Rives, Julian
Journal of the American Chemical Society (1996), 118 (45), 11225-11236CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
The parametrization and testing of the OPLS all-atom force field for org. mols. and peptides are described. Parameters for both torsional and nonbonded energetics have been derived, while the bond stretching and angle bending parameters have been adopted mostly from the AMBER all-atom force field. The torsional parameters were detd. by fitting to rotational energy profiles obtained from ab initio MO calcns. at the RHF/6-31G*//RHF/6-31G* level for more than 50 org. mols. and ions. The quality of the fits was high with av. errors for conformational energies of less than 0.2 kcal/mol. The force-field results for mol. structures are also demonstrated to closely match the ab initio predictions. The nonbonded parameters were developed in conjunction with Monte Carlo statistical mechanics simulations by computing thermodn. and structural properties for 34 pure org. liqs. including alkanes, alkenes, alcs., ethers, acetals, thiols, sulfides, disulfides, aldehydes, ketones, and amides. Av. errors in comparison with exptl. data are 2% for heats of vaporization and densities. The Monte Carlo simulations included sampling all internal and intermol. degrees of freedom. It is found that such non-polar and monofunctional systems do not show significant condensed-phase effects on internal energies in going from the gas phase to the pure liqs.
54
Schrödinger Release 2013-2: Maestro, version 9.5; Schrödinger, LLC, New York, 2013.
Google Scholar
There is no corresponding record for this reference.
55
Schrödinger Release 2013-2: LigPrep, version 2.7; Schrödinger, LLC, New York, 2013.
Google Scholar
There is no corresponding record for this reference.

Cited By

Click to copy section linkSection link copied!

Explore this article's citation statements on scite.ai

This article is cited by 123 publications.

