ACS Publications. Most Trusted. Most Cited. Most Read
Hole Hopping through Tryptophan in Cytochrome P450
More

OR SEARCH CITATIONS

My Activity
Publications

Figure 1Loading Img
Download Hi-Res ImageDownload to MS-PowerPointCite This:Biochemistry 2017, 56, 28, 3531-3538
  • Open Access
  • Editors Choice
Article

Hole Hopping through Tryptophan in Cytochrome P450
Click to copy article linkArticle link copied!

View Author Information
Beckman Institute, California Institute of Technology, Pasadena, California 91125, United States
*Harry B. Gray. E-mail: [email protected]. Phone: 626-395-6500.
*Jay R. Winkler. E-mail: [email protected]. Phone: 626-395-2834.
Open PDFSupporting Information (1)

Biochemistry

Cite this: Biochemistry 2017, 56, 28, 3531–3538
Click to copy citationCitation copied!
https://doi.org/10.1021/acs.biochem.7b00432
Published July 9, 2017

Copyright © 2017 American Chemical Society. This publication is licensed under these Terms of Use.

Request reuse permissions

Abstract

Click to copy section linkSection link copied!
High Resolution Image
Download MS PowerPoint Slide

Electron-transfer kinetics have been measured in four conjugates of cytochrome P450 with surface-bound Ru-photosensitizers. The conjugates are constructed with enzymes from Bacillus megaterium (CYP102A1) and Sulfolobus acidocaldarius (CYP119). A W96 residue lies in the path between Ru and the heme in CYP102A1, whereas H76 is present at the analogous location in CYP119. Two additional conjugates have been prepared with (CYP102A1)W96H and (CYP119)H76W mutant enzymes. Heme oxidation by photochemically generated Ru3+ leads to P450 compound II formation when a tryptophan residue is in the path between Ru and the heme; no heme oxidation is observed when histidine occupies this position. The data indicate that heme oxidation proceeds via two-step tunneling through a tryptophan radical intermediate. In contrast, heme reduction by photochemically generated Ru+ proceeds in a single electron tunneling step with closely similar rate constants for all four conjugates.

Copyright © 2017 American Chemical Society

Subjects

what are subjects

Most biological redox transformations involve reagents with formal potentials in the ±1 V vs NHE range. At the periphery of this potential window proteins present a decidedly unsymmetrical medium for electron transfer (ET). Whereas reduction of peptides and small aromatic groups only proceeds at potentials more negative than −2.5 V vs NHE, (1-3) one-electron oxidations of aromatic and sulfur-containing amino-acids, as well as the peptide backbone itself, can occur at potentials in the 1.0–1.5 V vs NHE range. (4-11) We anticipate, then, that proteins are superexchange mediators of ET in reactions of low-potential redox couples. In contrast, oxidized amino acid radicals are known to be essential participants in many high-potential enzymatic redox reactions, (12-21) and structural evidence suggests that they may play a far greater role than previously recognized. (22)
Elucidating the roles of protein radicals, particularly those of the aromatic amino acids tryptophan (W) and tyrosine (Y), in functional and protective pathways of high-potential enzymes continues to be an active area of research. (22-25) The appearance of dioxygen in Earth’s atmosphere promoted the evolution of a vast array of O2-utilizing enzymes that generate high-potential reactive intermediates capable of oxidizing tryptophan and tyrosine. The cytochromes P450 (CYP) are prominent representatives of this enzyme class, responsible for a broad spectrum of vital metabolic functions. (26) The accepted enzymatic reaction cycle of cytochrome P450 involves two high-potential reactive intermediates (compounds I and II) that participate directly in reactions with substrates. (27-32) In prior work, we demonstrated that compound II can be prepared in the heme domain of Bacillus megaterium P450 (CYP102A1) by oxidation of the Fe3+-heme with a surface-attached Ru(diimine)33+ complex (E°(Ru3+/2+) ≈ 1.2 V vs NHE (33, 34)). (35) We have extended this work to the archaeal Sulfolobus acidocaldarius P450 (CYP119). (30) A key structural difference between the two enzymes is an aromatic side chain hydrogen bonded to one of the heme proprionates (W96 in CYP102A1; H76 in CYP119) (Figure 1). (36, 37) We find that an intervening tryptophan residue (CYP102A1, W96; CYP119, H76W) is essential for promoting Fe3+(OH2)–heme oxidation by Ru(diimine)33+ in both CYP102A1 and CYP119 but that these residues appear to play no analogous role in the reduction of Fe3+(OH2)-heme by Ru(diimine)3+ (E°(Ru2+/+) ≈ −1.3 V vs NHE (33, 34)).

Figure 1

Figure 1. Overlay of the heme environments of CYP102A1 (gray carbon atoms) and CYP119 (green carbon atoms) illustrating the relative positions of W96 in CYP102A1 and H76 in CYP119. Atomic coordinates were taken from PDB IDs 2IJ2 (CYP102A1) (34) and 1IO7 (CYP119). (35)

High Resolution Image
Download MS PowerPoint Slide

Experimental Procedures

Click to copy section linkSection link copied!

Materials

Buffer salts were obtained from J.T. Baker. 5-Aminolevulenic acid and dithiothreitol were obtained from Sigma-Aldrich. [Ru(NH3)6]Cl3 was obtained from Strem Chemicals. All chemicals were used as received with no further purification. The ruthenium labeling reagent ([Ru(2,2′-bipyridine)2(5-iodoacetamido 1,10-phenanthroline)]2+, [Ru(bpy)2(IAphen)]2+), (38) model complex ([Ru(2,2′-bipyridine)2(5-acetamido 1,10-phenanthroline)]2+, [Ru(bpy)2(Aphen)]2+), (38) and p-methoxydimethylaniline (pMeODMA) (39) were synthesized according to published procedures. Solutions were prepared using 18 MΩ-cm water unless otherwise noted. Mutagenesis primers were obtained from Operon.

Plasmid Preparation

The recombinant CYP102A1 (UniProt accession number P14779) heme domain, consisting of the first 463 residues with an N-terminal 6-histidine tag, was obtained courtesy of Professor Andrew Udit (Occidental College, Los Angeles California), within the pCWori+ vector. Recombinant CYP119 (UniProt accession number Q55080) with an N-terminal 6-histidine tag was obtained courtesy of Professor Paul Ortiz de Montellano (University of California, San Francisco), also within the pCWori+ vector. Qiagen Quik-Change site-directed mutagenesis was used to generate the desired P450 mutants. Mutagenesis primers (forward, 5′–3′) were CTAATTAAGAAGCAGCCGATGAATCACG (CYP102A1 C62A), CGATTGGTCTTAGCGGCTTTAAC (CYP102A1 C156S), GCTGGACGCATCAAAAAAATTGGTGCAAAGCGC (CYP102A1 K97C); GGACGCATGAAAAAAATCATTGCAAAGCGCATAATATC (CYP102A1 W96H); GATCCCCCTCTCCATTGTGAGTTAAGATCAATGTCAGC (CYP119 D77C), and CCTCAGATCCCCCTCTCTGGTGTGAGTTAAGATCAATGTC (CYP119 H76W).

Overexpression in E. coli

The P450 mutants CYP102A1-C62A/C156S/K97C (C97(CYP102A1)W96), CYP102A1-C62A/C156S/K97C/W96H (C97(CYP102A1)W96H), CYP119-D77C (C77(CYP119)H76), and CYP119-D77C/H76W (C77(CYP119)H76W) were overexpressed in the BL21-DE3 strain of E. coli. Overnight cultures of Luria–Bertani broth (25 mL) containing 100 μg/mL ampicillin and a single respective E. coli colony were incubated at 37 °C overnight, shaking at 180–200 rpm. Induction cultures of TB (1× TB for CYP102A1, 2× TB for CYP119) containing 200 μg/mL ampicillin, 1 μM thiamine, 0.4% glycerol, and 250 μL of mineral supplements (stock solution 100 mM FeCl3, 10 mM ZnCl2, 8.5 mM CoCl2, 8.5 mM Na2MoO4, 7 mM CaCl2, 7.5 mM CuCl2, 8 mM H3BO3) were inoculated with the overnight culture and incubated at 37 °C until reaching an optical density of ∼1 at 600 nm. Cultures were induced by addition of 1 mM IPTG, and 0.5 mM α-aminolevulenic acid, a heme precursor, was added. The temperature was lowered to 30 °C for 24 (CYP102A1) or 48 h (CYP119). Following expression, cells were harvested by centrifugation, and cell pellets were stored at −80 °C until needed.
Cell pellets were resuspended in cold wash buffer (50 mM Tris pH 8, 300 mM sodium chloride, 20 mM imidazole). A small spatula tip of each of two protease inhibitors (benzamidine hydrochloride and Pefabloc SC) was added, and cells were lysed by two to three cycles of probe-tip sonication (0.5 s on, 0.5 s off, for 5 min), cooled by an ice–water bath. After centrifugation (15 000 rpm, 1 h, 8 °C) to pellet cellular debris, the supernatant was loaded directly onto a Ni batch column. After thorough washing with wash buffer (1.5–2 L), protein was eluted (200 mM imidazole in wash buffer), and the colored (red/orange) fractions were collected and concentrated in 30 kDa centrifugal filters. Gel filtration chromatography was used to remove fragmented proteins, followed by buffer exchange into 20 mM Tris, pH 8, with 20 mM dithiothreitol (DTT) added to reduce intermolecular disulfide bonds. Purity was determined by UV–vis absorption (A420/A280), SDS-PAGE, and mass spectrometry. Protein not intended for immediate use was flash-frozen in liquid nitrogen (with 40% glycerol added to solution as cryoprotectant) and stored at −80 °C.

Conjugation to Ru-Photosensitizer

An approximately 3-fold excess of [Ru(bpy)2(IA-phen)]2+ was added to a ∼10 μM solution of P450 mutant in 20 mM Tris buffer (pH 8) and shaken in the dark at 4 °C. Labeling progress can be monitored by MALDI mass spectrometry; no further increase in the peak corresponding to the predicted mass of Ru2+–P450 was observed after 2 h. Excess [Ru(bpy)2(IA-phen)]2+ was removed during concentration in 30 kDa filters, followed by desalting on an FPLC HiPrep column.
To separate photosensitizer-labeled and unlabeled enzymes, protein samples were loaded onto an anion exchange MonoQ or HiPrep Q column equilibrated with 20 mM Tris buffer, pH 8 (Q wash buffer). The column was washed with Q wash buffer until UV–visible absorbance returned to baseline. The gradient was ramped quickly to 59% Q elution buffer (Q wash buffer + 250 mM sodium chloride), followed by a slow gradient of 59–65% Q elution buffer over 60 min. Successful conjugation and separation of Ru–P450 was verified by UV–vis, mass spectrometry, and fluorometry.

Laser Spectroscopy Sample Preparation

Laser samples were composed of ∼10 μM Ru–P450 conjugate, with and without oxidative quencher (17 mM [Ru(NH3)6]Cl3) or reductive quencher (10 mM pMeODMA) in buffered solution (pH 8, 50 mM sodium borate or 50 mM Tris); additionally, each buffer contained sodium chloride to prevent precipitation. pMeODMA is only sparingly soluble in water; aqueous stock solutions were prepared by dropwise addition of concentrated pMeODMA/DMSO solution into aqueous buffer (50 mM sodium borate, pH 8). Fresh pMeODMA solutions were prepared immediately prior to use and protected from light, as oxygenated solutions change from clear to pinkish/purple in ambient light. Laser samples were placed in a high-vacuum four-sided quartz fluorescence cuvette with high-vacuum Teflon valve, equipped with a small stir bar. Deoxygenation was achieved via 3 × 10–15 gentle pump-backfill cycles with argon on a Schlenk line, with 15 min of equilibration between each set of cycles. Additional details provided in Supporting Information.
For nanosecond-to-millisecond transient luminescence and absorption experiments, excitation was provided by 480 nm pulses from a tunable optical parametric oscillator (Spectra Physics, Quanta-Ray MOPO-700) pumped by the third harmonic from a Spectra Physics Q-switched Nd:YAG laser (Spectra-Physics, Quanta-Ray PRO-Series, 8 ns pulse width) operated at 10 Hz. Probe light was provided by a 75-W arc lamp (PTI model A 1010) that could be operated in continuous or pulsed mode and passed through the sample collinearly with the excitation pulse. After rejection of scattered light by appropriate long- and short-pass filters, and intensity modulation by a neutral density filter, probe wavelengths were selected by a double monochromator (Instruments SA DH-10) with 1 mm slits. Transmitted light was detected by a photomultiplier tube (PMT, Hamamatsu R928) and amplified by a 200 MHz wideband voltage amplifier DHPVA-200 (FEMTO).
Luminescence decays were monitored at 630 nm. Single wavelength transient absorption kinetics were monitored every 10 nm from 390 to 440 nm, averaging ∼500 shots per wavelength. Data from five separate time scales (2 μs, 40 μs, 400 μs, 10 ms, and 500 ms) were collected, log-compressed, and spliced together to produce full kinetics traces using Matlab software (Mathworks).

Results

Click to copy section linkSection link copied!

Ru–P450 Conjugates

Electron-transfer kinetics measurements were performed on four Ru–P450 conjugates: two mutants of CYP102A1 and two of CYP119. The Ru–P450 from our previous work is a triple mutant of CYP102A1: C62A/C156S/K97C with [Ru(2,2′-bipyridine)2(5-acetamido-1,10-phenanthroline)]2+ ([Ru(bpy)2(APhen)]2+) covalently bound to C97 via a thioether linkage (RuC97(CYP102A1)W96). To investigate the importance of W96 in photochemical ET, we generated the analogous conjugate with a W96H mutation (RuC97(CYP102A1)W96H). The W96H mutation should preserve hydrogen-bonding with the heme propionates, which is thought to provide structural stability to the heme. (40) But, unlike tryptophan, this side chain should not be susceptible to oxidation by photochemically generated Ru3+. (11)
We have prepared analogous Ru–P450 conjugates with an intervening histidine or tryptophan residue in thermophilic CYP119. The residue corresponding to CYP102A1-W96 is H76 in CYP119 (Figure 1); a cysteine mutation at residue 77 serves as the photosensitizer attachment point. The two Ru–CYP119 conjugates are referred to as RuC77(CYP119)H76 and RuC77(CYP119)H76W.

Luminescence Quenching Measurements

The Ru(diimine)3 photosensitizer luminesces upon 480 nm excitation. The luminescence decay of all four Ru–P450 conjugates is nonexponential, attributable to multiple photosensitizer conformations that do not exchange on the luminescence decay time scale. The nonexponential decay kinetics are most pronounced for mutants containing a tryptophan residue adjacent to the Ru-tethering point (RuC97(CYP102A1)W96, RuC77(CYP119)H76W). The mild oxidant [Ru(NH3)6]3+ is an efficient quencher of excited Ru(diimine)32+ complexes (*Ru2+), (35) producing powerfully oxidizing Ru(diimine)33+ in high yield. In the presence of [Ru(NH3)6]3+ (17 mM), luminescence is strongly quenched, and the decay kinetics can be fit to a single exponential function (Table 1). There are small differences in quenched decay times; in particular, the decay time of quenched RuC77(CYP119)H76 is approximately two to three times longer than that found in the three other proteins (90 ns vs 30–50 ns). The origin of this difference is not readily apparent.
Table 1. Luminescence Decay Times of Four Ru–P450 Conjugates in the Absence and Presence of Quenchersa
enzymequencherτmono, nsτa, ns (ρa)τb, ns (ρb)
RuC97(CYP102A1)W96none140190 (0.65)52 (0.35)
 [Ru(NH3)6]3+30  
 pMeODMA62  
RuC97(CYP102A1)W96Hnone180160 (0.80)310 (0.20)
 [Ru(NH3)6]3+33  
 pMeODMA65  
RuC77(CYP119)H76none200220 (0.85)45 (0.15)
 [Ru(NH3)6]3+91  
 pMeODMA54  
RuC77(CYP119)H76Wnone13091 (0.75)320 (0.25)
 [Ru(NH3)6]3+48  
 pMeODMA50  
a

Quenchers: [Ru(NH3)6]3+, 17 mM; pMeODMA, 10 mM. The relative amplitudes of major (ρa) and minor (ρb) components in biexponential fits to the unquenched decays also are listed. Samples were excited at 480 nm, and luminescence was detected at 630 nm. Uncertainties in the decay times are ±10%, except for the single-exponential fits to the unquenched decays.

In prior work, we demonstrated that para-methoxy-N,N-dimethylaniline (pMeODMA) quenches *Ru2+ complexes to produce one-electron reduced forms (Ru+). (39) In the presence of 10 mM pMeODMA, *Ru2+ luminescence is efficiently quenched, and the decay kinetics are monoexponential. In contrast to the oxidative quenching with [Ru(NH3)6]3+, there is very little difference in the quenched decay times among the four Ru–P450 conjugates (Table 1).

Transient Absorption Measurements

In the absence of electron-transfer quenchers, the transient absorption features of the Ru–P450 conjugates are characterized by a loss of Ru(diimine)32+ metal-to-ligand charge transfer (MLCT) absorbance in the 400–440 nm region due to depopulation of the ground-state photosensitizer. The spectral and temporal profiles of these transients are essentially identical for the free photosensitizer and all four Ru–P450 conjugates: the features return to baseline with the same time constants as the luminescence decay.

Oxidative Quenching

Transient absorption measurements demonstrate that [Ru(NH3)6]3+ quenches the *Ru2+ to produce electron-transfer products (Figure 2). The ligand field absorption bands of [Ru(NH3)6]3+/2+ are too weak to make any detectable contribution to the transient spectra. Photogenerated [Ru(bpy)2(Aphen)]3+ (Ru3+) is characterized by a bleach of [Ru(bpy)2(Aphen)]2+ MLCT absorption between 390 and 440 nm, and time-resolved absorption measurements reveal that it persists for several microseconds before reacting with [Ru(NH3)6]2+ to regenerate the Ru2+ sensitizer and oxidized quencher (Figure 2).

Figure 2

Figure 2. Transient absorption kinetics following 480 nm laser excitation of [Ru(bpy)2(Aphen)]2+ in the presence of [Ru(NH3)6]3+ (17 mM). The purple curve is a luminescence decay trace.

High Resolution Image
Download MS PowerPoint Slide
We reported previously that when [Ru(bpy)2(IAphen)]2+ is conjugated to C97 in CYP102A1, photogenerated RuC973+(CYP102A1)W96 sequentially generates ferric-porphyrin radical cation (Fe3+por•+) and Fe4+-hydroxide (Fe4+–OH, CII) intermediates. These oxidation processes are characterized by loss of absorbance at 420 nm (the peak of the Fe3+–OH2 heme Soret absorption) that persists for hundreds of milliseconds; formation of CII is characterized by the appearance of transient absorption at 440 nm on the millisecond time scale (Figure 3).

Figure 3

Figure 3. Transient kinetics following oxidative quenching ([Ru(NH3)6]3+, 17 mM) in four Ru–P450 conjugates: λex = 480 nm; λobsd = 420 nm (green), 440 nm (red). Signals normalized to the magnitude of the 440 nm prompt bleach.

High Resolution Image
Download MS PowerPoint Slide
We subjected the other three Ru–P450 conjugates to identical oxidative flash-quench irradiation and recorded the transient kinetics (Figure 3). The CYP119 mutant with an intervening tryptophan, RuC77(CYP119)H76W, displays transient absorption spectra and kinetics similar to those of RuC97(CYP102A1)W96, albeit with smaller signal amplitudes (<5 mOD) (Figure 3). The lower ET yield in this variant may be a consequence of nonproductive oxidation of other nearby aromatic residues or less efficient competition with back electron transfer from reduced quencher. The results with RuC97(CYP102A1)W96 and RuC77(CYP119)H76W are in striking contrast to those of the Ru–P450 constructs with an intervening histidine residue (RuC97(CYP102A1)W96H and RuC77(CYP119)H76). Neither of the latter constructs reveals any evidence indicative of heme oxidation following photochemical generation of the Ru(diimine)33+ complex. In both cases, we observe only a bleach of the ground-state MLCT absorption features (390–440 nm) that returns to baseline within 200 μs. The spectral profiles and kinetics of these transients are nearly identical to that of the free photosensitizer ([Ru(bpy)2(Aphen)]2+) quenched with [Ru(NH3)6]3+ (Figure 2). These observations suggest that Ru(diimine)33+ oxidizes the P450 heme only in structures with an intervening tryptophan residue.