Joseph P. Milton, Dorota Gryko. Photochemical Functionalization of 4-Diazoisoquinoline-1,3(2H,4H)-diones and Their 1-Sulfoxide Analogues. ACS Organic & Inorganic Au 2025, 5 (3) , 205-210. https://doi.org/10.1021/acsorginorgau.5c00017
Tao Zhang, Xinxin Ren, Jingkun Li, Yanhong Wang, Bin Wang, Ziren Chen, Yu Xia, Shaofeng Wu, Chenjiang Liu, Yonghong Zhang. Lewis Acidic Ionic-Liquid-Catalyzed Radical-Cascade Alkylation/Cyclization of N-Alkyl-N-methacryloyl Benzamides with Alkanes via Visible-Light-Induced Ligand-to-Metal Charge Transfer: Access to Alkylated Isoquinoline-1,3(2H,4H)-diones. Organic Letters 2024, 26 (48) , 10259-10266. https://doi.org/10.1021/acs.orglett.4c03697
Xinqiang Tan, Yuezhen Li, Ziyou Hao, Jia Wang, Xiangqian Liu, Bingqing Liu, Jianmei Yuan, Lizhen Fang, Ping-Xin Zhou, Yingling Wang. Pentafluorosulfanylation of Acrylamides: The Synthesis of SF5-Containing Isoquinolinediones with SF5Cl. The Journal of Organic Chemistry 2024, 89 (21) , 15941-15952. https://doi.org/10.1021/acs.joc.4c02181
Xinxin Ren, Tao Zhang, Bin Wang, Weiwei Jin, Yu Xia, Shaofeng Wu, Chenjiang Liu, Yonghong Zhang. Visible-Light-Driven Bifunctional Photocatalytic Radical-Cascade Selenocyanation/Cyclization of Acrylamides with KSeCN. The Journal of Organic Chemistry 2024, 89 (8) , 5783-5796. https://doi.org/10.1021/acs.joc.4c00362
Wenjuan Zhang, Yaqi Song, Tian-Yu Sun, Dawei Wang, Xiao-Feng Xia. Photocatalytic Proton-Coupled Electron Transfer Enabled Radical Cyclization for Isoquinoline-1,3-diones Synthesis. The Journal of Organic Chemistry 2024, 89 (7) , 5060-5068. https://doi.org/10.1021/acs.joc.4c00282
Vishal Jyoti Roy, Neha Dagar, Swagata Choudhury, Sudipta Raha Roy. Unified Approach to Diverse Heterocyclic Synthesis: Organo-Photocatalyzed Carboacylation of Alkenes and Alkynes from Feedstock Aldehydes and Alcohols. The Journal of Organic Chemistry 2023, 88 (21) , 15374-15388. https://doi.org/10.1021/acs.joc.3c01884
Zeguo Fang, Wen Liu, Nawaf Al-Maharik, Ruizhe Cao, Yingxue Huang, Yiting Yuan, Qian Zhang, Dong Li. Silver-Catalyzed Cascade Radical Bicyclization Reaction: An Atom- and Step-Economical Strategy Accessing γ-Lactam Containing Isoquinolinediones. The Journal of Organic Chemistry 2023, 88 (21) , 15428-15436. https://doi.org/10.1021/acs.joc.3c01964
Ajit Dhananjay Jagtap, Robert J. Geraghty, Zhengqiang Wang. Inhibiting HCMV pUL89-C Endonuclease with Metal-Binding Compounds. Journal of Medicinal Chemistry 2023, 66 (20) , 13874-13887. https://doi.org/10.1021/acs.jmedchem.3c01280
Tianyu He, Tiffany C. Edwards, Jiashu Xie, Hideki Aihara, Robert J. Geraghty, Zhengqiang Wang. 4,5-Dihydroxypyrimidine Methyl Carboxylates, Carboxylic Acids, and Carboxamides as Inhibitors of Human Cytomegalovirus pUL89 Endonuclease. Journal of Medicinal Chemistry 2022, 65 (7) , 5830-5849. https://doi.org/10.1021/acs.jmedchem.2c00203
Lanjun Su, Pan Xue, Xin Zhu, Huan Sun, Jikai Liu, Chengming Wang. Transition-Metal- and Light-Free Generation of an Iminyl Radical: Facile Approach to Oxindoles and Isoquinolinediones with a Quaternary Carbon Center via Cyanoalkylarylation. The Journal of Organic Chemistry 2022, 87 (1) , 874-883. https://doi.org/10.1021/acs.joc.1c02593
Xiaoshen Ma, Charles S. Yeung. Achieving C(sp2)–C(sp3) Coupling with BCP-F2 Building Blocks via Barluenga Coupling: A Comparative Approach. The Journal of Organic Chemistry 2021, 86 (15) , 10672-10698. https://doi.org/10.1021/acs.joc.1c01370
Antonella Messore, Angela Corona, Valentina Noemi Madia, Francesco Saccoliti, Valeria Tudino, Alessandro De Leo, Davide Ialongo, Luigi Scipione, Daniela De Vita, Giorgio Amendola, Ettore Novellino, Sandro Cosconati, Mathieu Métifiot, Marie-Line Andreola, Francesca Esposito, Nicole Grandi, Enzo Tramontano, Roberta Costi, Roberto Di Santo. Quinolinonyl Non-Diketo Acid Derivatives as Inhibitors of HIV-1 Ribonuclease H and Polymerase Functions of Reverse Transcriptase. Journal of Medicinal Chemistry 2021, 64 (12) , 8579-8598. https://doi.org/10.1021/acs.jmedchem.1c00535
Maria E. Cilento, Karen A. Kirby, Stefan G. Sarafianos. Avoiding Drug Resistance in HIV Reverse Transcriptase. Chemical Reviews 2021, 121 (6) , 3271-3296. https://doi.org/10.1021/acs.chemrev.0c00967
Zhenxing Zhang, Chunqi Jia, Xiangtao Kong, Muzammal Hussain, Zhenyu Liu, Wanqing Liang, Ling Jiang, Hao Jiang, Junyan Ma. Sustainable Approach to Azaheterocyclic Acetamides by Decarboxylative Aminoformylation. ACS Sustainable Chemistry & Engineering 2020, 8 (44) , 16463-16468. https://doi.org/10.1021/acssuschemeng.0c05118
Lei Wang, Stefan G. Sarafianos, Zhengqiang Wang. Cutting into the Substrate Dominance: Pharmacophore and Structure-Based Approaches toward Inhibiting Human Immunodeficiency Virus Reverse Transcriptase-Associated Ribonuclease H. Accounts of Chemical Research 2020, 53 (1) , 218-230. https://doi.org/10.1021/acs.accounts.9b00450
Chao Dong, Xin Wang, Zibo Pei, Ruwei Shen. Metal-Free Denitrogenative C–C Couplings of Pyridotriazoles with Boronic Acids To Afford α-Secondary and α-Tertiary Pyridines. Organic Letters 2019, 21 (11) , 4148-4152. https://doi.org/10.1021/acs.orglett.9b01334
Yuanyong Yang, Yingxian Li, Cheng Cheng, Guo Yang, Shuiying Wan, Jiquan Zhang, Yuanhu Mao, Yonglong Zhao, Lin Zhang, Chun Li, Lei Tang. Reductant-Free Aerobic Hydroxylation of Isoquinoline-1,3(2H,4H)-dione Derivatives. The Journal of Organic Chemistry 2019, 84 (4) , 2316-2324. https://doi.org/10.1021/acs.joc.8b02977
Masato Ohsumi and Nagatoshi Nishiwaki . Selective Synthesis of (Benzyl)biphenyls by Successive Suzuki–Miyaura Coupling of Phenylboronic Acids with 4-Bromobenzyl Acetate under Air Atmosphere. ACS Omega 2017, 2 (11) , 7767-7771. https://doi.org/10.1021/acsomega.7b01450
Aaron Wegener and Kenneth A. Miller . Total Synthesis of Avrainvilleol. The Journal of Organic Chemistry 2017, 82 (21) , 11655-11658. https://doi.org/10.1021/acs.joc.7b02028
Sanjeev Kumar V. Vernekar, Jing Tang, Bulan Wu, Andrew D. Huber, Mary C. Casey, Nataliya Myshakina, Daniel J. Wilson, Jayakanth Kankanala, Karen A. Kirby, Michael A. Parniak, Stefan G. Sarafianos, and Zhengqiang Wang . Double-Winged 3-Hydroxypyrimidine-2,4-diones: Potent and Selective Inhibition against HIV-1 RNase H with Significant Antiviral Activity. Journal of Medicinal Chemistry 2017, 60 (12) , 5045-5056. https://doi.org/10.1021/acs.jmedchem.7b00440
Han Ju, Jian Zhang, Boshi Huang, Dongwei Kang, Bing Huang, Xinyong Liu, and Peng Zhan . Inhibitors of Influenza Virus Polymerase Acidic (PA) Endonuclease: Contemporary Developments and Perspectives. Journal of Medicinal Chemistry 2017, 60 (9) , 3533-3551. https://doi.org/10.1021/acs.jmedchem.6b01227
Xiao-Feng Xia, Su-Li Zhu, Jian-Biao Liu, Dawei Wang, and Yong-Min Liang . Copper-Catalyzed Radical-Promoted Aminocyclization of Acrylamides with N-Fluorobenzenesulfonimide. The Journal of Organic Chemistry 2016, 81 (24) , 12482-12488. https://doi.org/10.1021/acs.joc.6b02337
Bulan Wu, Jing Tang, Daniel J. Wilson, Andrew D. Huber, Mary C. Casey, Juan Ji, Jayakanth Kankanala, Jiashu Xie, Stefan G. Sarafianos, and Zhengqiang Wang . 3-Hydroxypyrimidine-2,4-dione-5-N-benzylcarboxamides Potently Inhibit HIV-1 Integrase and RNase H. Journal of Medicinal Chemistry 2016, 59 (13) , 6136-6148. https://doi.org/10.1021/acs.jmedchem.6b00040
Jayakanth Kankanala, Karen A. Kirby, Feng Liu, Lena Miller, Eva Nagy, Daniel J. Wilson, Michael A. Parniak, Stefan G. Sarafianos, and Zhengqiang Wang . Design, Synthesis, and Biological Evaluations of Hydroxypyridonecarboxylic Acids as Inhibitors of HIV Reverse Transcriptase Associated RNase H. Journal of Medicinal Chemistry 2016, 59 (10) , 5051-5062. https://doi.org/10.1021/acs.jmedchem.6b00465
Peng Zhan, Christophe Pannecouque, Erik De Clercq, and Xinyong Liu . Anti-HIV Drug Discovery and Development: Current Innovations and Future Trends. Journal of Medicinal Chemistry 2016, 59 (7) , 2849-2878. https://doi.org/10.1021/acs.jmedchem.5b00497
Jing Tang, Feng Liu, Eva Nagy, Lena Miller, Karen A. Kirby, Daniel J. Wilson, Bulan Wu, Stefan G. Sarafianos, Michael A. Parniak, and Zhengqiang Wang . 3-Hydroxypyrimidine-2,4-diones as Selective Active Site Inhibitors of HIV Reverse Transcriptase-Associated RNase H: Design, Synthesis, and Biochemical Evaluations. Journal of Medicinal Chemistry 2016, 59 (6) , 2648-2659. https://doi.org/10.1021/acs.jmedchem.5b01879
Shi Tang, You-Lin Deng, Jie Li, Wen-Xin Wang, Guo-Liang Ding, Ming-Wei Wang, Zhu-Ping Xiao, Ying-Chun Wang, and Rui-Long Sheng . Synthesis of Perfluorinated Isoquinolinediones through Visible-Light-Induced Cyclization of Alkenes. The Journal of Organic Chemistry 2015, 80 (24) , 12599-12605. https://doi.org/10.1021/acs.joc.5b01803
Jubi John, Youngju Kim, Nicholas Bennett, Kalyan Das, Sandra Liekens, Lieve Naesens, Eddy Arnold, Anita R. Maguire, Matthias Götte, Wim Dehaen, and Jan Balzarini . Pronounced Inhibition Shift from HIV Reverse Transcriptase to Herpetic DNA Polymerases by Increasing the Flexibility of α-Carboxy Nucleoside Phosphonates. Journal of Medicinal Chemistry 2015, 58 (20) , 8110-8127. https://doi.org/10.1021/acs.jmedchem.5b01180
Wei Niu, Yanlong Liu, Erling Dai, Jiarui Sun, Yuyu Dai, Xiangsheng Xu. Synthesis of amide-functionalized isoquinoline derivatives by photo-induced carbamoyl radical cascade amidation/cyclization. Organic & Biomolecular Chemistry 2025, 23 (23) , 5533-5541. https://doi.org/10.1039/D5OB00465A
Saikat Pandit, Tobias Ritter. Copper‐Photoredox‐Catalyzed C(sp 3 )–C(sp 3 ) Reductive Cross‐Coupling of Alkyl Bromides with BCP‐Thianthrenium Reagents. Angewandte Chemie 2025, 55 https://doi.org/10.1002/ange.202506785
Saikat Pandit, Tobias Ritter. Copper‐Photoredox‐Catalyzed C(sp 3 )–C(sp 3 ) Reductive Cross‐Coupling of Alkyl Bromides with BCP‐Thianthrenium Reagents. Angewandte Chemie International Edition 2025, 55 https://doi.org/10.1002/anie.202506785
Ren‐Rui Xu, Chang‐Sheng Kuai, Xiao‐Feng Wu. Palladium‐Catalyzed Selectivity Controlled Highly Efficient Carbonylative Synthesis of Isoquinoline‐1,3(2 H ,4 H )‐diones and Indanones. ChemistryEurope 2025, 3 (2) https://doi.org/10.1002/ceur.202400105
Lei Huang, Chaodong Wang, Zhi Chen, Qianxi Jin, Shengjie Song, Jiadi Zhou, Jianjun Li. Photoinduced EDA Complex‐Initiated Synthesis of Fluoroalkylated Isoquinolinonediones. Chemistry – A European Journal 2025, 31 (3) https://doi.org/10.1002/chem.202403286
Fathi Shalbi, Ahmed R. Ali. A mini-review on integrase inhibitors: The cornerstone of next-generation HIV treatment. European Journal of Medicinal Chemistry 2024, 279 , 116900. https://doi.org/10.1016/j.ejmech.2024.116900
An-Qi Miao, Yu-Xin Wang, Lin-Lin Xu, Wen-Juan Hao, Shu-Jiang Tu, Jin-Peng Zhang, Bo Jiang. Pd(II)/N,N′-Disulfonyl bisimidazoline-catalyzed asymmetric arylation of isoquinoline-1,3,4-trione-derived ketimines. Green Synthesis and Catalysis 2024, 5 (3) , 165-169. https://doi.org/10.1016/j.gresc.2023.07.001
Lei Huang, Jun Sun, Boxuan Sun, Shengjie Song, Jianjun Li. Regioselective synthesis of isoquinolinonediones through remote unactivated C(sp 3 )–H bonds. Chemical Communications 2024, 60 (36) , 4818-4821. https://doi.org/10.1039/D4CC00916A
Dong-Liang Zhang, Zhang-Gao Le, Qing Li, Zong-Bo Xie, Wen-Wen Yang, Zhi-Qiang Zhu. Visible-light-driven EDA complex-promoted cascade cyclization to construct 4-cyanoalkyl isoquinoline-1,3-diones. Chemical Communications 2024, 60 (21) , 2958-2961. https://doi.org/10.1039/D4CC00092G
Hongsheng Ma, Tongyan Yu, Siliang You, Ming‐Zhi Zhang, Chao Deng. Synthesis of nitro‐containing isoquinoline‐1,3‐diones with tert‐butyl nitrite. Journal of Heterocyclic Chemistry 2024, 61 (2) , 331-335. https://doi.org/10.1002/jhet.4762
Qing Li, Zhi-Qiang Zhu, Wen-Yi Zhang, Zhang-Gao Le, Zong-Bo Xie. Visible-light-induced decarboxylative cascade cyclization of acryloylbenzamides with N -hydroxyphthalimide esters via EDA complexes. Organic & Biomolecular Chemistry 2024, 22 (5) , 965-969. https://doi.org/10.1039/D3OB01970E
Jinli Xu, Chenyue Zhao, Dongping Cheng, Xiaoliang Xu. Synthesis of Isoquinolinediones via the Radical Addition/Cyclization of N‐Alkyl‐N‐methacryloylbenzamides with Monoalkyl Oxalates. Advanced Synthesis & Catalysis 2023, 365 (24) , 4527-4532. https://doi.org/10.1002/adsc.202301223
Archana Vijayakumar, M. Manod, R. Bharath Krishna, Abra Mathew, Chithra Mohan. Diversely functionalized isoquinolines and their core-embedded heterocyclic frameworks: a privileged scaffold for medicinal chemistry. RSC Medicinal Chemistry 2023, 14 (12) , 2509-2534. https://doi.org/10.1039/D3MD00248A
Dharmraj V. Pathak, Sneha R. Sagar, Hardik G. Bhatt, Paresh K. Patel. A search for potential anti-HIV phytoconstituents from the natural product repository. Advances in Traditional Medicine 2023, 23 (4) , 953-984. https://doi.org/10.1007/s13596-022-00646-2
Pengfei Jia, Zhiqian Lin, Cankun Luo, Jiao Liang, Ruizhi Lai, Li Guo, Yuan Yao, Yong Wu. Synthesis of spirotriazolines and spirooxadiazolines via light-induced 1,3-dipolar [3+2] cycloadditions. New Journal of Chemistry 2023, 47 (44) , 20248-20252. https://doi.org/10.1039/D3NJ03037G
Xiao-Yu Lu, Fu-Yi Shui, Xiang Zhang, Rui Huang, Zi-Zhen Wang, Yi-Wei Song, Fan Jiang, Gui-Xian Yang, Yan-Xi Sun. Palladium catalyzed tandem cyclization of acryloylbenzamides and N -arylacrylamides with epoxides: access to functionalized isoquinolinediones and oxindoles. Organic Chemistry Frontiers 2023, 10 (22) , 5616-5622. https://doi.org/10.1039/D3QO01243C
Shujing Xu, Lin Sun, Xinyong Liu, Peng Zhan. Opportunities and challenges in new HIV therapeutic discovery: what is the next step?. Expert Opinion on Drug Discovery 2023, 18 (11) , 1195-1199. https://doi.org/10.1080/17460441.2023.2246872
Fatma Mohamed A. Abid, Nurul Syahirah Salim, Roswanira Abdul Wahab, Siti Ernieyanti Hashim, Murugesan Sankaranarayanan, Ajmal Bhat, Joazaizulfazli Jamalis. An Overview of the Anti-HIV Potential of Thiazolidinone Derivatives. Anti-Infective Agents 2023, 21 (5) https://doi.org/10.2174/2211352521666230718094413
Cai Zhang, Demao Chen, Jie-Ping Wan, Yunyun Liu. Recent Advances in Electrochemical Cascade Cyclization Reactions. Synthesis 2023, 55 (18) , 2911-2925. https://doi.org/10.1055/a-2039-1728
Yushen Yu, Zhihui Liang, Lele Zhang, Yuhan Lin, Min Liu, Shanshan Wang, Mingqiang Huang, Lina Cai, Shunyou Cai. Photocatalytic dehydrogenative oxidation/amination of 2-alkyl benzamides under transition-metal-free conditions. Organic Chemistry Frontiers 2023, 10 (17) , 4400-4407. https://doi.org/10.1039/D3QO00878A
Dimitrios Moianos, Georgia-Myrto Prifti, Maria Makri, Grigoris Zoidis. Targeting Metalloenzymes: The “Achilles’ Heel” of Viruses and Parasites. Pharmaceuticals 2023, 16 (6) , 901. https://doi.org/10.3390/ph16060901
Jia-Xiong Kang, Guang-Kuan Zhao, Xiu-Ming Yang, Mou-Xin Huang, Wen-Qi Hui, Rong Zeng, Qin Ouyang. Recent advances on dual inhibitors targeting HIV reverse transcriptase associated polymerase and ribonuclease H. European Journal of Medicinal Chemistry 2023, 250 , 115196. https://doi.org/10.1016/j.ejmech.2023.115196
Zhuang-Zhi Shi, Tongyan Yu, Hongsheng Ma, Long-Xiao Chi, Siliang You, Chao Deng. Recent advances in radical cascade cyclization of 1,n-enynes with trifluoromethylating agents. Tetrahedron 2023, 131 , 133216. https://doi.org/10.1016/j.tet.2022.133216
Youchun Huang, Ke Kang, Xiuwen Zhong, Yongping Yu, Wenteng Chen. Rh(III)-catalyzed C H activation/intramolecular annulation for the synthesis of N-methoxydihydropyrimidin-2-one fused heterocycles. Tetrahedron Letters 2023, 115 , 154311. https://doi.org/10.1016/j.tetlet.2022.154311
Tianyu He, Tiffany C. Edwards, Ryuichi Majima, Eunkyung Jung, Jayakanth Kankanala, Jiashu Xie, Robert J. Geraghty, Zhengqiang Wang. Repurposing N-hydroxy thienopyrimidine-2,4-diones (HtPD) as inhibitors of human cytomegalovirus pUL89 endonuclease: Synthesis and biological characterization. Bioorganic Chemistry 2022, 129 , 106198. https://doi.org/10.1016/j.bioorg.2022.106198
Lina Zhang, Fenju Wei, Jiwei Zhang, Chuanfeng Liu, Nerea López-Carrobles, Xinyong Liu, Luis Menéndez-Arias, Peng Zhan. Current medicinal chemistry strategies in the discovery of novel HIV-1 ribonuclease H inhibitors. European Journal of Medicinal Chemistry 2022, 243 , 114760. https://doi.org/10.1016/j.ejmech.2022.114760
D. Wen, Z. Shen, X. Qi, X.‐F. Wu. Palladium‐Catalyzed Cascade Carbonylative Synthesis of Functionalized Isoquinoline‐1,3‐diones and Oxindoles Using Dimethyl Carbonate as both Solvent and Reactant. European Journal of Organic Chemistry 2022, 2022 (42) https://doi.org/10.1002/ejoc.202200971
Jianyi Shi, Zheng Zeng, Shengting Xu, Zechun Cai, Yuehua Luo, Yongbo Fan, Zhongzhi Zhu, Tingting Wen, Xiuwen Chen. Cross-coupling of 2-methylquinolines and in-situ activated isoquinolines: Construction of 1,2-disubstituted isoquinolinones. Chinese Chemical Letters 2022, 33 (11) , 4874-4877. https://doi.org/10.1016/j.cclet.2022.02.032
Yan-Ning Niu, Xiao-Feng Xia. Recent developments in the synthesis of the isoquinoline-1,3(2 H ,4 H )-dione by radical cascade reaction. Organic & Biomolecular Chemistry 2022, 20 (40) , 7861-7885. https://doi.org/10.1039/D2OB01554D
Zhihui Liang, Chao Liu, Jiajun Fan, Mingze Wang, Xuanyu Yan, Mingqiang Huang, Shunyou Cai. Photocatalytic dehydrogenated etherification of 2-aryl benzylic alcohols. Green Chemistry 2022, 24 (19) , 7442-7447. https://doi.org/10.1039/D2GC02030K
Lina Zhang, Fenju Wei, David Borrego, Fabao Zhao, Javier Martínez del Río, Estrella Frutos-Beltrán, Jiwei Zhang, Shujing Xu, Nerea López-Carrobles, Shenghua Gao, Dongwei Kang, Christophe Pannecouque, Erik De Clercq, Xinyong Liu, Luis Menéndez-Arias, Peng Zhan. Design, synthesis, and biological evaluation of novel double-winged galloyl derivatives as HIV-1 RNase H inhibitors. European Journal of Medicinal Chemistry 2022, 240 , 114563. https://doi.org/10.1016/j.ejmech.2022.114563
Eunkyung Jung, Ryuichi Majima, Tiffany C. Edwards, Ruben Soto‐Acosta, Robert J. Geraghty, Zhengqiang Wang. 8‐Hydroxy‐1,6‐naphthyridine‐7‐carboxamides as Inhibitors of Human Cytomegalovirus pUL89 Endonuclease. ChemMedChem 2022, 17 (17) https://doi.org/10.1002/cmdc.202200334
Diancong Chen, Haiping Yang, Zhong Li, Peter Maienfisch, Xiaoyong Xu. Design, synthesis and nematicidal activities of trifluorobutene hydroxamic acid derivatives against Meloidogyne incognita. Journal of Molecular Structure 2022, 1264 , 133191. https://doi.org/10.1016/j.molstruc.2022.133191
Xingxing Cai, Jiahui Fu, Li Gu, Dongping Cheng, Hong Wang, Xiaoliang Xu. Visible‐light‐promoted Cascade Reaction of Acryloylbenzamides with Carboxylic Acids: Metal‐free Synthesis of Isoquinolinediones. Asian Journal of Organic Chemistry 2022, 11 (8) https://doi.org/10.1002/ajoc.202200318
Shidi Ma, Pengsheng Zhou, Xu Fan, Dianjun Li, Jinhui Yang. Base-promoted cascade radical difluoroalkylation/cyclization of acrylamides for the synthesis of CF2-containing oxindoles and isoquinoline-1,3-diones. Tetrahedron Letters 2022, 102 , 153933. https://doi.org/10.1016/j.tetlet.2022.153933
Jiahui Fu, Xingxing Cai, Yihuo Liu, Jinghua Li, Dongping Cheng, Xiaoliang Xu. Synthesis of Isoquinoline-1,3(2H,4H)-diones by Visible-Light-Mediated Cyclization of Acryloylbenzamides with Alkylboronic Acids, Arylsulfonyl Hydrazides and Oxime Esters. Synthesis 2022, 54 (11) , 2707-2723. https://doi.org/10.1055/a-1734-9782
Xingxing Cai, Yihuo Liu, Siyu Ding, Jiahui Fu, Jinghua Li, Dongping Cheng, Xiaoliang Xu. Visible light-induced radical cascade reaction of acryloylbenzamides with N-hydroxyphthalimide esters. Tetrahedron Letters 2022, 95 , 153722. https://doi.org/10.1016/j.tetlet.2022.153722
Yameng Wan, Qingfeng Liu, Hao Wu, Zhiguo Zhang, Guisheng Zhang. 2,11-Dimethoxyldipyridopurinone as an efficient reducing visible-light photocatalyst for organic transformations. Organic Chemistry Frontiers 2022, 9 (6) , 1634-1641. https://doi.org/10.1039/D1QO01914G
Lei Wang, Tiffany C. Edwards, Rajkumar Lalji Sahani, Jiashu Xie, Hideki Aihara, Robert J. Geraghty, Zhengqiang Wang. Metal binding 6-arylthio-3-hydroxypyrimidine-2,4-diones inhibited human cytomegalovirus by targeting the pUL89 endonuclease of the terminase complex. European Journal of Medicinal Chemistry 2021, 222 , 113640. https://doi.org/10.1016/j.ejmech.2021.113640
Jianlian Liu, Chaojun Du, Hong Hao. Crystal structure of 4-(2,2-difluoroethyl)-2,4-dimethyl-6-(trifluoromethyl)isoquinoline-1,3(2 H ,4 H )-dione, C 14 H 12 F 5 NO 2. Zeitschrift für Kristallographie - New Crystal Structures 2021, 236 (5) , 979-980. https://doi.org/10.1515/ncrs-2021-0179
Sandeep Kumar, Tariq A. Shah, Tharmalingam Punniyamurthy. Recent advances in the application of tetrabromomethane in organic synthesis. Organic Chemistry Frontiers 2021, 8 (15) , 4288-4314. https://doi.org/10.1039/D0QO01369B
Ying‐Xian Li, Xiao‐Bing Feng, Xue‐Min Jia, Huang Jin, Fei Chen, Yong‐Long Zhao, Ji‐Quan Zhang, Jian‐Ta Wang, Bing Guo, Lei Tang, Yuan‐Yong Yang. Regiodivergent Functionalization of Isoquinoline‐1,3(2 H ,4 H )‐dione Derivatives via Aerobic Umpolung. Asian Journal of Organic Chemistry 2021, 10 (6) , 1508-1513. https://doi.org/10.1002/ajoc.202100194
Huixing Li, Xinlong Han, Bin Cao. Crystal structure of 4-(2,2-difluoroethyl)-2,4,6-trimethylisoquinoline-1,3(2 H ,4 H )-dione, C 14 H 15 F 2 NO 2. Zeitschrift für Kristallographie - New Crystal Structures 2021, 236 (3) , 499-501. https://doi.org/10.1515/ncrs-2020-0635
Yue Ma, Estrella Frutos-Beltrán, Dongwei Kang, Christophe Pannecouque, Erik De Clercq, Luis Menéndez-Arias, Xinyong Liu, Peng Zhan. Medicinal chemistry strategies for discovering antivirals effective against drug-resistant viruses. Chemical Society Reviews 2021, 50 (7) , 4514-4540. https://doi.org/10.1039/D0CS01084G
Ren‐You Guan, Chan‐Wei Hsu, Jeng‐Liang Han. Trifluoroethanol‐mediated Decarboxylative Addition Reactions of β‐Ketoacids with Diverse Electrophiles. Asian Journal of Organic Chemistry 2021, 10 (1) , 273-284. https://doi.org/10.1002/ajoc.202000553
Fenju Wei, Edeildo Ferreira da Silva-Júnior, Xinyong Liu, Peng Zhan. HIV-1 and HBV RNase H as Metal-Chelating Inhibitors: Discovery and Medicinal Chemistry Strategies. 2021, 585-602. https://doi.org/10.1007/978-3-030-71165-8_28
Jiaxuan Shao, Youjia Wang, Silu Chen, Shaowei Wang, Yanhui Wu, Xulian Li, Weihua Zhang, Chao Deng. Synthesis of CF2H-containing isoquinoline-1,3-diones through metal-free, visible-light and air-promoted radical difluoromethylation/cyclization of N-benzamides. Tetrahedron 2021, 79 , 131822. https://doi.org/10.1016/j.tet.2020.131822
Cheng Cheng, Ying-Xian Li, Xue-Min Jia, Ji-Quan Zhang, Yong-Long Zhao, Wei Feng, Lei Tang, Yuan-Yong Yang. Enantioselective amination of 4-alkylisoquinoline-1,3(2 H ,4 H )-dione derivatives. RSC Advances 2020, 10 (70) , 42912-42915. https://doi.org/10.1039/D0RA07806A
Fenju Wei, Dongwei Kang, Luis Menéndez‐Arias, Xinyong Liu, Peng Zhan. Recent Developments in Small Molecular HIV‐1 and Hepatitis B Virus RNase H Inhibitors. 2020, 273-292. https://doi.org/10.1002/9781119640868.ch9
Yingpeng Su, Rong Zhang, Wenxuan Xue, Xuan Liu, Yanan Zhao, Ke-Hu Wang, Danfeng Huang, Congde Huo, Yulai Hu. Visible-light-promoted acyl radical cascade reaction for accessing acylated isoquinoline-1,3(2 H ,4 H )-dione derivatives. Organic & Biomolecular Chemistry 2020, 18 (10) , 1940-1948. https://doi.org/10.1039/D0OB00086H
Yali Sang, Christophe Pannecouque, Erik De Clercq, Chunlin Zhuang, Fener Chen. Pharmacophore-fusing design of pyrimidine sulfonylacetanilides as potent non-nucleoside inhibitors of HIV-1 reverse transcriptase. Bioorganic Chemistry 2020, 96 , 103595. https://doi.org/10.1016/j.bioorg.2020.103595
Enzo Tramontano, Angela Corona, Luis Menéndez-Arias. Ribonuclease H, an unexploited target for antiviral intervention against HIV and hepatitis B virus. Antiviral Research 2019, 171 , 104613. https://doi.org/10.1016/j.antiviral.2019.104613
Yanfei Liu, Jiaping Wu, Baiyang Qian, Yongjia Shang. Controllable construction of isoquinolinedione and isocoumarin scaffolds via Rh III -catalyzed C–H annulation of N -tosylbenzamides with diazo compounds. Organic & Biomolecular Chemistry 2019, 17 (38) , 8768-8777. https://doi.org/10.1039/C9OB01789E
Shaowei Wang, Peng Dai, Zhichao Yan, Youjia Wang, Jiaxuan Shao, Yanhui Wu, Chao Deng, Weihua Zhang. Metal‐free, Visible‐Light‐Induced Radical Trifluoromethylation/Cyclization of N‐benzamides with CF 3 SO 2 Na to Synthesize CF 3 ‐Containing Isoquinoline‐1,3‐diones. ChemistrySelect 2019, 4 (35) , 10329-10333. https://doi.org/10.1002/slct.201902545
Maojian Lu, Tao Zhang, Dabao Tan, Chengzhu Chen, Ying Zhang, Mingqiang Huang, Shunyou Cai. Visible‐Light‐Promoted Oxidative Alkylarylation of N ‐Aryl/Benzoyl Acrylamides Through Direct C−H Bond Functionalization. Advanced Synthesis & Catalysis 2019, 361 (18) , 4237-4242. https://doi.org/10.1002/adsc.201900712
Yali Sang, Sheng Han, Shuwen Han, Christophe Pannecouque, Erik De Clercq, Chunlin Zhuang, Fener Chen. Follow on-based optimization of the biphenyl-DAPYs as HIV-1 nonnucleoside reverse transcriptase inhibitors against the wild-type and mutant strains. Bioorganic Chemistry 2019, 89 , 102974. https://doi.org/10.1016/j.bioorg.2019.102974
Ross D. Overacker, Somdev Banerjee, George F. Neuhaus, Selena Milicevic Sephton, Alexander Herrmann, James A. Strother, Ruth Brack-Werner, Paul R. Blakemore, Sandra Loesgen. Biological evaluation of molecules of the azaBINOL class as antiviral agents: Inhibition of HIV-1 RNase H activity by 7-isopropoxy-8-(naphth-1-yl)quinoline. Bioorganic & Medicinal Chemistry 2019, 27 (16) , 3595-3604. https://doi.org/10.1016/j.bmc.2019.06.044
Yong You, Wen-Ya Lu, Ke-Xin Xie, Jian-Qiang Zhao, Zhen-Hua Wang, Wei-Cheng Yuan. Enantioselective synthesis of isoquinoline-1,3(2 H ,4 H )-dione derivatives via a chiral phosphoric acid catalyzed aza-Friedel–Crafts reaction. Chemical Communications 2019, 55 (58) , 8478-8481. https://doi.org/10.1039/C9CC04057A
Antonia Di Mola, Consiglia Tedesco, Antonio Massa. Metal-Free Air Oxidation in a Convenient Cascade Approach for the Access to Isoquinoline-1,3,4(2H)-triones. Molecules 2019, 24 (11) , 2177. https://doi.org/10.3390/molecules24112177
Yu-Jue Chen, Yan-Hong He, Zhi Guan. Metal-free visible-light-promoted thiocyanation/cyclization cascade for the synthesis of thiocyanato-containing isoquinolinediones. Tetrahedron 2019, 75 (22) , 3053-3061. https://doi.org/10.1016/j.tet.2019.04.053
Ping Gao, Xueshun Wang, Lin Sun, Xiqiang Cheng, Vasanthanathan Poongavanam, Jacob Kongsted, Mar Álvarez, Joanna Luczkowiak, Christophe Pannecouque, Erik De Clercq, Kuo‐Hsiung Lee, Chin‐Ho Chen, Huiqing Liu, Luis Menéndez‐Arias, Xinyong Liu, Peng Zhan. Design, synthesis, and biologic evaluation of novel galloyl derivatives as HIV ‐1 RN ase H inhibitors. Chemical Biology & Drug Design 2019, 93 (4) , 582-589. https://doi.org/10.1111/cbdd.13455
Jing Tang, Ha T. Do, Andrew D. Huber, Mary C. Casey, Karen A. Kirby, Daniel J. Wilson, Jayakanth Kankanala, Michael A. Parniak, Stefan G. Sarafianos, Zhengqiang Wang. Pharmacophore-based design of novel 3-hydroxypyrimidine-2,4-dione subtypes as inhibitors of HIV reverse transcriptase-associated RNase H: Tolerance of a nonflexible linker. European Journal of Medicinal Chemistry 2019, 166 , 390-399. https://doi.org/10.1016/j.ejmech.2019.01.081
Tiexin Zhang, Xiangyang Guo, Yusheng Shi, Cheng He, Chunying Duan. Dye-incorporated coordination polymers for direct photocatalytic trifluoromethylation of aromatics at metabolically susceptible positions. Nature Communications 2018, 9 (1) https://doi.org/10.1038/s41467-018-05919-6
Tiexin Zhang, Yusheng Shi, Sen Zhang, Chen Jia, Cheng He, Chunying Duan. Thiophene insertion for continuous modulation of the photoelectronic properties of triphenylamine-based metal–organic frameworks for photocatalytic sulfonylation–cyclisation of activated alkenes. New Journal of Chemistry 2018, 42 (22) , 18448-18457. https://doi.org/10.1039/C8NJ04151B
Zeng-Zeng Li, Jian Yu, Liang-Neng Wang, Shi-Lu Chen, Rui-Long Sheng, Shi Tang. Cascade radical cyclization/cross-coupling of halobenzamides by synergistic Cu/Fe catalysis: An access to 7-tert-alkylated isoquinolinediones. Tetrahedron 2018, 74 (45) , 6558-6568. https://doi.org/10.1016/j.tet.2018.09.036
Songhai Huang, Pengfei Niu, Yingpeng Su, Dongcheng Hu, Congde Huo. Tandem radical cyclization of N -methacryloyl benzamides with CBr 4 to construct brominated isoquinolinediones. Organic & Biomolecular Chemistry 2018, 16 (41) , 7748-7752. https://doi.org/10.1039/C8OB01964A
Lei Wang, Jing Tang, Andrew D. Huber, Mary C. Casey, Karen A. Kirby, Daniel J. Wilson, Jayakanth Kankanala, Michael A. Parniak, Stefan G. Sarafianos, Zhengqiang Wang. 6-Biphenylmethyl-3-hydroxypyrimidine-2,4-diones potently and selectively inhibited HIV reverse transcriptase-associated RNase H. European Journal of Medicinal Chemistry 2018, 156 , 680-691. https://doi.org/10.1016/j.ejmech.2018.07.035
Lei Wang, Jing Tang, Andrew D. Huber, Mary C. Casey, Karen A. Kirby, Daniel J. Wilson, Jayakanth Kankanala, Jiashu Xie, Michael A. Parniak, Stefan G. Sarafianos, Zhengqiang Wang. 6-Arylthio-3-hydroxypyrimidine-2,4-diones potently inhibited HIV reverse transcriptase-associated RNase H with antiviral activity. European Journal of Medicinal Chemistry 2018, 156 , 652-665. https://doi.org/10.1016/j.ejmech.2018.07.039
Lin Sun, Ping Gao, Guanyu Dong, Xujie Zhang, Xiqiang Cheng, Xiao Ding, Xueshun Wang, Dirk Daelemans, Erik De Clercq, Christophe Pannecouque, Luis Menéndez-Arias, Peng Zhan, Xinyong Liu. 5-Hydroxypyrido[2,3-b]pyrazin-6(5H)-one derivatives as novel dual inhibitors of HIV-1 reverse transcriptase-associated ribonuclease H and integrase. European Journal of Medicinal Chemistry 2018, 155 , 714-724. https://doi.org/10.1016/j.ejmech.2018.06.036
Cyrus M. Lacbay, Michael Menni, Jean A. Bernatchez, Matthias Götte, Youla S. Tsantrizos. Pharmacophore requirements for HIV-1 reverse transcriptase inhibitors that selectively “Freeze” the pre-translocated complex during the polymerization catalytic cycle. Bioorganic & Medicinal Chemistry 2018, 26 (8) , 1713-1726. https://doi.org/10.1016/j.bmc.2018.02.017
Yan Wang, Jing Tang, Zhengqiang Wang, Robert J. Geraghty. Metal-chelating 3-hydroxypyrimidine-2,4-diones inhibit human cytomegalovirus pUL89 endonuclease activity and virus replication. Antiviral Research 2018, 152 , 10-17. https://doi.org/10.1016/j.antiviral.2018.01.015
Sonia de Castro, María-José Camarasa. Polypharmacology in HIV inhibition: can a drug with simultaneous action against two relevant targets be an alternative to combination therapy?. European Journal of Medicinal Chemistry 2018, 150 , 206-227. https://doi.org/10.1016/j.ejmech.2018.03.007