Reductive Quenching

Photochemical reduction of Ru–P450 conjugates was performed using pMeODMA as quencher. The resulting Ru+ species has nearly 1 eV of driving force for reduction of the ferric P450 heme: E°(Ru(bpy)32+/+ = −1.3 V vs NHE; (33, 34)E°(P450 Fe3+/2+) = −0.43 V vs NHE. (41) All four Ru–P450 conjugates exhibit similar transient absorption features under flash-quench conditions (Figure 4). Three distinct kinetics phases appear on the nanosecond, microsecond, and millisecond time scales following pulsed laser excitation of the photosensitizer. All transient absorption features decay back to baseline within a few hundred milliseconds, suggesting that the overall photochemical process is reversible. The fastest kinetics phase (τ ≈ 60 ns) is assigned to decay of *Ru(diimine)32+; transient absorption features associated with this state decay with the same time constant as the luminescence. Transient absorption at 510 nm, attributable to Ru(diimine)3+ and pMeODMA•+, develops with the same time constant. The subsequent microsecond kinetics phase is characterized by a bleach at 420 nm and increased absorbance at 440 nm, indicative of a red-shift in the heme Soret band. In the resting state of Fe3+-P450, the Fe center is axially ligated by cysteine thiolate and water ligands, producing a low-spin electronic configuration. Chemical reduction of Fe3+-P450 produces a five-coordinate high-spin ferrous heme with a blue-shifted Soret band. (41) The red-shifted Soret observed following reductive quenching of the Ru–P450 conjugates is indicative of a low-spin ferrous heme. (42) The microsecond heme reduction by Ru+ is likely faster than aquo ligand loss, resulting in a transient low-spin, six-coordinate ferrous species. This conclusion is consistent with the absorption profiles of Fe2+(CO)–CYP101 (P450cam from Pseudomonas putida), Fe2+(imidazole)–CYP101, and cryoreduced CYP101. (43, 44) The millisecond kinetics phase corresponds to reoxidation of the reduced heme by pMeODMA•+, resulting in a return to baseline of all transient absorption features and regeneration of Fe3+(OH2)–P450 and pMeODMA.

Figure 4

Figure 4. Transient kinetics following reductive quenching (pMeODMA, 10 mM) of four Ru–P450 conjugates: λex = 480 nm; λobsd = 420 nm (green), 440 nm (red). Signals normalized to the magnitude of the 440 nm prompt bleach.

High Resolution Image
Download MS PowerPoint Slide
We performed a global least-squares analysis of the Ru–P450 reductive quenching kinetics recorded at 420 and 440 nm (and, for select mutants, 400, 410, 430 nm) to a three-exponential function with amplitude coefficients ρ1–3(λ) and rate constants γ1–3 (eq 1). We fixed the first observed rate constant to the value obtained from single-exponential fits to the quenched luminescence decay kinetics recorded at 630 nm. The remaining two rate constants, which were extracted from the global fitting, are listed in Table 2.(1)
Table 2. Rate Constants for Ru-Sensitizer Quenching (γ1), Heme Reduction (γ2), and Heme Oxidation (γ3) Extracted from Global Fitting of Transient Absorption Data
enzymeγ1 (s–1)γ2 (s–1)γ3 (s–1)
RuC97(CYP102A1)W961.6 × 1073.6 × 1041.1 × 102
RuC97(CYP102A1)W96H1.6 × 1076.0 × 1041.9 × 102
RuC77(CYP119)H761.9 × 1075.7 × 1041.4 × 102
RuC77(CYP119)H76W1.9 × 1078.1 × 1041.3 × 102
The second rate constant corresponds to heme reduction. All four mutants exhibit very similar reduction rates, with maximum heme reduction complete at approximately 100 μs. Interestingly, after normalizing by the magnitude of the prompt *Ru2+ excited state bleach (440 nm), the magnitudes of the transient features associated with heme reduction (e.g., absorption at 440 nm) differ greatly among the four Ru–P450 conjugates. In particular, both CYP119 mutants exhibit absorption features that are greater by a factor of 2–3 than either of the CYP102A1 mutants (Figure 4).
All transient absorption features decay to baseline within 100 ms; this return rate is extremely sensitive to small amounts of oxygen. In our proposed flash-quench scheme, reoxidation of the ferrous center occurs via bimolecular recombination with pMeODMA•+. This recombination is expected to be a second-order process; however, the disappearance of the transient features is better modeled as a first-order process, possibly owing to reaction with oxygen or minor impurities.

Discussion

Click to copy section linkSection link copied!
In a prior report on the kinetics of heme oxidation by Ru3+ in RuC97(CYP102A1)W96, we found spectroscopic evidence for stepwise oxidation of Fe3+(OH2)–heme to Fe4+(OH)–heme via an intermediate porphyrin radical cation. Electron transfer from the porphyrin to Ru3+C97 was remarkably rapid (8.5 × 105 s–1, pH 8), given the 20.8-Å distance from the Ru-center to the nearest aromatic carbon atom on the porphyrin ring (Figure 5). (35) This result conflicts with the semiclassical ET theory prediction that the rate constant for this reaction should be 3 orders of magnitude smaller (4 × 102 s–1; −ΔG° = 0.2 eV; reorganization energy λ = 0.8 eV; distance decay factor β = 1.1 Å–1, see Supporting Information). Indeed, the failure to observe flash-quench induced heme oxidation in RuC77(CYP119)H76 is in better agreement with the slower predicted rate since porphyrin oxidation by Ru3+ apparently does not compete effectively with Ru3+ reduction by reduced quencher (complete in 100 μs).

Figure 5

Figure 5. Structural model of RuC97–CYP102A1 (PDB ID 3NPL) highlighting the electron-transfer distances from RuC97 to the porphryin (20.76 Å), RuC97 to W96 (11.88 Å), and W96 to the porphyrin (7.15 Å).

High Resolution Image
Download MS PowerPoint Slide
The fact that we observe flash-quench heme oxidation only in Ru–P450s with intervening tryptophan residues strongly implicates the tryptophan radical cation as a reaction intermediate. Kinetics modeling of a stepwise hole-transfer reaction from Ru3+ to W96•+ to por•+, using distances taken from the RuC97(CYP102A1)W96 structure (PDB ID 3NPL) (35) (Figure 5), predicts an apparent rate constant for porphyrin oxidation of 1.4 × 106 s–1 (Supporting Information), a value in remarkably good agreement with the experimentally derived quantity. The rate constant for hole transfer from W96•+ to por•+ is predicted to be more than 2 orders of magnitude greater, suggesting that a negligibly small concentration of W96•+ will build up during the porphyrin oxidation process (Figure 6).

Figure 6

Figure 6. Photochemical ET reaction scheme in RuC97(CYP102A1) and RuC77(CYP119). Blue arrows indicate excitation processes, solid green arrows indicate bimolecular quenching reactions, dashed green arrows indicate bimolecular charge-recombination processes with quencher redox products, and red arrows indicate intraprotein ET reactions. With an intervening W residue (a, CYP102A, W96; CYP119 H76W), oxidative quenching of *Ru2+ by QO (left path) leads to heme oxidation via an intermediate Trp radical; reductive quenching by QR (right path) leads to heme reduction in a single-step tunneling reaction. With an intervening H residue (b, CYP102A, W96H; CYP119 H76), oxidative quenching of *Ru2+ by QO produces Ru3+ but not heme oxidation, whereas reductive quenching again leads to single-step electron transfer from Ru+ to the heme.

High Resolution Image
Download MS PowerPoint Slide
The kinetics of the high-potential heme oxidation reaction are in striking contrast to those of the low-potential heme reduction reaction. The estimated driving force for the Ru+ to Fe3+(OH2)–heme ET is 0.9 eV, close to the reorganization energy estimate of 0.8 eV. The ET distance is somewhat ambiguous for this reaction because the transferring electron could be localized on any one of the three diimine ligands. On the basis of the RuC97(CYP102A1) crystal structure, (35) the shortest distances from any diimine ligand to the Fe center range from 19.5 to 23.8 Å. Semiclassical ET theory predicts that the rate constant for reactions over this distance range will be 103–105 s–1, in accord with the γ2 values listed in Table 2. Moreover, the rate constants for heme reduction vary by no more than a factor of 2 among the four conjugates. We conclude from this analysis that reduction of Fe3+(OH2)–heme by RuC97+ in CYP102A1 and by RuC77+ in CYP119 involves single step electron tunneling and that the intervening tryptophan (W96, W76) and histidine (H96, H76) residues serve only to mediate the superexchange coupling between the two redox sites (Figure 6).
The heme oxidation and reduction kinetics in RuC97(CYP102A1) and RuC77(CYP119) highlight the asymmetry between high and low potential ET reactions in proteins. The electron-tunneling timetables extracted from our studies of ET in Ru-modified proteins provide benchmarks for single-step electron tunneling in which the reduction potential of the oxidant is <1 V vs NHE. Our studies of Ru–P450 clearly demonstrate that multistep tunneling reactions via tryptophan (and tyrosine) radicals come into play when oxidants have potentials >1 V. In addition, the radicals of the sulfur-containing amino acids also might be participants in reactions with particularly high potential oxidants. For enzymes functioning with intermediates at potentials greater than 1 V, protein structure and composition are critically important factors that ensure oxidizing equivalents are delivered to intended targets rather than diffusing to low potential sinks via multistep tunneling. The obvious corollary is that strategic placement of tryptophan and tyrosine residues in enzymes can direct the flow of oxidizing equivalents over long distances with little loss of potential.

Supporting Information

Click to copy section linkSection link copied!

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.7b00432.

  • Additional experimental details, spectra of ferric and ferrous wild-type P450-BM3 and the ferrous–ferric difference spectrum, details of electron transfer rate calculations, and estimated electron transfer rate constants (PDF)

Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Author Information

Click to copy section linkSection link copied!
  • Corresponding Authors
  • Author
    • Maraia E. Ener - Beckman Institute, California Institute of Technology, Pasadena, California 91125, United States
  • Funding

    Research reported in this publication was supported by the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health under Award Number R01DK019038. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Additional support was provided by the Arnold and Mabel Beckman Foundation.

  • Notes
    The authors declare no competing financial interest.

Abbreviations

Click to copy section linkSection link copied!
ET

electron transfer

MLCT

metal-to-ligand charge transfer

[Ru(bpy)2(IAphen)]2+

[Ru(2,2′-bipyridine)2(5-iodoacetamido 1,10-phenanthroline)]2+

[Ru(bpy)2(Aphen)]2+

[Ru(2,2′-bipyridine)2(5-acetamido-1,10-phenanthroline)]2+

pMeODMA

p-methoxydimethylaniline

References

Click to copy section linkSection link copied!

This article references 44 other publications.