Load all citations

Download PDF

Get e-Alerts

Journal of Medicinal Chemistry

Cite this: J. Med. Chem. 2015, 58, 2, 651–664

Click to copy citationCitation copied!

https://doi.org/10.1021/jm501132s

Published December 18, 2014

Request reuse permissions

Article Views

Altmetric

Citations

123

Learn about these metrics

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

Abstract
High Resolution Image
Download MS PowerPoint Slide
Figure 1
Figure 1. Major chemotypes reported as HIV RNase H active site inhibitors. Chemotypes 4–7 reflect a pharmacophore model consisting of a chelating triad (magenta) and an aryl or biaryl moiety (cyan) connected through a methylene or amino linker.
High Resolution Image
Download MS PowerPoint Slide
Figure 2
Figure 2. Design of a novel HID scaffold 9 based on the pharmacophore model of 4–7.
High Resolution Image
Download MS PowerPoint Slide
Scheme 1
Scheme 1. Synthesis of C6 Arylmethyl HID Analogues 20a–t^a
High Resolution Image
Download MS PowerPoint Slide
Scheme aReagents and conditions: (a) NaBH₄, THF, rt, 12 h, 87%; (b) n-BuLi, DMF, THF, −78 °C–rt, overnight, 76%; (c) TsNHNH₂, toluene, 80 °C, 2 h; (d) boronic acid, K₂CO₃, 1,4-dioxane, 110 °C, 3–5 h, 40–55%; (e) PPTS, toluene, reflux, 6–12 h, 75–90%; (f) OsO₄, NMO, t-BuOH/acetone/H₂O, rt, 2–6 h, 60–81%; (g) NaIO₄, RuCl₃, CH₃CN/CCl₄/H₂O, rt, 2–4 h, 67–85%; (h) ArB(OH)₂, Pd(PPh₃)₄, K₂CO₃, EtOH/H₂O, microwave, 120–150 °C, 20–30 min, 60–75%; (i) NH₂OTHP, CDI, toluene, reflux, 12 h; (j) p-TSA hydrate, MeOH, 2–3 h, rt, 35–55% over two steps.
Figure 3
Figure 3. Binding mode of compound 20i. Left: structure of full length RT with two subunits p66 and p51 (orange). p66 subunit comprises fingers (blue), palm (red), thumb (green), connection (yellow), and RNase H (magenta) domains. Compounds 7 (green) and 20i (cyan) are docked into the RNase H active site. Right: a close-up view of RNase H active site with predicted binding mode of compound 7 (green) and 20i (cyan). Metal cofactors (Mn²⁺) are colored in gray, with the active site residues (D443, E478, D498 and D549) in yellow. Pictures were generated using PyMol. (41)
High Resolution Image
Download MS PowerPoint Slide
References
This article references 55 other publications.
1. 1
  AIDSinfo; UNAIDS: Geneva 2013; http://www.unaids.org/en/dataanalysis/datatools/aidsinfo/.
  There is no corresponding record for this reference.
2. 2
  Barouch, D. H. Challenges in the development of an HIV-1 vaccine Nature 2008, 455, 613– 619
  There is no corresponding record for this reference.
3. 3
  Schiffner, T.; Sattentau, Q. J.; Dorrell, L. Development of prophylactic vaccines against HIV-1 Retrovirology 2013, 10, 72
  There is no corresponding record for this reference.
4. 4
  Zhang, J.; Crumpacker, C. Eradication of HIV and Cure of AIDS, Now and How? Front. Immunol. 2013, 4, 337
  4
  Eradication of HIV and Cure of AIDS, Now and How?
  Zhang Jielin; Crumpacker Clyde
  Frontiers in immunology (2013), 4 (), 337 ISSN:1664-3224.
  Recent studies have highlighted the importance of eradication of human immunodeficiency virus (HIV) and cure of acquired immunodeficiency syndrome (AIDS). However, a pivotal point that the patient immunity controls HIV reactivation after highly active anti-retroviral therapy [HAART or combination anti-retroviral therapy (cART)] remains less well addressed. In spite of the fact that both innate and adaptive immunities are indispensable and numerous cells participate in the anti-HIV immunity, memory CD4 T-cells are indisputably the key cells organizing all immune actions against HIV while being the targets of HIV. Here we present a view and multidisciplinary approaches to HIV/AIDS eradication and cure. We aim at memory CD4 T-cells, utilizing the stem cell properties of these cells to reprogram an anti-HIV memory repertoire to eliminate the viral reservoir, toward achieving an AIDS-free world.
5. 5
  Siliciano, J. D.; Siliciano, R. F. HIV-1 eradication strategies: design and assessment Curr. Opin. HIV AIDS 2013, 8, 318– 325
  5
  HIV-1 eradication strategies: design and assessment
  Siliciano Janet D; Siliciano Robert F
  Current opinion in HIV and AIDS (2013), 8 (4), 318-25 ISSN:.
  PURPOSE OF REVIEW: Recent developments have generated renewed interest in the possibility of curing HIV-1 infection. This review describes some of the practical challenges that will need to be overcome if curative strategies are to be successful. RECENT FINDINGS: The latent reservoir for HIV-1 in resting memory CD4 T cells is the major barrier to curing the infection. The most widely discussed approach to curing the infection involves finding agents that reverse latency in resting CD4 T cells, with the assumption that the cells will then die from viral cytopathic effects or be lysed by host cytolytic T lymphocytes (CTLs). A major challenge is the development of in-vitro models that can be used to explore mechanisms and identify latency-reversing agents (LRAs). Although several models have been developed, including primary cell models, none of them may fully capture the quiescent state of the cells that harbour latent HIV-1 in vivo. An additional problem is that LRAs that do not cause T-cell activation may not lead to the death of infected cells. Finally, measuring the effects of LRAs in vivo is complicated by the lack of correlation between different assays for the latent reservoir. SUMMARY: Progress on these practical issues is essential to finding a cure.
6. 6
  Xing, S.; Siliciano, R. F. Targeting HIV latency: pharmacologic strategies toward eradication Drug Discovery Today 2013, 18, 541– 551
  There is no corresponding record for this reference.
7. 7
  Beilhartz, G. L.; Gotte, M. HIV-1 Ribonuclease H: Structure, Catalytic Mechanism and Inhibitors Viruses 2010, 2, 900– 926
  7
  HIV-1 ribonuclease H: structure, catalytic mechanism and inhibitors
  Beilhartz, Greg L.; Gotte, Matthias
  Viruses (2010), 2 (), 900-926CODEN: VIRUBR; ISSN:1999-4915. (Molecular Diversity Preservation International)
  A review. Since the human immunodeficiency virus (HIV) was discovered as the etiol. agent of acquired immunodeficiency syndrome (AIDS), it has encouraged much research into antiviral compds. The reverse transcriptase (RT) of HIV has been a main target for antiviral drugs. However, all drugs developed so far inhibit the polymerase function of the enzyme, while none of the approved antiviral agents inhibit specifically the necessary RNase H (RNase H) function of RT. This review provides a background on structure-function relationships of HIV-1 RNase H, as well as an outline of current attempts to develop novel, potent chemotherapeutics against a difficult drug target.
8. 8
  Sarafianos, S. G.; Marchand, B.; Das, K.; Himmel, D. M.; Parniak, M. A.; Hughes, S. H.; Arnold, E. Structure and function of HIV-1 reverse transcriptase: molecular mechanisms of polymerization and inhibition J. Mol. Biol. 2009, 385, 693– 713
  8
  Structure and function of HIV-1 reverse transcriptase: Molecular mechanisms of polymerization and inhibition
  Sarafianos, Stefan G.; Marchand, Bruno; Das, Kalyan; Himmel, Daniel M.; Parniak, Michael A.; Hughes, Stephen H.; Arnold, Eddy
  Journal of Molecular Biology (2009), 385 (3), 693-713CODEN: JMOBAK; ISSN:0022-2836. (Elsevier Ltd.)
  A review. The rapid replication of the HIV-1 virus and errors made during viral replication cause the virus to evolve rapidly in patients, making the problems of vaccine development and drug therapy particularly challenging. In the absence of an effective vaccine, drugs are the only useful treatment. Anti-HIV drugs work; so far drug therapy has saved more than 3 × 106 yr of life. Unfortunately, HIV-1 virus develops resistance to all of the available drugs. Although a no. of useful anti-HIV drugs have been approved for use in patients, the problems assocd. with drug toxicity and the development of resistance means that the search for new drugs is an ongoing process. The 3 viral enzymes, reverse transcriptase (RT), integrase (IN), and protease (PR) are all good drug targets. Two distinct types of RT inhibitors, both of which block the polymerase activity of RT, have been approved to treat HIV-1 infections, nucleoside analogs (NRTIs) and non-nucleosides (NNRTIs), and there are promising leads for compds. that either block the RNase H activity or block the polymerase in other ways. A better understanding of the structure and function(s) of RT and of the mechanism(s) of inhibition can be used to generate better drugs; in particular, drugs that are effective against the current drug-resistant strains of HIV-1.
9. 9
  Cihlar, T.; Ray, A. S. Nucleoside and nucleotide HIV reverse transcriptase inhibitors: 25 years after zidovudine Antiviral Res. 2010, 85, 39– 58
  9
  Nucleoside and nucleotide HIV reverse transcriptase inhibitors: 25 years after zidovudine
  Cihlar, Tomas; Ray, Adrian S.
  Antiviral Research (2010), 85 (1), 39-58CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)
  A review. Twenty-five years ago, nucleoside analog 3'-azidothymidine (AZT) was shown to efficiently block the replication of HIV in cell culture. Subsequent studies demonstrated that AZT acts via the selective inhibition of HIV reverse transcriptase (RT) by its triphosphate metabolite. These discoveries have established the first class of antiretroviral agents: nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs). Over the years that followed, NRTIs evolved into the main component of antiretroviral drug combinations that are now used for the treatment of all populations of HIV infected patients. A total of thirteen NRTI drug products are now available for clin. application: eight individual NRTIs, four fixed-dose combinations of two or three NRTIs, and one complete fixed-dose regimen contg. two NRTIs and one non-nucleoside RT inhibitor. Multiple NRTIs or their prodrugs are in various stages of clin. development and new potent NRTIs are still being identified through drug discovery efforts. This article will review basic principles of the in vitro and in vivo pharmacol. of NRTIs, discuss their clin. use including limitations assocd. with long-term NRTI therapy, and describe newly identified NRTIs with promising pharmacol. profiles highlighting those in the development pipeline. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, vol. 85, issue 1, 2010.
10. 10
  de Bethune, M. P. Non-nucleoside reverse transcriptase inhibitors (NNRTIs), their discovery, development, and use in the treatment of HIV-1 infection: a review of the last 20 years (1989–2009) Antiviral Res. 2010, 85, 75– 90
  There is no corresponding record for this reference.
11. 11
  Corona, A.; Masaoka, T.; Tocco, G.; Tramontano, E.; Le Grice, S. F. Active site and allosteric inhibitors of the ribonuclease H activity of HIV reverse transcriptase Future Med. Chem. 2013, 5, 2127– 2139
  11
  Active site and allosteric inhibitors of the ribonuclease H activity of HIV reverse transcriptase
  Corona, Angela; Masaoka, Takashi; Tocco, Graziella; Tramontano, Enzo; Le Grice, Stuart FJ
  Future Medicinal Chemistry (2013), 5 (18), 2127-2139CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)
  A review. Despite the wealth of information available for the reverse transcriptase (RT)-assocd. RNase H (RNaseH) domain of lentiviruses, gamma-retroviruses and long terminal repeat contg. retrotransposons, exploiting this information in the form of an RNaseH inhibitor with high specificity and low cellular toxicity has been disappointing. However, it is now becoming increasingly evident that the two-subunit HIV-1 RT is a highly versatile enzyme, undergoing major structural alterations in order to interact with, position and ultimately hydrolyze the RNA component of an RNA/DNA hybrid. Thus, in addn. to targeting the RNaseH active site, identifying small mols. that bind elsewhere and disrupt catalysis allosterically by impairing conformational flexibility is gaining increased attention. This review summarizes current progress towards development of both active site and allosteric RNaseH inhibitors.
12. 12
  Ilina, T.; Labarge, K.; Sarafianos, S. G.; Ishima, R.; Parniak, M. A. Inhibitors of HIV-1 Reverse Transcriptase-Associated Ribonuclease H Activity Biology (Basel, Switzerland) 2012, 1, 521– 541
  12
  Inhibitors of HIV-1 reverse transcriptase - associated ribonuclease H activity
  Ilina, Tatiana; LaBarge, Krystal; Sarafianos, Stefan G.; Ishima, Rieko; Parniak, Michael A.
  Biology (Basel, Switzerland) (2012), 1 (3), 521-541CODEN: BBSIBX; ISSN:2079-7737. (MDPI AG)
  A review. HIV-1 enzyme reverse transcriptase (RT) is a major target for antiviral drug development, with over half of current FDA-approved therapeutics against HIV infection targeting the DNA polymerase activity of this enzyme. HIV-1 RT is a multifunctional enzyme that has RNA and DNA dependent polymerase activity, along with RNase H (RNase H) activity. The latter is responsible for degrdn. of the viral genomic RNA template during first strand DNA synthesis to allow completion of reverse transcription and the viral dsDNA. While the RNase H activity of RT has been shown to be essential for virus infectivity, all currently used drugs directed at RT inhibit the polymerase activity of the enzyme; none target RNase H. In the last decade, the increasing prevalence of HIV variants resistant to clin. used antiretrovirals has stimulated the search for inhibitors directed at stages of HIV replication different than those targeted by current drugs. HIV RNase H is one such novel target and, over the past few years, significant progress has been made in identifying and characterizing new RNase H inhibitor pharmacophores. In this review we focus mainly on the most potent low micromolar potency compds., as these provide logical bases for further development. We also discuss why HIV RNase H has been a difficult target for antiretroviral drug development.
13. 13
  Klumpp, K.; Hang, J. Q.; Rajendran, S.; Yang, Y. L.; Derosier, A.; In, P. W. K.; Overton, H.; Parkes, K. E. B.; Cammack, N.; Martin, J. A. Two-metal ion mechanism of RNA cleavage by HIV RNase H and mechanism-based design of selective HIV RNase H inhibitors Nucleic Acids Res. 2003, 31, 6852– 6859
  13
  Two-metal ion mechanism of RNA cleavage by HIV RNase H and mechanism-based design of selective HIV RNase H inhibitors
  Klumpp, Klaus; Hang, Julie Qi; Rajendran, Surendran; Yang, Yanli; Derosier, Andre; In, Philippe Wong Kai; Overton, Hilary; Parkes, Kevin E. B.; Cammack, Nick; Martin, Joseph A.
  Nucleic Acids Research (2003), 31 (23), 6852-6859CODEN: NARHAD; ISSN:0305-1048. (Oxford University Press)
  Human immunodeficiency virus (HIV) RNase H activity is essential for the synthesis of viral DNA by HIV reverse transcriptase (HIV-RT). RNA cleavage by RNase H requires the presence of divalent metal ions, but the role of metal ions in the mechanism of RNA cleavage has not been resolved. We measured HIV RNase H activity assocd. with HIV-RT protein in the presence of different concns. of either Mg2+, Mn2+, Co2+ or a combination of these divalent metal ions. Polymerase-independent HIV RNase H was similar to or more active with Mn2+ and Co2+ compared with Mg2+. Activation of RNase H by these metal ions followed sigmoidal dose-response curves suggesting cooperative metal ion binding. Titrn. of Mg2+-bound HIV RNase H with Mn2+ or Co2+ ions generated bell-shaped activity dose-response curves. Higher activity could be achieved through simultaneous binding of more than one divalent metal ion at intermediate Mn2+ and Co2+ concns., and complete replacement of Mg2+ occurred at higher Mn2+ or Co2+ concns. These results are consistent with a two-metal ion mechanism of RNA cleavage as previously suggested for a no. of polymerase-assocd. nucleases. In contrast, the structurally highly homologous RNase HI from Escherichia coli is most strongly activated by Mg2+, is significantly inhibited by submillimolar concns. of Mn2+ and most probably cleaves RNA via a one-metal ion mechanism. Based on this difference in active site structure, a series of small mol. N-hydroxyimides was identified with significant enzyme inhibitory potency and selectivity for HIV RNase H.
14. 14
  Himmel, D. M.; Sarafianos, S. G.; Dharmasena, S.; Hossain, M. M.; McCoy-Simandle, K.; Ilina, T.; Clark, A. D.; Knight, J. L.; Julias, J. G.; Clark, P. K.; Krogh-Jespersen, K.; Levy, R. M.; Hughes, S. H.; Parniak, M. A.; Arnold, E. HIV-1 reverse transcriptase structure with RNase H inhibitor dihydroxy benzoyl naphthyl hydrazone bound at a novel site ACS Chem. Biol. 2006, 1, 702– 712
  14
  HIV-1 Reverse Transcriptase Structure with RNase H Inhibitor Dihydroxy Benzoyl Naphthyl Hydrazone Bound at a Novel Site
  Himmel, Daniel M.; Sarafianos, Stefan G.; Dharmasena, Sanjeewa; Hossain, Mohammed M.; McCoy-Simandle, Kessler; Ilina, Tatiana; Clark, Arthur D., Jr.; Knight, Jennifer L.; Julias, John G.; Clark, Patrick K.; Krogh-Jespersen, Karsten; Levy, Ronald M.; Hughes, Stephen H.; Parniak, Michael A.; Arnold, Eddy
  ACS Chemical Biology (2006), 1 (11), 702-712CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)
  The rapid emergence of drug-resistant variants of human immunodeficiency virus, type 1 (HIV-1), has limited the efficacy of anti-acquired immune deficiency syndrome (AIDS) treatments, and new lead compds. that target novel binding sites are needed. The authors have detd. the 3.15 Å resoln. crystal structure of HIV-1 reverse transcriptase (RT) complexed with dihydroxy benzoyl naphthyl hydrazone (DHBNH), an HIV-1 RT RNase H (RNH) inhibitor (RNHI). DHBNH is effective against a variety of drug-resistant HIV-1 RT mutants. While DHBNH has little effect on most aspects of RT-catalyzed DNA synthesis, at relatively high concns. it does inhibit the initiation of RNA-primed DNA synthesis. Although primarily an RNHI, DHBNH binds >50 Å away from the RNH active site, at a novel site near both the polymerase active site and the nonnucleoside RT inhibitor (NNRTI) binding pocket. When DHBNH binds, both Tyr181 and Tyr188 remain in the conformations seen in unliganded HIV-1 RT. DHBNH interacts with conserved residues (Asp186, Trp229) and has substantial interactions with the backbones of several less well-conserved residues. On the basis of this structure, the authors designed substituted DHBNH derivs. that interact with the NNRTI-binding pocket. These compds. inhibit both the polymerase and RNH activities of RT.
15. 15
  Fuji, H.; Urano, E.; Futahashi, Y.; Hamatake, M.; Tatsumi, J.; Hoshino, T.; Morikawa, Y.; Yamamoto, N.; Komano, J. Derivatives of 5-nitro-furan-2-carboxylic acid carbamoylmethyl ester inhibit RNase H activity associated with HIV-1 reverse transcriptase J. Med. Chem. 2009, 52, 1380– 1387
  There is no corresponding record for this reference.
16. 16
  Tramontano, E.; Esposito, F.; Badas, R.; Di Santo, R.; Costi, R.; La Colla, P. 6-[1-(4-Fluorophenyl)methyl-1H-pyrrol-2-yl)]-2,4-dioxo-5-hexenoic acid ethyl ester a novel diketo acid derivative which selectively inhibits the HIV-1 viral replication in cell culture and the ribonuclease H activity in vitro Antiviral Res. 2005, 65, 117– 124
  16
  6-[1-(4-Fluorophenyl)methyl-1H-pyrrol-2-yl]-2,4-dioxo-5-hexenoic acid ethyl ester a novel diketo acid derivative which selectively inhibits the HIV-1 viral replication in cell culture and the ribonuclease H activity in vitro
  Tramontano, Enzo; Esposito, Francesca; Badas, Roberta; Di Santo, Roberto; Costi, Roberta; La Colla, Paolo
  Antiviral Research (2005), 65 (2), 117-124CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)
  The human immunodeficiency virus-type 1 (HIV-1) reverse transcriptase (RT) is a multifunctional enzyme which displays DNA polymerase activity, which recognizes RNA and DNA templates, and a degradative RNase H activity. While both RT functions are required for retroviral replication, until now only the polymerase function has been widely explored as drug target. We have identified a novel diketo acid deriv., 6-[1-(4-fluorophenyl)methyl-1H-pyrrol-2-yl]-2,4-dioxo-5-hexenoic acid Et ester (RDS 1643), which inhibits in enzyme assays the HIV-1 RT-assocd. polymerase-independent RNase H activity but has no effect on the HIV-1 RT-assocd. RNA-dependent DNA polymerase (RDDP) activity and on the RNase H activities displayed by the Avian Myeloblastosis Virus and E. coli. Time-dependence studies revealed that the compd. is active independently on the order of its addn. to the reaction mixt., and inhibition kinetics studies demonstrated that RDS 1643 inhibits the RNase H activity noncompetitively, with a KI value of 17 μM. When RDS 1643 was combined with non-nucleoside RT inhibitors (NNRTI), such as efavirenz and nevirapine, results indicated that RDS 1643 does not affect the NNRTIs anti-RDDP activity and that, vice versa, the NNRTIs do not alter the RNase H inhibition by RDS 1643. When assayed on the viral replication in cell-based assays, RDS 1643 inhibited the HIV-1IIIB strain with an EC50 of 14 μM. Similar results were obtained against the Y181C and Y181C/K103N HIV-1 NNRTI resistant mutant strains. RDS 1643 may be the first HIV-1 inhibitor selectively targeted to the viral RT-assocd. RNase-H function.
17. 17
  Lansdon, E. B.; Liu, Q.; Leavitt, S. A.; Balakrishnan, M.; Perry, J. K.; Lancaster-Moyer, C.; Kutty, N.; Liu, X.; Squires, N. H.; Watkins, W. J.; Kirschberg, T. A. Structural and binding analysis of pyrimidinol carboxylic acid and N-hydroxy quinazolinedione HIV-1 RNase H inhibitors Antimicrob. Agents Chemother. 2011, 55, 2905– 2915
  There is no corresponding record for this reference.
18. 18
  Williams, P. D.; Staas, D. D.; Venkatraman, S.; Loughran, H. M.; Ruzek, R. D.; Booth, T. M.; Lyle, T. A.; Wai, J. S.; Vacca, J. P.; Feuston, B. P.; Ecto, L. T.; Flynn, J. A.; DiStefano, D. J.; Hazuda, D. J.; Bahnck, C. M.; Himmelberger, A. L.; Dornadula, G.; Hrin, R. C.; Stillmock, K. A.; Witmer, M. V.; Miller, M. D.; Grobler, J. A. Potent and selective HIV-1 ribonuclease H inhibitors based on a 1-hydroxy-1,8-naphthyridin-2(1H)-one scaffold Bioorg. Med. Chem. Lett. 2010, 20, 6754– 6757
  There is no corresponding record for this reference.
19. 19
  Gerondelis, P.; Johns, B. A., The development of novel pyrido-pyrimidinone antiretrovirals with selective activity against HIV ribonuclease H. , Cold Spring Harbor Laboratories Conference on Retroviruses, Cold Spring Harbor, NY, May 21–26, 2012; Cold Spring Harbor Press: Cold Spring Harbor, NY, 2012.
  There is no corresponding record for this reference.
20. 20
  Beilhartz, G. L.; Ngure, M.; Johns, B. A.; DeAnda, F.; Gerondelis, P.; Gotte, M. Inhibition of the Ribonuclease H Activity of HIV-1 Reverse Transcriptase by GSK5750 Correlates with Slow Enzyme–Inhibitor Dissociation J. Biol. Chem. 2014, 289, 16270– 16277
  There is no corresponding record for this reference.
21. 21
  Chen, Y. L.; Tang, J.; Kesler, M. J.; Sham, Y. Y.; Vince, R.; Geraghty, R. J.; Wang, Z. Q. The design, synthesis and biological evaluations of C-6 or C-7 substituted 2-hydroxyisoquinoline-1,3-diones as inhibitors of hepatitis C virus Bioorg. Med. Chem. 2012, 20, 467– 479
  There is no corresponding record for this reference.
22. 22
  Billamboz, M.; Bailly, F.; Lion, C.; Calmels, C.; Andreola, M. L.; Witvrouw, M.; Christ, F.; Debyser, Z.; De Luca, L.; Chimirri, A.; Cotelle, P. 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as inhibitors of HIV-1 integrase and reverse transcriptase RNase H domain: influence of the alkylation of position 4 Eur. J. Med. Chem. 2011, 46, 535– 546
  There is no corresponding record for this reference.
23. 23
  Billamboz, M.; Suchaud, V.; Bailly, F.; Lion, C.; Demeulemeester, J.; Calmels, C.; Andreola, M. L.; Christ, F.; Debyser, Z.; Cotelle, P. 4-Substituted 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as a Novel Class of HIV-1 Integrase Inhibitors ACS Med. Chem. Lett. 2013, 4, 41– 46
  There is no corresponding record for this reference.
24. 24
  Desimmie, B. A.; Demeulemeester, J.; Suchaud, V.; Taltynov, O.; Billamboz, M.; Lion, C.; Bailly, F.; Strelkov, S. V.; Debyser, Z.; Cotelle, P.; Christ, F. 2-Hydroxyisoquinoline-1,3(2H,4H)-diones (HIDs), Novel Inhibitors of HIV Integrase with a High Barrier to Resistance ACS Chem. Biol. 2013, 8, 1187– 1194
  There is no corresponding record for this reference.
25. 25
  Suchaud, V.; Bailly, F.; Lion, C.; Calmels, C.; Andréola, M.-L.; Christ, F.; Debyser, Z.; Cotelle, P. Investigation of a Novel Series of 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as Human Immunodeficiency Virus Type 1 Integrase Inhibitors J. Med. Chem. 2014, 57, 4640– 4660http://dx.doi.org/10.1021/jm500109z
  There is no corresponding record for this reference.
26. 26
  Billamboz, M.; Bailly, F.; Lion, C.; Touati, N.; Vezin, H.; Calmels, C.; Andreola, M. L.; Christ, F.; Debyser, Z.; Cotelle, P. Magnesium Chelating 2-Hydroxyisoquinoline-1,3(2H,4H)-diones, as Inhibitors of HIV-1 Integrase and/or the HIV-1 Reverse Transcriptase Ribonuclease H Domain: Discovery of a Novel Selective Inhibitor of the Ribonuclease H Function J. Med. Chem. 2011, 54, 1812– 1824
  26
  Magnesium Chelating 2-Hydroxyisoquinoline-1,3(2H,4H)-diones, as Inhibitors of HIV-1 Integrase and/or the HIV-1 Reverse Transcriptase Ribonuclease H Domain: Discovery of a Novel Selective Inhibitor of the Ribonuclease H Function
  Billamboz, Muriel; Bailly, Fabrice; Lion, Cedric; Touati, Nadia; Vezin, Herve; Calmels, Christina; Andreola, Marie-Line; Christ, Frauke; Debyser, Zeger; Cotelle, Philippe
  Journal of Medicinal Chemistry (2011), 54 (6), 1812-1824CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