  1. 1
    Heinze, J. (2016) Aliphatic and Aromatic Hydrocarbons - Reduction, in Organic Electrochemistry (Hammerich, O. and Speiser, B., Eds.), pp 861– 890, Taylor and Francis Group, Boca Raton, FL.
    Google Scholar
    There is no corresponding record for this reference.
  2. 2
    Holton, D. M., Edwards, P. P., and Salmon, G. A. (1984) Electrons, alkali metal-electron species and radical anions in substituted organic amides J. Phys. Chem. 88, 3855– 3859 DOI: 10.1021/j150661a034
    Google Scholar
    There is no corresponding record for this reference.
  3. 3
    Knecht, L. A. and Kolthoff, I. M. (1962) N-Methylacetamide as a Polarographic Solvent Inorg. Chem. 1, 195– 203 DOI: 10.1021/ic50002a002
    Google Scholar
    There is no corresponding record for this reference.
  4. 4
    Harriman, A. (1987) Further Comments on the Redox Potentials of Tryptophan and Tyrosine J. Phys. Chem. 91, 6102– 6104 DOI: 10.1021/j100308a011
    Google Scholar
    4
    Further comments on the redox potentials of tryptophan and tyrosine
    Harriman, Anthony
    Journal of Physical Chemistry (1987), 91 (24), 6102-4CODEN: JPCHAX; ISSN:0022-3654.
    The redox potentials for 1-electron oxidn. of tryptophan and tyrosine, as well as for few simple indoles and phenols, were detd. by cyclic voltammetry. Mostly, the values obsd. are in reasonable agreement with those detd. earlier by pulsed radiolysis but the value obsd. for tryptophan (E° = 1.015 V vs. a normal H electrode at pH 7) is much higher than that derived from pulsed radiolysis. The neg. magnitude of the redox potentials for tryptophan and tyrosine shows a marked pH dependence.
  5. 5
    Fourré, I., Bergès, J., and Houée-Levin, C. (2010) Structural and Topological Studies of Methionine Radical Cations in Dipeptides: Electron Sharing in Two-Center Three-Electron Bonds J. Phys. Chem. A 114, 7359– 7368 DOI: 10.1021/jp911983a
    Google Scholar
    5
    Structural and Topological Studies of Methionine Radical Cations in Dipeptides: Electron Sharing in Two-Center Three-Electron Bonds
    Fourre, Isabelle; Berges, Jacqueline; Houee-Levin, Chantal
    Journal of Physical Chemistry A (2010), 114 (27), 7359-7368CODEN: JPCAFH; ISSN:1089-5639. (American Chemical Society)
    One electron oxidn. of methionine in peptides is highly dependent on the local structure. The sulfur-centered radical cation can complex with oxygen, nitrogen, or other sulfur atoms from a neighboring residue or from the peptidic bond, forming an intramol. S X two-center three-electron bond (X = S, N, O). This stabilization was investigated computationnally in the radical cations of three peptides, methionine glycine (Met Gly) and its reverse sequence Gly Met, and Met Met. Geometry optimizations were done at the BH&HLYP/6-31G(d) level of theory and the effect of solvation was taken into account using a continuum model (CPCM). Up to seven stable conformations were considered for each peptide, with formation of 5-10 member cycles involving nitrogen from the peptidic bond or from the amine, oxygen from the peptidic bond or from the carboxylate group, or sulfur from the other residue for Met Met. The absorption wavelengths corresponding to the σ → σ* transition calcd. for each complex at the TD-BH&HLYP/6-311+G(d,p)//BH&HLYP/6-31G(d) level of theory vary from the near-UV for the S O bonds to the green visible for the S S bonds. For X = N, they increase with the SN distance as expected for a 2c-3e bond, whereas for X = O they slightly decrease. Characterization of these 2c-3e bonds as a function of the sequence, using the ELF and the AIM topol. analyses, shows the different natures of the S X bonds, which is purely 2c-3e for X = S, mainly 2c-3e with a part of electrostatic interaction for X = N and mainly electrostatic for X = O.
  6. 6
    Glass, R. S., Hug, G. L., Schoneich, C., Wilson, G. S., Kuznetsova, L., Lee, T. M., Ammam, M., Lorance, E., Nauser, T., Nichol, G. S., and Yamamoto, T. (2009) Neighboring Amide Participation in Thioether Oxidation: Relevance to Biological Oxidation J. Am. Chem. Soc. 131, 13791– 13805 DOI: 10.1021/ja904895u
    Google Scholar
    There is no corresponding record for this reference.
  7. 7
    Glass, R. S., Petsom, A., Hojjatie, M., Coleman, B. R., Duchek, J. R., Klug, J., and Wilson, G. S. (1988) Facilitation of Electrochemical Oxidation of Dialkyl Sulfides Appended with Neighboring Carboxylate and Alcohol Groups J. Am. Chem. Soc. 110, 4772– 4778 DOI: 10.1021/ja00222a040
    Google Scholar
    There is no corresponding record for this reference.
  8. 8
    Jovanovic, S. V., Harriman, A., and Simic, M. G. (1986) Electron-Transfer Reactions of Tryptophan and Tyrosine Derivatives J. Phys. Chem. 90, 1935– 1939 DOI: 10.1021/j100400a039
    Google Scholar
    8
    Electron-transfer reactions of tryptophan and tyrosine derivatives
    Jovanovic, Slobodan V.; Harriman, Anthony; Simic, Michael G.
    Journal of Physical Chemistry (1986), 90 (9), 1935-9CODEN: JPCHAX; ISSN:0022-3654.
    Oxidn. of tryptophan, tyrosine, and their derivs. by oxidizing radicals was studied by pulse radiolysis in aq. solns. at 20°. Rate consts. for the oxidn. of tryptophan derivs. with •N3 and Br2-• radicals vary from 8 × 108 to 4.8 × 109 M-1 s-1 and oxidn. goes to completion; no pH dependence was obsd. Oxidn. rate consts. for tyrosine derivs. increase upon deprotonation of the phenolic residue at higher pH. Redox potentials for the indolyl and phenoxyl radicals were derived from the measured equil. consts. by using p-methoxyphenol (E7.5 = 0.6 and E13 = 0.4 V), bisulfite (E3 = 0.84 V), and guanosine (E = 0.91 V) redox couples as ref. systems. The redox potential of the tryptophyl radical was measured by pulse radiolysis and laser photolysis and found, by both techniques, to be E = 0.64 V at pH 7. Redox potentials of tryptophan derivs. were dependent on the nature of the side chain possibly due to interaction of the side chain with the nitrogen atom in the pyrrole ring. Redox potentials of tyrosine derivs. were independent of the nature of the side chain and higher than the redox potentials of tryptophan derivs. The values E7 = 0.85 V and E13 = 0.65 V were measured for the tyrosine/phenoxyl radical redox couple at pH 7 and 13, resp. Electron transfer from tyrosine to tryptophyl radicals was slow in neutral media, k = 5 × 105-1.3 × 106 M-1 s-1, and proceeded via multiple steps, one of which is proton transfer from tyrosine to tryptophyl radicals followed by electron transfer.
  9. 9
    Surdhar, P. S. and Armstrong, D. A. (1987) Reduction potentials and exchange reactions of thiyl radicals and disulfide anion radicals J. Phys. Chem. 91, 6532– 6537 DOI: 10.1021/j100310a022
    Google Scholar
    9
    Reduction potentials and exchange reactions of thiyl radicals and disulfide anion radicals
    Surdhar, Parminder S.; Armstrong, David A.
    Journal of Physical Chemistry (1987), 91 (26), 6532-7CODEN: JPCHAX; ISSN:0022-3654.
    Redox equil. between RS• and -s•-S= radicals, and between these types of radical and phenoxyl and chlorpromazine radicals were investigated in aq. solns. at pHs over the range 6-10 to obtain a self-consistent set of redox potentials for the reaction: PhO• + H+ + e- = PhOH; RṠSR- + 2H+ + e- = 2RSH; and RS• + H+ + e- = RSH (18), in S systems with alkyl R groups. Abs. std. potentials were calcd. on the basis of E0 = 0.83 V for the chlorpromazine couple. The results for E04 (-1.35 ± 0.02 V) and E018 (=1.33 ± 0.02 V) were in agreement with values calcd. from thermodn. data within the known uncertainties. E018 Was found to exhibit a falloff when electron-rich groups, such as the 2 methyls of penicillamine or the CO2- of β-mercaptoacetic acid, were present on the C adjacent to the S atom. However, the effect was relatively small (∼10-14 mV). The E011 was 1.72 ± 0.02 V for β-mercaptoethanol. The corresponding potentials for the cyclic anions of dithiothreitol, dithioerythreitol, and lipoamide were the same within exptl. error, but the uncertainties were larger (±0.4 V). (e- + -S-S- = -Ṡ-S= of E022 was calcd. to be -1.60 V, showing that only strongly reducing species could donate electrons to disulfide. Rate consts. for several of the forward and backward reactions in the equil. were also detd.
  10. 10
    Yashiro, H., White, R. C., Yurkovskaya, A. V., and Forbes, M. D. E. (2005) Methionine radical cation: Structural studies as a function of pH using X- and Q-band time-resolved electron paramagnetic resonance spectroscopy J. Phys. Chem. A 109, 5855– 5864 DOI: 10.1021/jp051551k
    Google Scholar
    10
    Methionine Radical Cation: Structural Studies as a Function of pH Using X- and Q-Band Time-Resolved Electron Paramagnetic Resonance Spectroscopy
    Yashiro, Haruhiko; White, Ryan C.; Yurkovskaya, Alexandra V.; Forbes, Malcolm D. E.
    Journal of Physical Chemistry A (2005), 109 (26), 5855-5864CODEN: JPCAFH; ISSN:1089-5639. (American Chemical Society)
    A comprehensive high resoln. ESR (EPR) characterization of the L-methionine radical cation and its N-acetyl deriv. in liq. soln. at room temp. is presented. The cations were generated photochem. in high yield by excimer laser excitation of a water sol. dye, anthraquinone sulfonate sodium salt, the excited triplet state of which is quenched by electron transfer from the side chain sulfur atom of methionine or N-acetylmethionine. The radicals were detected by continuous wave (CW) time-resolved ESR (TREPR) spectroscopy at X-band (9.5 GHz) and Q-band (35 GHz) microwave frequencies. At pH values well below the pKa of the protonated amine nitrogen, the cation forms a dimer with another ground-state methionine mol. through a S-S three-electron bond. In basic soln., the lone pair on the nitrogen of the amino acid is available to make an intramol. S-N three-electron bond with the side chain sulfur atom, leading to a five-membered ring structure for the cation. When the amino acid nitrogen is unsubstituted (methionine itself), rapid deprotonation to an aminyl radical takes place at high pH values. If the nitrogen is substituted (N-acetylmethionine), the cyclic structure is obsd. within its electron spin relaxation time at about 1 μs. Spectral simulation provides chem. shifts (g-factors) and hyperfine coupling consts. for all structures, and isotopic labeling expts. strongly support the assignments.