  2-Hydroxyisoquinoline-1,3(2H,4H)-dione was recently discovered as a scaffold for the inhibition of HIV-1 integrase and the RNase H function of HIV-1 reverse transcriptase. First, we investigate its interaction with Mg2+ and Mn2+ using different spectroscopic techniques and report that 2-hydroxyisoquinoline-1,3(2H,4H)-dione forms a 1:1 complex with Mg2+ but a 1:2 complex with Mn2+. The complex formation requires enolization of the ligand. ESR spectroscopy shows a redox reaction between the ligand and Mn2+ producing superoxide anions. Second, 2-hydroxyisoquinoline-1,3(2H,4H)-dione, its magnesium complex, and its 4-Me and 2-hydroxy-4-methoxycarbonylisoquinoline-1,3(2H,4H)-diones were tested as inhibitors of HIV-1 integrase, reverse transcriptase RNase H, and DNA polymerase functions. Their antiviral activities were evaluated and 2-hydroxy-4-methoxycarbonyl-isoquinoline-1,3(2H,4H)-dione was found to inhibit the viral replication of HIV-1 in MT-4 cells. Cross-resistance was measured for this compd. on three different viral strains. Exptl. data suggest that the antiviral activity of 2-hydroxy-4-methoxycarbonylisoquinoline-1,3(2H,4H)-dione is probably due to the RNase H inhibition.
27. 27
  Billamboz, M.; Bailly, F.; Barreca, M. L.; De Luca, L.; Mouscadet, J. F.; Calmels, C.; Andreola, M. L.; Witvrouw, M.; Christ, F.; Debyser, Z.; Cotelle, P. Design, Synthesis, and Biological Evaluation of a Series of 2-Hydroxyisoquinoline-1,3(2H,4H)-diones as Dual Inhibitors of Human Immunodeficiency Virus Type 1 Integrase and the Reverse Transcriptase RNase H Domain J. Med. Chem. 2008, 51, 7717– 7730
  There is no corresponding record for this reference.
28. 28
  Barluenga, J.; Tomas-Gamasa, M.; Aznar, F.; Valdes, C. Metal-free carbon–carbon bond-forming reductive coupling between boronic acids and tosylhydrazones Nature Chem. 2009, 1, 494– 499
  28
  Metal-free carbon-carbon bond-forming reductive coupling between boronic acids and tosylhydrazones
  Barluenga, Jose; Tomas-Gamasa, Maria; Aznar, Fernando; Valdes, Carlos
  Nature Chemistry (2009), 1 (6), 494-499, S494/1-S494/46CODEN: NCAHBB; ISSN:1755-4330. (Nature Publishing Group)
  The formation of carbon-carbon bonds is a fundamental transformation in org. synthesis. In spite of the myriad methods available, advantageous methodologies in terms of selectivity, availability of starting materials, operational simplicity, functional-group tolerance, environmental sustainability and economy are in const. demand. In this context, the development of new cross-coupling reactions that use catalysts based on inexpensive and non-toxic metals is attracting increasing attention. Similarly, efficient processes that do not require a metal catalyst are of extraordinary interest. Here, we report a new and efficient metal-free carbon-carbon bond-forming coupling between tosylhydrazones and boronic acids. This reaction is very general and functional-group tolerant. As the required tosylhydrazones are easily generated from carbonyl compds., it can be seen as a reductive coupling of carbonyls, a process of high synthetic relevance that requires several steps using other methodologies.
29. 29
  Vanrheenen, V.; Cha, D. Y.; Hartley, W. M. Catalytic Osmium-Tetroxide Oxidation of Olefins—cis-1,2-Cyclohexanediol Org. Synth. 1988, 50–9, 342– 348
  There is no corresponding record for this reference.
30. 30
  Vanrheenen, V.; Kelly, R. C.; Cha, D. Y. Improved Catalytic OsO₄ Oxidation of Olefins to cis-1,2-Glycols Using Tertiary Amine Oxides as Oxidant Tetrahedron Lett. 1976, 1973– 1976
  There is no corresponding record for this reference.
31. 31
  Yang, D.; Zhang, C. Ruthenium-catalyzed oxidative cleavage of olefins to aldehydes J. Org. Chem. 2001, 66, 4814– 4818
  31
  Ruthenium-Catalyzed Oxidative Cleavage of Olefins to Aldehydes
  Yang, Dan; Zhang, Chi
  Journal of Organic Chemistry (2001), 66 (14), 4814-4818CODEN: JOCEAH; ISSN:0022-3263. (American Chemical Society)
  Three oxidn. protocols have been developed to cleave olefins to carbonyl compds. with ruthenium trichloride as catalyst (3.5 mol %). These methods convert olefins that are not fully substituted to aldehydes rather than carboxylic acids. While aryl olefins were cleaved to arom. aldehydes in excellent yields by using the system of RuCl3-Oxone-NaHCO3 in CH3CN-H2O (1.5:1), aliph. olefins were converted into alkyl aldehydes with RuCl3-NaIO4 in 1,2-dichloroethane-H2O (1:1) in good to excellent yields. It is noteworthy that terminal aliph. olefins were cleaved to the corresponding aldehydes in excellent yields by using RuCl3-NaIO4 in CH3CN-H2O (6:1).
32. 32
  Parniak, M. A.; Min, K. L.; Budihas, S. R.; Le Grice, S. F.; Beutler, J. A. A fluorescence-based high-throughput screening assay for inhibitors of human immunodeficiency virus-1 reverse transcriptase-associated ribonuclease H activity Anal. Biochem. 2003, 322, 33– 39
  There is no corresponding record for this reference.
33. 33
  Parniak, M. A.; Min, K. L. Substrate for assaying ribonuclease H activity. US 7,186,520 March6, 2007.
  There is no corresponding record for this reference.
34. 34
  Parniak, M. A.; Min, K. L. Method of identifying or characterizing a compound that modulates ribonuclease H activity. US 7,439,035 October21, 2008.
  There is no corresponding record for this reference.
35. 35
  Nowotny, M. Retroviral integrase superfamily: the structural perspective EMBO Rep. 2009, 10, 144– 151
  35
  Retroviral integrase superfamily: the structural perspective
  Nowotny, Marcin
  EMBO Reports (2009), 10 (2), 144-151CODEN: ERMEAX; ISSN:1469-221X. (Nature Publishing Group)
  A review. The retroviral integrase superfamily (RISF) comprises numerous important nucleic acid-processing enzymes, including transposases, integrases and various nucleases. These enzymes are involved in a wide range of processes such as transposition, replication and repair of DNA, homologous recombination, and RNA-mediated gene silencing. Two out of the four enzymes that are encoded by the human immunodeficiency virus, RNase H1 and integrase, are members of this superfamily. RISF enzymes act on various substrates, and yet show remarkable mechanistic and structural similarities. All share a common fold of the catalytic core and the active site, which is composed primarily of carboxylate residues. Here, RISF proteins are presented from a structural perspective, describing the individual members and the common and divergent elements of their structures, as well as the mechanistic insights gained from the structures of RNase H1 enzyme complexes with RNA/DNA hybrids.
36. 36
  Barreca, M. L.; Ferro, S.; Rao, A.; De Luca, L.; Zappala, M.; Monforte, A. M.; Debyser, Z.; Witvrouw, M.; Chimirri, A. Pharmacophore-based design of HIV-1 integrase strand-transfer inhibitors J. Med. Chem. 2005, 48, 7084– 7088
  There is no corresponding record for this reference.
37. 37
  Abram, M. E.; Parniak, M. A. Virion instability of human immunodeficiency virus type 1 reverse transcriptase (RT) mutated in the protease cleavage site between RT p51 and the RT RNase H domain J. Virol. 2005, 79, 11952– 11961
  37
  Virion instability of human immunodeficiency virus type 1 reverse transcriptase (RT) mutated in the protease cleavage site between RT p51 and the RT RNase H domain
  Abram, Michael E.; Parniak, Michael A.
  Journal of Virology (2005), 79 (18), 11952-11961CODEN: JOVIAM; ISSN:0022-538X. (American Society for Microbiology)
  Each of the human immunodeficiency virus type 1 (HIV-1) pol-encoded enzymes, protease (PR), reverse transcriptase (RT), and integrase (IN), is active only as a dimer (or higher-order oligomer in the case of IN), but only RT comprises subunits of different masses. RT is a heterodimer of 66-kDa and 51-kDa subunits. The latter is formed by HIV PR-catalyzed cleavage of p66 during virion maturation, resulting in the removal of the RNase H (RNH) domain of a p66 subunit. In order to study the apparent need for RT heterodimers in the context of the virion, we introduced a variety of mutations in the RT p51-RNH protease cleavage site of an infectious HIV-1 mol. clone. Surprisingly, rather than leading to virions with increased RT p66 content, most of the mutations resulted in significantly attenuated virus that contained greatly decreased levels of RT that in many cases was primarily p51 RT. IN levels were also reduced in several mutants. However, most mutants showed normal levels of the Pr160gag-pol precursor polyprotein, suggesting that reduced virion RT arose from proteolytic instability rather than decreased incorporation. Mutant virion p24 Gag levels were equiv. to wild type, indicating that Gag incorporation and processing were not affected. Repeated passage of MT-2 cells exposed to mutant viruses led to the appearance of virus with improved replication capacity; these virions contained normally processed RT at near-wild-type levels. These results imply that addnl. proteolytic processing of RT to the p66/p51 heterodimer is essential to provide proteolytic stability of RT during HIV-1 maturation.
38. 38
  Parikh, U. M.; Koontz, D. L.; Chu, C. K.; Schinazi, R. F.; Mellors, J. W. In vitro activity of structurally diverse nucleoside analogs against human immunodeficiency virus type 1 with the K65R mutation in reverse transcriptase Antimicrob. Agents Chemother. 2005, 49, 1139– 1144
  There is no corresponding record for this reference.
39. 39
  Su, H.-P.; Yan, Y.; Prasad, G. S.; Smith, R. F.; Daniels, C. L.; Abeywickrema, P. D.; Reid, J. C.; Loughran, H. M.; Kornienko, M.; Sharma, S.; Grobler, J. A.; Xu, B.; Sardana, V.; Allison, T. J.; Williams, P. D.; Darke, P. L.; Hazuda, D. J.; Munshi, S. Structural Basis for the Inhibition of RNase H Activity of HIV-1 Reverse Transcriptase by RNase H Active Site-Directed Inhibitors J. Virol. 2010, 84, 7625– 7633
  39
  Structural basis for the inhibition of RNase H activity of HIV-1 reverse transcriptase by RNase H active site-directed inhibitors
  Su, Hua-Poo; Yan, Youwei; Prasad, G. Sridhar; Smith, Robert F.; Daniels, Christopher L.; Abeywickrema, Pravien D.; Reid, John C.; Loughran, H. Marie; Kornienko, Maria; Sharma, Sujata; Grobler, Jay A.; Xu, Bei; Sardana, Vinod; Allison, Timothy J.; Williams, Peter D.; Darke, Paul L.; Hazuda, Daria J.; Munshi, Sanjeev
  Journal of Virology (2010), 84 (15), 7625-7633CODEN: JOVIAM; ISSN:0022-538X. (American Society for Microbiology)
  HIV/AIDS continues to be a menace to public health. Several drugs currently on the market have successfully improved the ability to manage the viral burden in infected patients. However, new drugs are needed to combat the rapid emergence of mutated forms of the virus that are resistant to existing therapies. Currently, approved drugs target three of the four major enzyme activities encoded by the virus that are crit. to the HIV life cycle. Although a no. of inhibitors of HIV RNase H activity have been reported, few inhibit by directly engaging the RNase H active site. Here, we describe structures of naphthyridinone-contg. inhibitors bound to the RNase H active site. This class of compds. binds to the active site via two metal ions that are coordinated by catalytic site residues, D443, E478, D498, and D549. The directionality of the naphthyridinone pharmacophore is restricted by the ordering of D549 and H539 in the RNase H domain. In addn., one of the naphthyridinone-based compds. was found to bind at a second site close to the polymerase active site and non-nucleoside/nucleotide inhibitor sites in a metal-independent manner. Further characterization, using fluorescence-based thermal denaturation and a crystal structure of the isolated RNase H domain reveals that this compd. can also bind the RNase H site and retains the metal-dependent binding mode of this class of mols. These structures provide a means for structurally guided design of novel RNase H inhibitors.
40. 40
  Friesner, R. A.; Murphy, R. B.; Repasky, M. P.; Frye, L. L.; Greenwood, J. R.; Halgren, T. A.; Sanschagrin, P. C.; Mainz, D. T. Extra precision glide: docking and scoring incorporating a model of hydrophobic enclosure for protein-ligand complexes J. Med. Chem. 2006, 49, 6177– 6196
  40
  Extra Precision Glide: Docking and Scoring Incorporating a Model of Hydrophobic Enclosure for Protein-Ligand Complexes
  Friesner, Richard A.; Murphy, Robert B.; Repasky, Matthew P.; Frye, Leah L.; Greenwood, Jeremy R.; Halgren, Thomas A.; Sanschagrin, Paul C.; Mainz, Daniel T.
  Journal of Medicinal Chemistry (2006), 49 (21), 6177-6196CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)
  A novel scoring function to est. protein-ligand binding affinities has been developed and implemented as the Glide 4.0 XP scoring function and docking protocol. In addn. to unique water desolvation energy terms, protein-ligand structural motifs leading to enhanced binding affinity are included:(1) hydrophobic enclosure where groups of lipophilic ligand atoms are enclosed on opposite faces by lipophilic protein atoms, (2) neutral-neutral single or correlated hydrogen bonds in a hydrophobically enclosed environment, and (3) five categories of charged-charged hydrogen bonds. The XP scoring function and docking protocol have been developed to reproduce exptl. binding affinities for a set of 198 complexes (RMSDs of 2.26 and 1.73 kcal/mol over all and well-docked ligands, resp.) and to yield quality enrichments for a set of fifteen screens of pharmaceutical importance. Enrichment results demonstrate the importance of the novel XP mol. recognition and water scoring in sepg. active and inactive ligands and avoiding false positives.