  11. 11
    Navaratnam, S. and Parsons, B. J. (1998) Reduction Potential of Histidine Free Radicals: a Pulse Radiolysis Study J. Chem. Soc., Faraday Trans. 94, 2577– 2581 DOI: 10.1039/a803477j
    Google Scholar
    11
    Reduction potential of histidine free radicals: a pulse radiolysis study
    Navaratnam, S.; Parsons, B. J.
    Journal of the Chemical Society, Faraday Transactions (1998), 94 (17), 2577-2581CODEN: JCFTEV; ISSN:0956-5000. (Royal Society of Chemistry)
    The technique of pulse radiolysis has been used to demonstrate that all histidine free radicals (designated HisNsbd+) produced by oxidn. of histidine by Br2- radical anions can oxidize the water sol. vitamin E analog, Trolox C (k = 1.0±0.2 × 109 d mol-1 s-1 at pH 6.95). It has also been shown that HisNsbd+ radicals can react with tryptophan in electron transfer equil. involving both HisNsbd+ and TrpNsbd+ species over the pH range 6.4-9.0. The ΔE values [E(TrpNsbd+/Trp)-E(HisNsbd+/His)] range from -140 to -161 mV and indicate an E7(HisNsbd+/His) value of 1170 mV [based on E7(TrpNsbd+/Trp) = 1015 mV at pH 7]. The effect of pH on E(HisNsbd+/His) was accounted for by assuming that HisNsbd+ can deprotonate to yield a bi-allylic free radical, designated His (-H+). The pKa for this dissocn. was estd. to be in the range 5-7. The implications of the relatively high redn. potential for HisNsbd+ in its possible participation in the mechanism of action of non-heme metalloenzymes is discussed.
  12. 12
    Stubbe, J. and van der Donk, W. A. (1998) Protein Radicals in Enzyme Catalysis Chem. Rev. 98, 705– 762 DOI: 10.1021/cr9400875
    Google Scholar
    12
    Protein Radicals in Enzyme Catalysis
    Stubbe, JoAnne; van der Donk, Wilfred A.
    Chemical Reviews (Washington, D. C.) (1998), 98 (2), 705-762CODEN: CHREAY; ISSN:0009-2665. (American Chemical Society)
    A review with 559 refs. with emphasis on the general principles that have evolved governing the formation of protein radicals and their roles in catalysis. New exptl. information that has emerged since 1988 is summarized for each system that has been thus far characterized. The scope of this review is limited to enzymic systems that utilize amino acid or modified amino acid based radicals that are covalently linked to the protein. The discussion covers one electron oxidized amino acids identified in proteins, biosynthesis of (modified) amino acid radicals, methods to examine radical dependent reactions, and ribonucleotide reductases, cytochrome c peroxidase, prostaglandin H synthase, pyruvate formate lyase, galactose oxidase, photosynthetic oxygen evolution, quinoproteins, and other systems in which protein-based radicals have been proposed or detected.
  13. 13
    Aubert, C., Mathis, P., Eker, A. P. M., and Brettel, K. (1999) Intraprotein Electron Transfer between Tyrosine and Tryptophan in DNA photolysase from Anacystis nidulans Proc. Natl. Acad. Sci. U. S. A. 96, 5423– 5427 DOI: 10.1073/pnas.96.10.5423
    Google Scholar
    There is no corresponding record for this reference.
  14. 14
    Aubert, C., Vos, M. H., Mathis, P., Eker, A. P. M., and Brettel, K. (2000) Intraprotein Radical Transfer during Photoactivation of DNA Photolyase Nature 405, 586– 590 DOI: 10.1038/35014644
    Google Scholar
    14
    Intraprotein radical transfer during photoactivation of DNA photolyase
    Aubert, Corinne; Vos, Marten H.; Mathis, Paul; Eker, Andre P. M.; Brettel, Kiaus
    Nature (London) (2000), 405 (6786), 586-590CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)
    Amino-acid radicals play key roles in many enzymic reactions. Catalysis often involves transfer of a radical character within the protein, as in class I ribonucleotide reductase where radical transfer occurs over 35 Å, from a tyrosyl radical to a cysteine. It is currently debated whether this kind of long-range transfer occurs by electron transfer, followed by proton release to create a neutral radical, or by H-atom transfer, i.e., simultaneous transfer of electrons and protons. The latter mechanism avoids the energetic cost of charge formation in the low dielec. protein, but it is less robust to structural changes than is electron transfer. Available exptl. data do not clearly discriminate between these proposals. We have studied the mechanism of photoactivation (light-induced redn. of the FAD cofactor) of Escherichia coli DNA photolyase using time-resolved absorption spectroscopy. Here we show that the excited FAD radical abstrs. an electron from a nearby tryptophan in 30 ps. After subsequent electron transfer along a chain of three tryptophans, the most remote tryptophan (as a cation radical) releases a proton to the solvent in about 300 ns, showing that electron transfer occurs before proton dissocn. A similar process may take place in photolyase-like blue-light receptors.
  15. 15
    DeGray, J. A., Lassmann, G., Curtis, J. F., Kennedy, T. A., Marnett, L. J., Eling, T. E., and Mason, R. P. (1992) Spectral-Analysis of the Protein-Derived Tyrosyl Radicals from Prostaglandin-H Synthase J. Biol. Chem. 267, 23583– 23588
    Google Scholar
    There is no corresponding record for this reference.
  16. 16
    Eklund, H., Eriksson, M., Uhlin, U., Nordlund, P., and Logan, D. (1997) Ribonucleotide Reductase - Structural Studies of a Radical Enzyme Biol. Chem. 378, 821– 825
    Google Scholar
    There is no corresponding record for this reference.
  17. 17
    Goodin, D. B., Mauk, A. G., and Smith, M. (1986) Studies of the Radical Species in Compound ES of Cytochrome c Peroxidase Altered by Site-Directed Mutagenesis Proc. Natl. Acad. Sci. U. S. A. 83, 1295– 1299 DOI: 10.1073/pnas.83.5.1295
    Google Scholar
    There is no corresponding record for this reference.
  18. 18
    Green, M. T. (1999) Evidence for Sulfur-Based Radicals in Thiolate Compound I Intermediates J. Am. Chem. Soc. 121, 7939– 7940 DOI: 10.1021/ja991541v
    Google Scholar
    18
    Evidence for Sulfur-Based Radicals in Thiolate Compound I Intermediates
    Green, Michael T.
    Journal of the American Chemical Society (1999), 121 (34), 7939-7940CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
    Compd. I species are believed to be the active intermediates in the catalytic cycles of a no. of oxidative heme enzymes. With one exception, these reactive complexes are thought to be best formulated as ferryl porphyrin radical cations. Recent findings, however, indicate that the electronic structure of compd. I may depend dramatically upon the nature of the axial ligand and suggest that in some cases (thiolate-ligated heme proteins in particular) an alternative formulation of the compd. I species may be more appropriate. A few researchers have suggested that, in thiolate-heme proteins, the thiolate ligand (rather than the porphyrin) may give up an electron to stabilize the Fe(IV)-oxo species, thereby generating a sulfur radical. In support of this hypothesis, Xα calcns. on a thiolate compd. I complex do show significant spin d. on sulfur. However, these Xα calcns. yield a quartet ground state, while compd. I is known to be a doublet. To investigate the possibility that thiolate compd. I species possess sulfur-based radicals, calcns. have been performed using th B3LYP functional. Using GAUSSIAN94, unrestricted calcns. were performed on a 43 atom active site model of a thiolate compd. I intermediate. The cysteinate axial ligand was replaced with a Me mercaptide unit and hydrogen atoms were substituted for the eight carbons directly attached to the porphyrin ring, yielding the Fe(N4C20H12)(SCH3)O 43 atom species. Our calcns. predict a doublet ground state, in agreement with EPR expts. that show chloroperoxidase compd. I to display strong antiferromagnetic coupling (J = -35 cm-1). Since chloroperoxidase compd. I is the only known compd. I system to show this sort of coupling, our calcd. value of J = -77 cm-1 is an important indicator of the quality of our calcns.
  19. 19
    Licht, S., Gerfen, G. J., and Stubbe, J. A. (1996) Thiyl radicals in ribonucleotide reductases Science 271, 477– 481 DOI: 10.1126/science.271.5248.477
    Google Scholar
    19
    Thiyl radicals in ribonucleotide reductases
    Licht, Stuart; Gerfen, Gary J.; Stubbe, JoAnne
    Science (Washington, D. C.) (1996), 271 (5248), 477-81CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
    The ribonucleoside triphosphate reductase (RTPR) from Lactobacillus leichmannii catalyzes adenosylcobalamin (AdoCbl)-dependent nucleotide redn., as well as exchange of the 5' hydrogens of AdoCbl with solvent. A protein-based thiyl radical is proposed as an intermediate in both of these processes. In the presence of RTPR contg. specifically deuterated cysteine residues, the ESR spectrum of an intermediate in the exchange reaction and the redn. reaction, trapped by rapid freeze quench techniques, exhibits narrowed hyperfine features relative to the corresponding unlabeled RTPR. The spectrum was interpreted to represent a thiyl radical coupled to cob(II)alamin. Another proposed intermediate, 5'-deoxyadenosine, was detected by rapid acid quench techniques. Similarities in mechanism between RTPR and the Escherichia coli ribonucleotide reductase suggest that both enzymes require a thiyl radical for catalysis.
  20. 20
    Pogni, R., Baratto, M. C., Teutloff, C., Giansanti, S., Ruiz-Dueñas, F. J., Choinowski, T., Piontek, K., Martínez, A. T., Lendzian, F., and Basosi, R. (2006) A Tryptophan Neutral Radical in the Oxidized State of Versatile Peroxidase from Pleurotus eryngii: a Combined Multifrequency EPR and Density Functional Theory Study J. Biol. Chem. 281, 9517– 9526 DOI: 10.1074/jbc.M510424200
    Google Scholar
    20
    A Tryptophan Neutral Radical in the Oxidized State of Versatile Peroxidase from Pleurotus eryngii: A combined multifrequency EPR and density functional theory study
    Pogni, Rebecca; Baratto, M. Camilla; Teutloff, Christian; Giansanti, Stefania; Ruiz-Duenas, Francisco J.; Choinowski, Thomas; Piontek, Klaus; Martinez, Angel T.; Lendzian, Friedhelm; Basosi, Riccardo
    Journal of Biological Chemistry (2006), 281 (14), 9517-9526CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)
    Versatile peroxidases are heme enzymes that combine catalytic properties of lignin peroxidases and manganese peroxidases, being able to oxidize Mn2+ as well as phenolic and non-phenolic arom. compds. in the absence of mediators. The catalytic process (initiated by hydrogen peroxide) is the same as in classical peroxidases, with the involvement of 2 oxidizing equiv. and the formation of the so-called Compd. I. This latter state contains an oxoferryl center and an org. cation radical that can be located on either the porphyrin ring or a protein residue. In this study, a radical intermediate in the reaction of versatile peroxidase from the ligninolytic fungus Pleurotus eryngii with H2O2 has been characterized by multifrequency (9.4 and 94 GHz) EPR and assigned to a tryptophan residue. Comparison of exptl. data and d. functional theory theor. results strongly suggests the assignment to a tryptophan neutral radical, excluding the assignment to a tryptophan cation radical or a histidine radical. Based on the exptl. detd. side chain orientation and comparison with a high resoln. crystal structure, the tryptophan neutral radical can be assigned to Trp164 as the site involved in long-range electron transfer for arom. substrate oxidn.
  21. 21
    Bernini, C., Pogni, R., Basosi, R., and Sinicropi, A. (2012) The nature of tryptophan radicals involved in the long-range electron transfer of lignin peroxidase and lignin peroxidase-like systems: Insights from quantum mechanical/molecular mechanics simulations Proteins: Struct., Funct., Genet. 80, 1476– 1483 DOI: 10.1002/prot.24046
    Google Scholar
    There is no corresponding record for this reference.
  22. 22
    Gray, H. B. and Winkler, J. R. (2015) Hole hopping through tyrosine/tryptophan chains protects proteins from oxidative damage Proc. Natl. Acad. Sci. U. S. A. 112, 10920– 10925 DOI: 10.1073/pnas.1512704112
    Google Scholar
    22
    Hole hopping through tyrosine/tryptophan chains protects proteins from oxidative damage
    Gray, Harry B.; Winkler, Jay R.
    Proceedings of the National Academy of Sciences of the United States of America (2015), 112 (35), 10920-10925CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
    Living organisms have adapted to atm. dioxygen by exploiting its oxidizing power while protecting themselves against toxic side effects. Reactive oxygen and nitrogen species formed during oxidative stress, as well as high-potential reactive intermediates formed during enzymic catalysis, could rapidly and irreversibly damage polypeptides were protective mechanisms not available. Chains of redox-active tyrosine and tryptophan residues can transport potentially damaging oxidizing equiv. (holes) away from fragile active sites and toward protein surfaces where they can be scavenged by cellular reductants. Precise positioning of these chains is required to provide effective protection without inhibiting normal function. A search of the structural database reveals that about one third of all proteins contain Tyr/Trp chains composed of three or more residues. Although these chains are distributed among all enzyme classes, they appear with greatest frequency in the oxidoreductases and hydrolases. Consistent with a redox-protective role, approx. half of the dioxygen-using oxidoreductases have Tyr/Trp chain lengths ≥3 residues. Among the hydrolases, long Tyr/Trp chains appear almost exclusively in the glycoside hydrolases. These chains likely are important for substrate binding and positioning, but a secondary redox role also is a possibility.
  23. 23
    Muller, P., Yamamoto, J., Martin, R., Iwai, S., and Brettel, K. (2015) Discovery and functional analysis of a 4th electron-transferring tryptophan conserved exclusively in animal cryptochromes and (6–4) photolyases Chem. Commun. 51, 15502– 15505 DOI: 10.1039/C5CC06276D
    Google Scholar
    There is no corresponding record for this reference.
  24. 24
    Winkler, J. R. and Gray, H. B. (2015) Electron flow through biological molecules: does hole hopping protect proteins from oxidative damage? Q. Rev. Biophys. 48, 411– 420 DOI: 10.1017/S0033583515000062
    Google Scholar
    24
    Electron flow through biological molecules: does hole hopping protect proteins from oxidative damage?
    Winkler, Jay R.; Gray, Harry B.
    Quarterly Reviews of Biophysics (2015), 48 (4), 411-420CODEN: QURBAW; ISSN:0033-5835. (Cambridge University Press)
    Biol. electron transfers often occur between metal-contg. cofactors that are sepd. by very large mol. distances. Employing photosensitizer-modified iron and copper proteins, we have shown that single-step electron tunneling can occur on nanosecond to microsecond timescales at distances between 15 and 20 Å. We also have shown that charge transport can occur over even longer distances by hole hopping (multistep tunneling) through intervening tyrosines and tryptophans. In this perspective, we advance the hypothesis that such hole hopping through Tyr/Trp chains could protect oxygenase, dioxygenase, and peroxidase enzymes from oxidative damage. In support of this view, by examg. the structures of P 450 (CYP102A) and 2OG-Fe (TauD) enzymes, we have identified candidate Tyr/Trp chains that could transfer holes from uncoupled high-potential intermediates to reductants in contact with protein surface sites.
  25. 25
    Kathiresan, M. and English, A. M. (2017) LC-MS/MS suggests that hole hopping in cytochrome c peroxidase protects its heme from oxidative modification by excess H2O2 Chem. Sci. 8, 1152– 1162 DOI: 10.1039/C6SC03125K
    Google Scholar
    25
    LC-MS/MS suggests that hole hopping in cytochrome c peroxidase protects its heme from oxidative modification by excess H2O2
    Kathiresan, Meena; English, Ann M.
    Chemical Science (2017), 8 (2), 1152-1162CODEN: CSHCCN; ISSN:2041-6520. (Royal Society of Chemistry)
    We recently reported that cytochrome c peroxidase (Ccp1) functions as a H2O2 sensor protein when H2O2 levels rise in respiring yeast. The availability of its reducing substrate, ferrocytochrome c (CycII), dets. whether Ccp1 acts as a H2O2 sensor or peroxidase. For H2O2 to serve as a signal it must modify its receptor so we employed high-performance LC-MS/MS to investigate in detail the oxidn. of Ccp1 by 1, 5 and 10 M eq. of H2O2 in the absence of CycII to prevent peroxidase activity. We observe strictly heme-mediated oxidn., implicating sequential cycles of binding and redn. of H2O2 at Ccp1's heme. This results in the incorporation of ∼20 oxygen atoms predominantly at methionine and tryptophan residues. Extensive intramol. dityrosine crosslinking involving neighboring residues was uncovered by LC-MS/MS sequencing of the crosslinked peptides. The proximal heme ligand, H175, is converted to oxo-histidine, which labilizes the heme but irreversible heme oxidn. is avoided by hole hopping to the polypeptide until oxidn. of the catalytic distal H52 in Ccp1 treated with 10 M eq. of H2O2 shuts down heterolytic cleavage of H2O2 at the heme. Mapping of the 24 oxidized residues in Ccp1 reveals that hole hopping from the heme is directed to three polypeptide zones rich in redox-active residues. This unprecedented anal. unveils the remarkable capacity of a polypeptide to direct hole hopping away from its active site, consistent with heme labilization being a key outcome of Ccp1-mediated H2O2 signaling. LC-MS/MS identification of the oxidized residues also exposes the bias of ESR (EPR) detection toward transient radicals with low O2 reactivity.
  26. 26
    Ortiz de Montellano, P. R., Ed. (2015) Cytochrome P450 - Structure, Mechanism, and Biochemistry, Springer, Switzerland.
    Google Scholar
    There is no corresponding record for this reference.
  27. 27
    Green, M. T., Dawson, J. H., and Gray, H. B. (2004) Oxoiron(IV) in Chloroperoxidase Compound II is Basic: Implications for P450 Chemistry Science 304, 1653– 1656 DOI: 10.1126/science.1096897
    Google Scholar
    27
    Oxoiron(IV) in Chloroperoxidase Compound II Is Basic: Implications for P450 Chemistry
    Green, Michael T.; Dawson, John H.; Gray, Harry B.
    Science (Washington, DC, United States) (2004), 304 (5677), 1653-1656CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
    With the use of x-ray absorption spectroscopy, we have found that the Fe-O bond in chloroperoxidase compd. II (CPO-II) is much longer than expected for an oxoiron(IV) (ferryl) unit; notably, the exptl. detd. bond length of 1.82(1) Å accords closely with d. functional calcns. on a protonated ferryl (FeIV-OH, 1.81 Å). The basicity of the CPO-II ferryl [pKa > 8.2 (where Ka is the acid dissocn. const.)] is attributable to strong electron donation by the axial thiolate. We suggest that the CPO-II protonated ferryl is a good model for the rebound intermediate in the P 450 oxygenation cycle; with elevated pKa values after one-electron redn., thiolate-ligated ferryl radicals are competent to oxygenate satd. hydrocarbons at potentials that can be tolerated by folded polypeptide hosts.
  28. 28
    Behan, R. K., Hoffart, L. M., Stone, K. L., Krebs, C., and Green, M. T. (2006) Evidence for basic ferryls in cytochromes P450 J. Am. Chem. Soc. 128, 11471– 11474 DOI: 10.1021/ja062428p
    Google Scholar
    28
    Evidence for Basic Ferryls in Cytochromes P450
    Behan, Rachel K.; Hoffart, Lee M.; Stone, Kari L.; Krebs, Carsten; Green, Michael T.
    Journal of the American Chemical Society (2006), 128 (35), 11471-11474CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