41. 41
  PyMOL, The PyMOL Molecular Graphics System, version 1.5.0.4; Schrödinger, LLC: New York 2013.
  There is no corresponding record for this reference.
42. 42
  Fletcher, R. S.; Holleschak, G.; Nagy, E.; Arion, D.; Borkow, G.; Gu, Z.; Wainberg, M. A.; Parniak, M. A. Single-step purification of recombinant wild-type and mutant HIV-1 reverse transcriptase Protein Express. Purif. 1996, 7, 27– 32
  42
  Single-step purification of recombinant wild-type and mutant HIV-1 reverse transcriptase
  Fletcher, Ronald S.; Holleschak, Gyula; Nagy, Eva; Arion, Dominique; Borkow, Gadi; Gu, Zhengxian; Wainberg, Mark A.; Parniak, Michael A.
  Protein Expression and Purification (1996), 7 (1), 27-32CODEN: PEXPEJ; ISSN:1046-5928. (Academic)
  A single-step method that enables the purifn. of HIV-1 recombinant reverse transcriptase (RT) directly from bacterial lysates in <2 h is described. Clarified lysates were applied to com. Q- and S-matrix cartridge columns connected in series. The columns were washed with low-salt buffer to remove unbound protein, then the Q column was removed and RT was eluted from the S column using a salt gradient. The purifn. was carried out with both medium-pressure and high-pressure chromatog. systems. The purifns. were carried out at room temp. near neutral pH, providing enzyme with high DNA polymerase specific activity. A crucial aspect of the procedure was the use of Tris buffer, a buffer that is normally incompatible in cation-exchange methods. The method was applicable for the purifn. of the p51/p66 heterodimer and the p51 and p66 homodimer forms of RT. This method was used to purify wild-type RT and several recombinant RT proteins contg. mutations correlated with dideoxynucleoside drug resistance.
43. 43
  Gong, Q.; Menon, L.; Ilina, T.; Miller, L. G.; Ahn, J.; Parniak, M. A.; Ishima, R. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor Chem. Biol. Drug Des. 2011, 77, 39– 47
  43
  Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor
  Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G.; Ahn, Jinwoo; Parniak, Michael A.; Ishima, Rieko
  Chemical Biology & Drug Design (2010), 77 (1), 39-47CODEN: CBDDAL; ISSN:1747-0277. (Wiley-Blackwell)
  HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and RNase H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clin. used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase RNase H are on the market or in preclin. development. Several drug-like small mol. inhibitors of reverse transcriptase RNase H have been described, but little structural information is available about the interactions between reverse transcriptase RNase H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new RNase H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase RNase H domain fragment. We carried out soln. NMR expts. to identify the interaction interface of BHMP07 with the RNase H domain fragment. Chem. shift changes of backbone amide signals at different BHMP07 concns. clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the RNase H fragment. Using RNase H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the RNase H inhibitor interaction and are likely to be useful for further improvements of the inhibitors.
44. 44
  Dabora, J. M.; Marqusee, S. Equilibrium unfolding of Escherichia coli ribonuclease H: characterization of a partially folded state Protein Sci. 1994, 3, 1401– 1408
  44
  Equilibrium unfolding of Escherichia coli ribonuclease H: characterization of a partially folded state
  Dabora, Jonathan M.; Marqusee, Susan
  Protein Science (1994), 3 (9), 1401-8CODEN: PRCIEI; ISSN:0961-8368.
  The equil. unfolding of Escherichia coli RNase HI (RNase H), a member of a family of enzymes the cleaves RNA from RNA:DNA hybrids, was examd. A completely synthetic gene was constructed that expresses a variant of the wild-type sequence with all 3 cysteines replaced with alanine. The resulting recombinant protein is active and folds reversibly. Denaturation studies monitored by CD and tryptophan fluorescence yield coincident curves that suggest that the equil. unfolding reaction is a 2-state process. Acid denaturation, however, reveals a cooperative transition at pH ∼1.8 to a partially folded state. This acid state can be further denatured in a reversible manner by the addn. of heat or urea as monitored by either CD or tryptophan fluorescence. Anal. ultracentrifugation studies indicate that the acid state of RNase H is both compact and monomeric. Although compact, the acid state does not resemble the native protein: the acid state displays a near-UV CD spectrum similar to the unfolded state and binds to and enhances the fluorescence of the dye 1-anilinonaphthalene 8-sulfonate much more than either the native or unfolded states. Therefore, the acid state of E. coli RNase H has the characteristics of a molten globule: it retains a high degree of secondary structure, remains compact, yet does not appear to contain a tightly packed core.
45. 45
  Ndongwe, T. P.; Adedeji, A. O.; Michailidis, E.; Ong, Y. T.; Hachiya, A.; Marchand, B.; Ryan, E. M.; Rai, D. K.; Kirby, K. A.; Whatley, A. S.; Burke, D. H.; Johnson, M.; Ding, S.; Zheng, Y. M.; Liu, S. L.; Kodama, E.; Delviks-Frankenberry, K. A.; Pathak, V. K.; Mitsuya, H.; Parniak, M. A.; Singh, K.; Sarafianos, S. G. Biochemical, inhibition and inhibitor resistance studies of xenotropic murine leukemia virus-related virus reverse transcriptase Nucleic Acids Res. 2012, 40, 345– 359
  There is no corresponding record for this reference.
46. 46
  Kirby, K. A.; Marchand, B.; Ong, Y. T.; Ndongwe, T. P.; Hachiya, A.; Michailidis, E.; Leslie, M. D.; Sietsema, D. V.; Fetterly, T. L.; Dorst, C. A.; Singh, K.; Wang, Z.; Parniak, M. A.; Sarafianos, S. G. Structural and inhibition studies of the RNase H function of xenotropic murine leukemia virus-related virus reverse transcriptase Antimicrob. Agents Chemother. 2012, 56, 2048– 2061
  There is no corresponding record for this reference.
47. 47
  Michailidis, E.; Marchand, B.; Kodama, E. N.; Singh, K.; Matsuoka, M.; Kirby, K. A.; Ryan, E. M.; Sawani, A. M.; Nagy, E.; Ashida, N.; Mitsuya, H.; Parniak, M. A.; Sarafianos, S. G. Mechanism of inhibition of HIV-1 reverse transcriptase by 4′-ethynyl-2-fluoro-2′-deoxyadenosine triphosphate, a translocation-defective reverse transcriptase inhibitor J. Biol. Chem. 2009, 284, 35681– 35691
  There is no corresponding record for this reference.
48. 48
  Wang, Z.; Bennett, E. M.; Wilson, D. J.; Salomon, C.; Vince, R. Rationally designed dual inhibitors of HIV reverse transcriptase and integrase J. Med. Chem. 2007, 50, 3416– 3419
  There is no corresponding record for this reference.
49. 49
  Sirivolu, V. R.; Vernekar, S. K. V.; Ilina, T.; Myshakina, N. S.; Parniak, M. A.; Wang, Z. Q. Clicking 3′-Azidothymidine into Novel Potent Inhibitors of Human Immunodeficiency Virus J. Med. Chem. 2013, 56, 8765– 8780
  There is no corresponding record for this reference.
50. 50
  HIV-1 reverse transcriptase with inhibitor; RCSB Protein Data Bank: Piscataway, NJ, 2010; http://www.rcsb.org/pdb/explore.do?structureId=3LP1, DOI: DOI: 10.2210/pdb3lp1/pdb .
  There is no corresponding record for this reference.
51. 51
  Sastry, G. M.; Adzhigirey, M.; Day, T.; Annabhimoju, R.; Sherman, W. Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments J. Comput.-Aided Mol. Des. 2013, 27, 221– 234
  51
  Protein and ligand preparation: parameters, protocols, and influence on virtual screening enrichments
  Sastry G Madhavi; Adzhigirey Matvey; Day Tyler; Annabhimoju Ramakrishna; Sherman Woody
  Journal of computer-aided molecular design (2013), 27 (3), 221-34 ISSN:.
  Structure-based virtual screening plays an important role in drug discovery and complements other screening approaches. In general, protein crystal structures are prepared prior to docking in order to add hydrogen atoms, optimize hydrogen bonds, remove atomic clashes, and perform other operations that are not part of the x-ray crystal structure refinement process. In addition, ligands must be prepared to create 3-dimensional geometries, assign proper bond orders, and generate accessible tautomer and ionization states prior to virtual screening. While the prerequisite for proper system preparation is generally accepted in the field, an extensive study of the preparation steps and their effect on virtual screening enrichments has not been performed. In this work, we systematically explore each of the steps involved in preparing a system for virtual screening. We first explore a large number of parameters using the Glide validation set of 36 crystal structures and 1,000 decoys. We then apply a subset of protocols to the DUD database. We show that database enrichment is improved with proper preparation and that neglecting certain steps of the preparation process produces a systematic degradation in enrichments, which can be large for some targets. We provide examples illustrating the structural changes introduced by the preparation that impact database enrichment. While the work presented here was performed with the Protein Preparation Wizard and Glide, the insights and guidance are expected to be generalizable to structure-based virtual screening with other docking methods.
52. 52
  (a) Schrödinger Release 2013-2: Schrödinger Suite 2013 Protein Preparation Wizard; Schrödinger, LLC: New York, 2013;
  There is no corresponding record for this reference.
  (b) Schrödinger Release 2013-2: Epik, version 2.5; Schrödinger, LLC: New York, 2013;
  There is no corresponding record for this reference.
  (c) Schrödinger Release 2013-2: Impact, version 6.0; Schrödinger, LLC: New York, 2013;
  There is no corresponding record for this reference.
  (d) Schrödinger Release 2013-2: Prime, version 3; Schrödinger, LLC: New York, 2013.
  There is no corresponding record for this reference.
53. 53
  Jorgensen, W. L.; Maxwell, D. S.; TiradoRives, J. Development and testing of the OPLS all-atom force field on conformational energetics and properties of organic liquids J. Am. Chem. Soc. 1996, 118, 11225– 11236
  53
  Development and Testing of the OPLS All-Atom Force Field on Conformational Energetics and Properties of Organic Liquids
  Jorgensen, William L.; Maxwell, David S.; Tirado-Rives, Julian
  Journal of the American Chemical Society (1996), 118 (45), 11225-11236CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
  The parametrization and testing of the OPLS all-atom force field for org. mols. and peptides are described. Parameters for both torsional and nonbonded energetics have been derived, while the bond stretching and angle bending parameters have been adopted mostly from the AMBER all-atom force field. The torsional parameters were detd. by fitting to rotational energy profiles obtained from ab initio MO calcns. at the RHF/6-31G*//RHF/6-31G* level for more than 50 org. mols. and ions. The quality of the fits was high with av. errors for conformational energies of less than 0.2 kcal/mol. The force-field results for mol. structures are also demonstrated to closely match the ab initio predictions. The nonbonded parameters were developed in conjunction with Monte Carlo statistical mechanics simulations by computing thermodn. and structural properties for 34 pure org. liqs. including alkanes, alkenes, alcs., ethers, acetals, thiols, sulfides, disulfides, aldehydes, ketones, and amides. Av. errors in comparison with exptl. data are 2% for heats of vaporization and densities. The Monte Carlo simulations included sampling all internal and intermol. degrees of freedom. It is found that such non-polar and monofunctional systems do not show significant condensed-phase effects on internal energies in going from the gas phase to the pure liqs.
54. 54
  Schrödinger Release 2013-2: Maestro, version 9.5; Schrödinger, LLC, New York, 2013.
  There is no corresponding record for this reference.
55. 55
  Schrödinger Release 2013-2: LigPrep, version 2.7; Schrödinger, LLC, New York, 2013.
  There is no corresponding record for this reference.
- PDB: 3LP1
Supporting Information
Supporting Information
Characterization data, including ¹H NMR, ¹³C NMR, and HRMS data, of all intermediates. This material is available free of charge via the Internet at http://pubs.acs.org.
- jm501132s_si_001.pdf (171.73 kb)
Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Design, Synthesis, Biochemical, and Antiviral Evaluations of C6 Benzyl and C6 Biarylmethyl Substituted 2-Hydroxylisoquinoline-1,3-diones: Dual Inhibition against HIV Reverse Transcriptase-Associated RNase H and Polymerase with Antiviral ActivitiesClick to copy article linkArticle link copied!