    Using a combination of Mossbauer spectroscopy and d. functional calcns., we have detd. that the ferryl forms of P 450BM3 and P450cam are protonated at physiol. pH. D. functional calcns. were performed on large active-site models of these enzymes to det. the theor. Mossbauer parameters for the ferryl and protonated ferryl (FeIVOH) species. These calcns. revealed a significant enlargement of the quadrupole splitting parameter upon protonation of the ferryl unit. The calcd. quadrupole splittings for the protonated and unprotonated ferryl forms of P 450BM3 are ΔEq = 2.17 mm/s and ΔEq = 1.05 mm/s, resp. For P450cam, they are ΔEq = 1.84 mm/s and ΔEq = 0.66 mm/s, resp. The exptl. detd. quadrupole splittings (P 450BM3, ΔEq = 2.16 mm/s; P450cam, ΔEq = 2.06 mm/s) are in good agreement with the values calcd. for the protonated forms of the enzymes. Our results suggest that basic ferryls are a natural consequence of thiolate-ligated hemes.
  29. 29
    Krest, C. M., Onderko, E. L., Yosca, T. H., Calixto, J. C., Karp, R. F., Livada, J., Rittle, J., and Green, M. T. (2013) Reactive Intermediates in Cytochrome P450 Catalysis J. Biol. Chem. 288, 17074– 17081 DOI: 10.1074/jbc.R113.473108
    Google Scholar
    29
    Reactive Intermediates in Cytochrome P450 Catalysis
    Krest, Courtney M.; Onderko, Elizabeth L.; Yosca, Timothy H.; Calixto, Julio C.; Karp, Richard F.; Livada, Jovan; Rittle, Jonathan; Green, Michael T.
    Journal of Biological Chemistry (2013), 288 (24), 17074-17081CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)
    A review. Recently, we reported the spectroscopic and kinetic characterizations of cytochrome P 450 compd. I in CYP119A1, effectively closing the catalytic cycle of cytochrome P 450-mediated hydroxylations. In this minireview, we focus on the developments that made this breakthrough possible. We examine the importance of enzyme purifn. in the quest for reactive intermediates and report the prepn. of compd. I in a second P 450 (P450ST). In an effort to bring clarity to the field, we also examine the validity of controversial reports claiming the prodn. of P 450 compd. I through the use of peroxynitrite and laser flash photolysis.
  30. 30
    Rittle, J. and Green, M. T. (2010) Cytochrome P450 Compound I: Capture, Characterization, and C-H Bond Activation Kinetics Science 330, 933– 937 DOI: 10.1126/science.1193478
    Google Scholar
    30
    Cytochrome P450 Compound I: Capture, Characterization, and C-H Bond Activation Kinetics
    Rittle, Jonathan; Green, Michael T.
    Science (Washington, DC, United States) (2010), 330 (6006), 933-937CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
    Cytochrome P 450 enzymes are responsible for the phase I metab. of approx. 75% of known pharmaceuticals. P 450s perform this and other important biol. functions through the controlled activation of C-H bonds. Here, we report the spectroscopic and kinetic characterization of the long-sought principal intermediate involved in this process, P 450 compd. I (P 450-I), which we prepd. in approx. 75% yield by reacting ferric CYP119 with m-chloroperbenzoic acid. The Mossbauer spectrum of CYP119-I is similar to that of chloroperoxidase compd. I, although its ESR spectrum reflects an increase in |J|/D, the ratio of the exchange coupling to the zero-field splitting. CYP119-I hydroxylates the unactivated C-H bonds of lauric acid [D(C-H) ~ 100 kcal per mol], with an apparent second-order rate const. of kapp = 1.1 × 107 per M per s at 4°. Direct measurements put a lower limit of k ≥ 210 per s on the rate const. for bound substrate oxidn., whereas analyses involving kinetic isotope effects predict a value in excess of 1400 per s.
  31. 31
    Yosca, T. H., Rittle, J., Krest, C. M., Onderko, E. L., Silakov, A., Calixto, J. C., Behan, R. K., and Green, M. T. (2013) Iron(IV)hydroxide pK(a) and the Role of Thiolate Ligation in C-H Bond Activation by Cytochrome P450 Science 342, 825– 829 DOI: 10.1126/science.1244373
    Google Scholar
    31
    Iron(IV)hydroxide pKa and the Role of Thiolate Ligation in C-H Bond Activation by Cytochrome P450
    Yosca, Timothy H.; Rittle, Jonathan; Krest, Courtney M.; Onderko, Elizabeth L.; Silakov, Alexey; Calixto, Julio C.; Behan, Rachel K.; Green, Michael T.
    Science (Washington, DC, United States) (2013), 342 (6160), 825-829CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
    Cytochrome P 450 enzymes activate oxygen at heme iron centers to oxidize relatively inert substrate carbon-hydrogen bonds. Cysteine thiolate coordination to iron is posited to increase the pKa (where Ka is the acid dissocn. const.) of compd. II, an iron(IV)hydroxide complex, correspondingly lowering the one-electron redn. potential of compd. I, the active catalytic intermediate, and decreasing the driving force for deleterious auto-oxidn. of tyrosine and tryptophan residues in the enzyme's framework. Here, we report on the prepn. of an iron(IV)hydroxide complex in a P 450 enzyme (CYP158) in ≥90% yield. Using rapid mixing technologies in conjunction with Moessbauer, UV/visible, and x-ray absorption spectroscopies, we det. a pKa value for this compd. of 11.9. Marcus theory anal. indicates that this elevated pKa results in a >10,000-fold redn. in the rate const. for oxidns. of the protein framework, making these processes noncompetitive with substrate oxidn.
  32. 32
    Modi, A. R., Dawson, J. H., Hrycay, E. G., and Bandiera, S. M. (2015) Oxidizing Intermediates in P450 Catalysis: A Case for Multiple Oxidants Adv. Exp. Med. Biol. 851, 63– 81 DOI: 10.1007/978-3-319-16009-2_2
    Google Scholar
    32
    Oxidizing intermediates in P450 catalysis: a case for multiple oxidants
    Modi, Anuja R.; Dawson, John H.
    Advances in Experimental Medicine and Biology (2015), 851 (Monooxygenase, Peroxidase and Peroxygenase Properties and Mechanisms of Cytochrome P450), 63-81CODEN: AEMBAP; ISSN:2214-8019. (Springer)
    A review. Cytochrome P 450 (P 450 or CYP) catalysis involves the oxygenation of org. compds. via a series of catalytic intermediates, namely, the ferric-peroxo, ferric-hydroperoxo, Compd. I (Cpd I) and FeIII -(H2O2) intermediates. Now that the structures of P 450 enzymes have been well established, a major focus of current research in the P 450 area has been unraveling the intimate details and activities of these reactive intermediates. The general consensus is that the Cpd I intermediate is the most reactive species in the reaction cycle, esp. when the reaction involves hydrocarbon hydroxylation. Cpd I has recently been characterized exptl. Other than Cpd I, there is a multitude of evidence, both exptl. as well as theor., supporting the involvement of other intermediates in various types of oxidn. reactions. The involvement of these multiple oxidants has been exptl. demonstrated using P 450 active-site mutants in epoxidn., heteroatom oxidn. and dealkylation reactions. In this chapter, we will review the P 450 reaction cycle and each of the reactive intermediates to discuss their role in oxidn. reactions.
  33. 33
    Sutin, N. and Creutz, C. (1978) Properties and Reactivities of the Luminescent Excited States of Polypyridine Complexes of Ruthenium(II) and Osmium(II), in Inorganic and Organometallic Photochemistry (Wrighton, M. S., Ed.), pp 1– 27, American Chemical Society, Washington, DC.
    Google Scholar
    There is no corresponding record for this reference.
  34. 34
    Creutz, C., Chou, M., Netzel, T. L., Okumura, M., and Sutin, N. (1980) Lifetimes, Spectra, and Quenching of the Excited-States of Polypyridine Complexes of Iron(II), Ruthenium(II), and Osmium(II) J. Am. Chem. Soc. 102, 1309– 1319 DOI: 10.1021/ja00524a014
    Google Scholar
    There is no corresponding record for this reference.
  35. 35
    Ener, M. E., Lee, Y. T., Winkler, J. R., Gray, H. B., and Cheruzel, L. (2010) Photooxidation of cytochrome P450-BM3 Proc. Natl. Acad. Sci. U. S. A. 107, 18783– 18786 DOI: 10.1073/pnas.1012381107
    Google Scholar
    35
    Photooxidation of cytochrome P450-BM3
    Ener, Maraia E.; Lee, Young-Tae; Winkler, Jay R.; Gray, Harry B.; Cheruzel, Lionel
    Proceedings of the National Academy of Sciences of the United States of America (2010), 107 (44), 18783-18786, S18783/1-S18783/6CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
    High-valent iron-oxo species are thought to be intermediates in the catalytic cycles of oxygenases and peroxidases. An attractive route to these iron-oxo intermediates involves laser flash-quench oxidn. of ferric hemes, as demonstrated by our work on the ferryl (compd. II) and ferryl porphyrin radical cation (compd. I) intermediates of horseradish peroxidase. Extension of this work to include cytochrome P 450-BM3 (CYP102A1) has required covalent attachment of a RuII photosensitizer to a nonnative cysteine near the heme (RuIIK97C-FeIIIP450), in order to promote electron transfer from the FeIII porphyrin to photogenerated RuIII. The RuIIK97C- FeIII,P450 conjugate was structurally characterized by X-ray crystallog. (2.4 Å resoln.; Ru-Fe distance, 24 Å). Flash-quench oxidn. of the ferric-aquo heme produces an FeIV-hydroxide species (compd. II) within 2 ms. Difference spectra for three singly oxidized P 450-BM3 intermediates were obtained from kinetics modeling of the transient absorption data in combination with generalized singular value decompn. anal. and multiexponential fitting.
  36. 36
    Girvan, H. M., Seward, H. E., Toogood, H. S., Cheesman, M. R., Leys, D., and Munro, A. W. (2007) Structural and spectroscopic characterization of P450BM3 mutants with unprecedented P450 heme iron ligand sets - New heme ligation states influence conformational equilibria in P450BM3 J. Biol. Chem. 282, 564– 572 DOI: 10.1074/jbc.M607949200
    Google Scholar
    There is no corresponding record for this reference.
  37. 37
    Park, S.-Y., Yamane, K., Adachi, S.-i., Shiro, Y., Weiss, K. E., Maves, S. A., and Sligar, S. G. (2002) Thermophilic cytochrome P450 (CYP119) from Sulfolobus solfataricus: high resolution structure and functional properties J. Inorg. Biochem. 91, 491– 501 DOI: 10.1016/S0162-0134(02)00446-4
    Google Scholar
    37