Journal of Medicinal Chemistry

Abstract

Introduction

Figure 1

Figure 2

Results and Discussion

Chemistry

Scheme 1

Biology

All New C6 Benzyl and C6 Biarylmethyl HID Analogues Potently Inhibit HIV RT Associated RNase H and Polymerase

Some C6 Benzyl and C6 Biarylmethyl HID Analogues Moderately Inhibit HIV IN

Many C6 Benzyl and C6 Biarylmethyl HID Analogues Inhibit HIV-1 in Low Micromolar Range

RNase H Active Site Binding

Figure 3

Conclusions

Experimental Section

Chemistry: General Procedures

General Procedure 1 for the One-Pot Reductive Coupling of Aldehydes with Boronic Acids (14a–g)

5-Benzyl-2,3-dihydro-1H-inden-1-ol (14a)

General Procedure 2 for the Synthesis of Alkene (15a–g)

6-Benzyl-1H-indene (15a)

General Procedure 3 for the Synthesis of Diol (16a–g)

5-Benzyl-2,3-dihydro-1H-indene-1,2-diol (16a)

General Procedure 4 for the Synthesis of Dicarboxylic Acid (17a–g)

4-Benzyl-2-(carboxymethyl)benzoic Acid (17a)

General Procedure 5 for Suzuki Coupling (18h–t)

4-([1,1′-Biphenyl]-4-ylmethyl)-2-(carboxymethyl)benzoic Acid (18i)

General Procedure 6 for Cyclization and Deprotection (20a–t)

6-Benzyl-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20a)

2-Hydroxy-6-(4-methylbenzyl)isoquinoline-1,3(2H,4H)-dione (20b)

6-(4-Fluorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20c)

6-(4-Chlorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20d)

6-(4-Bromobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20e)

2-Hydroxy-6-(4-(trifluoromethyl)benzyl)isoquinoline-1,3(2H,4H)-dione (20f)

6-(2,4-Difluorobenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20g)

6-(4-Cyclopropylbenzyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20h)

6-([1,1′-Biphenyl]-4-ylmethyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20i)

2-Hydroxy-6-(4-(thiophen-2-yl)benzyl)isoquinoline-1,3(2H,4H)-dione (20j)

6-((4′-Fluoro-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20k)

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-carbonitrile (20l)

2-Hydroxy-6-((4′-methoxy-[1,1′-biphenyl]-4-yl)methyl)isoquinoline-1,3(2H,4H)-dione (20m)

2-Hydroxy-6-((4′-(methylsulfonyl)-[1,1′-biphenyl]-4-yl)methyl)isoquinoline-1,3(2H,4H)-dione (20n)

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-sulfonamide (20o)

4′-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-[1,1′-biphenyl]-4-carboxamide (20p)

6-((2′,4′-Difluoro-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20q)

6-((2′,4′-Bis(trifluoromethyl)-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20r)

6-((3′-Fluoro-4′-methoxy-[1,1′-biphenyl]-4-yl)methyl)-2-hydroxyisoquinoline-1,3(2H,4H)-dione (20s)

4-(4-((2-Hydroxy-1,3-dioxo-1,2,3,4-tetrahydroisoquinolin-6-yl)methyl)phenyl)pyridin-1-ium 4-methylbenzenesulfonate (20t)

Biology

Reagents

Biologicals

Chemicals

RNase H Assay

RT Polymerase Assay

HIV IN Assay

Antiviral Assays

Modeling and Docking

Supporting Information

Terms & Conditions

Author Information

Acknowledgment

Abbreviations Used

References

Cited By

Journal of Medicinal Chemistry

Article Views

Altmetric

Citations

Recommended Articles

Abstract

Figure 1

Figure 2

Scheme 1

Figure 3

References

Supporting Information

Supporting Information

Terms & Conditions

Design, Synthesis, Biochemical, and Antiviral Evaluations of C6 Benzyl and C6 Biarylmethyl Substituted 2-Hydroxylisoquinoline-1,3-diones: Dual Inhibition against HIV Reverse Transcriptase-Associated RNase H and Polymerase with Antiviral Activities
Click to copy article linkArticle link copied!