    Thermophilic cytochrome P450 (CYP119) from Sulfolobus solfataricus: high resolution structure and functional properties
    Park, Sam-Yong; Yamane, Kazuhide; Adachi, Shin-ichi; Shiro, Yoshitsugu; Weiss, Kara E.; Maves, Shelley A.; Sligar, Stephen G.
    Journal of Inorganic Biochemistry (2002), 91 (4), 491-501CODEN: JIBIDJ; ISSN:0162-0134. (Elsevier Science Inc.)
    Crystal structures of a thermostable cytochrome P 450 (CYP119) and a site-directed mutant, (Phe24Leu), from the acidothermophilic archaea Sulfolobus solfataricus were detd. at 1.5-2.0 A resoln. The authors identify important crystallog. waters in the ferric heme pocket, observe protein conformational changes upon inhibitor binding, and detect a unique distribution of surface charge not found in other P 450s. An anal. of factors contributing to thermostability of CYP119 of these high resoln. structures shows an apparent increase in clustering of arom. residues and optimum stacking. The contribution of arom. stacking was investigated further with the mutant crystal structure and differential scanning calorimetry.
  38. 38
    Castellano, F. N., Dattelbaum, J. D., and Lakowicz, J. R. (1998) Long-lifetime Ru(II) complexes as labeling reagents for sulfhydryl groups Anal. Biochem. 255, 165– 170 DOI: 10.1006/abio.1997.2468
    Google Scholar
    38
    Long-lifetime Ru(II) complexes as labeling reagents for sulfhydryl groups
    Castellano, Felix N.; Dattelbaum, Jonathan D.; Lakowicz, Joseph R.
    Analytical Biochemistry (1998), 255 (2), 165-170CODEN: ANBCA2; ISSN:0003-2697. (Academic Press)
    We report the synthesis and spectral properties of two long-lifetime highly luminescent Ru(II) complexes contg. either a sulfhydryl reactive iodoacetamido group or a less reactive chloroacetamido group, [Ru(bpy)2(5-iodoacetamido-1,10-phenanthroline)] (PF6)2 and [Ru(bpy)2(5-chloroacetamido-1,10-phenanthroline)](PF6)2, resp., where bpy is 2,2'-bipyridine. Ru(bpy)2(phen-IA)(PF6)2 was covalently linked to human serum albumin (HSA) and human IgG (IgG). The photoluminescence lifetime of protein-bound probes approaches 1 μs under ambient conditions. In the absence of rotational motions, this probe displayed an anisotropy of 0.18 for excitation at 472 nm. Anisotropy decay data were used to det. the overall rotational correlation times of HSA and IgG. These long-lifetime sulfhydryl-reactive probes can be used to recover microsecond rotational motions and/or domain motions of proteins and/or macromol. complexes.
  39. 39
    Mines, G. A., Bjerrum, M. J., Hill, M. G., Casimiro, D. R., Chang, I.-J., Winkler, J. R., and Gray, H. B. (1996) Rates of Heme Oxidation and Reduction in Ru(His33)cytochrome c at Very High Driving Forces J. Am. Chem. Soc. 118, 1961– 1965 DOI: 10.1021/ja9519243
    Google Scholar
    39
    Rates of Heme Oxidation and Reduction in Ru(His33)cytochrome c at Very High Driving Forces
    Mines, Gary A.; Bjerrum, Morten J.; Hill, Michael G.; Casimiro, Danilo R.; Chang, I-Jy; Winkler, Jay R.; Gray, Harry B.
    Journal of the American Chemical Society (1996), 118 (8), 1961-5CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
    The rates of Ru(His33)cytochrome c electron-transfer (ET) reactions have been measured over a driving-force range of 0.59 to 1.89 eV. The driving-force dependence of Fe2+ → Ru3+ ET in RuL2(i.m.)(His33)cytc [L = 2,2'-bipyridine (bpy), 4,4',5,5'-tetramethyl-2,2'-bipyridine (4,4',5,5'-(CH3)4-bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-(CH3)2-bpy), 4,4'-bis(N-ethylcarbamoyl)-2,2'-bipyridine (4,4'-(CONH(C2H5))2-bpy), 1,10-phenanthroline (phen); i.m. = imidazole] is well described by semiclassical ET theory with kmax = 2.5×106 s-1 (HAB = 0.092 cm-1) and λ = 0.76 eV. As predicted by theory, the rate of an exergonic (-ΔG° = 1.3 eV) heme redn. reaction, *Ru2+(bpy)2(i.m.)(His)→Fe3+, falls in the inverted region (k = 2.0×105 s-1). In contrast, the rates of three highly exergonic heme redns., *Ru2+(phen)2(CN)(His)→Fe3+ (2.0×105 s-1; 1.40 eV), Ru+(4,4'-(CONH(C2H5))2-bpy)2(i.m.)(His)→Fe3+ (2.3×105 s-1; 1.44 eV), and Ru+(phen)2(CN)(His)→Fe3+ (4.5×105 s-1; 1.89 eV), are much higher than expected for reactions directly to ground-state products. Agreement with theory is greatly improved by assuming that an electronically excited ferroheme (Fe2+ → *Fe2+ ∼ 1.05 eV) is the initial product in each of these reactions.
  40. 40
    Munro, A. W., Malarkey, K., McKnight, J., Thomson, A. J., Kelly, S. M., Price, N. C., Lindsay, J. G., Coggins, J. R., and Miles, J. S. (1994) The Role of Tryptophan-97 of Cytochrome P450-BM3 from Bacillus megaterium in Catalytic Function - Evidence Against the Covalent Switching Hypothesis of P450 Electron Transfer Biochem. J. 303, 423– 428 DOI: 10.1042/bj3030423
    Google Scholar
    There is no corresponding record for this reference.
  41. 41
    Coelho, P. S., Wang, Z. J., Ener, M. E., Baril, S. A., Kannan, A., Arnold, F. H., and Brustad, E. M. (2013) A serine-substituted P450 catalyzes highly efficient carbene transfer to olefins in vivo Nat. Chem. Biol. 9, 485– 487 DOI: 10.1038/nchembio.1278
    Google Scholar
    41
    A serine-substituted P450 catalyzes highly efficient carbene transfer to olefins in vivo
    Coelho, Pedro S.; Wang, Z. Jane; Ener, Maraia E.; Baril, Stefanie A.; Kannan, Arvind; Arnold, Frances H.; Brustad, Eric M.
    Nature Chemical Biology (2013), 9 (8), 485-487CODEN: NCBABT; ISSN:1552-4450. (Nature Publishing Group)
    Whole-cell catalysts for non-natural chem. reactions will open new routes to sustainable prodn. of chems. We designed a cytochrome 'P411' with unique serine-heme ligation that catalyzes efficient and selective olefin cyclopropanation in intact Escherichia coli cells. The mutation C400S in cytochrome P450BM3 gives a signature ferrous CO Soret peak at 411 nm, abolishes monooxygenation activity, raises the resting-state FeIII-to-FeII redn. potential and substantially improves NAD(P)H-driven activity.
  42. 42
    Whited, C. A., Belliston-Bittner, W., Dunn, A. R., Winkler, J. R., and Gray, H. B. (2009) Nanosecond photoreduction of inducible nitric oxide synthase by a Ru-diimine electron tunneling wire bound distant from the active site J. Inorg. Biochem. 103, 906– 911 DOI: 10.1016/j.jinorgbio.2009.04.001
    Google Scholar
    42
    Nanosecond photoreduction of inducible nitric oxide synthase by a Ru-diimine electron tunneling wire bound distant from the active site
    Whited, Charlotte A.; Belliston-Bittner, Wendy; Dunn, Alexander R.; Winkler, Jay R.; Gray, Harry B.
    Journal of Inorganic Biochemistry (2009), 103 (6), 906-911CODEN: JIBIDJ; ISSN:0162-0134. (Elsevier B.V.)
    A Ru-diimine wire, [(4,4',5,5'-tetramethylbipyridine)2Ru(F9bp)]2+ (tmRu-F9bp, where F9bp is 4-methyl-4'-methylperfluorobiphenylbipyridine), binds tightly to the oxidase domain of inducible nitric oxide synthase (iNOSoxy). The binding of tmRu-F9bp is independent of tetrahydrobiopterin, arginine, and imidazole, indicating that the wire resides on the surface of the enzyme, distant from the active-site heme. Photoredn. of an imidazole-bound active-site heme iron in the enzyme-wire conjugate (kET = 2(1) × 107 s-1) is fully seven orders of magnitude faster than the in vivo process.
  43. 43
    Dunn, A. R., Dmochowski, I. J., Winkler, J. R., and Gray, H. B. (2003) Nanosecond Photoreduction of Cytochrome P450cam by Channel-Specific Ru-Diimine Electron Tunneling Wires J. Am. Chem. Soc. 125, 12450– 12456 DOI: 10.1021/ja0294111
    Google Scholar
    43
    Nanosecond Photoreduction of Cytochrome P450cam by Channel-Specific Ru-diimine Electron Tunneling Wires
    Dunn, Alexander R.; Dmochowski, Ivan J.; Winkler, Jay R.; Gray, Harry B.
    Journal of the American Chemical Society (2003), 125 (41), 12450-12456CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
    We report the synthesis and characterization of Ru-diimine complexes designed to bind to cytochrome P450cam (CYP101). The sensitizer core has the structure [Ru(L2)L']2+, where L' is a perfluorinated biphenyl bridge (F8bp) connecting 4,4'-dimethylbipyridine to an enzyme substrate (adamantane, F8bp-Ad), a heme ligand (imidazole, F8bp-Im), or F (F9bp). The electron-transfer (ET) driving force (-ΔG°) is varied by replacing the ancillary 2,2'-bipyridine ligands with 4,4',5,5'-tetramethylbipyridine (tmRu). The four complexes all bind P450cam tightly: Ru-F8bp-Ad (1, Kd = 0.077 μM); Ru-F8bp-Im (2, Kd = 3.7 μM); tmRu-F9bp (3, Kd = 2.1 μM); and tmRu-F8bp-Im (4, Kd = 0.48 μM). Binding is predominantly driven by hydrophobic interactions between the Ru-diimine wires and the substrate access channel. With Ru-F8bp wires, redox reactions can be triggered on the nanosecond time scale. Ru-wire 2, which ligates the heme iron, shows a small amt. of transient heme photoredn. (∼30%), whereas the transient photoredn. yield for 4 is 76%. Forward ET with 4 occurs in roughly 40 ns (kf = 2.8×107 s-1), and back ET (FeII → RuIII, kb ≈ 1.7×108 s-1) is near the coupling-limited rate (kmax). Direct photoredn. was not obsd. for 1 or 3. The large variation in ET rates among the Ru-diimine:P 450 conjugates strongly supports a through-bond model of Ru-heme electronic coupling.
  44. 44
    Denisov, I. G., Makris, T. M., and Sugar, S. G. (2002) Cryoradiolysis for the Study of P450 Reaction Intermediates Methods Enzymol. 357, 103– 115 DOI: 10.1016/S0076-6879(02)57670-9
    Google Scholar
    There is no corresponding record for this reference.

Cited By

Click to copy section linkSection link copied!
Citation Statements
Explore this article's citation statements on scite.ai
powered by  Scite

This article is cited by 25 publications.

  1. Arnab Kakati, Tarak Karmakar, Aarat P. Kalra. Triplet Energy Migration in Cytoskeletal Polymers. The Journal of Physical Chemistry B 2025, 129 (1) , 128-138. https://doi.org/10.1021/acs.jpcb.4c06748
  2. Qiwen Zhu, Alexander V. Soudackov, Cecilia Tommos, Sharon Hammes-Schiffer. Proton-Coupled Electron Transfer upon Oxidation of Tyrosine in a De Novo Protein: Analysis of Proton Acceptor Candidates. Biochemistry 2024, 63 (15) , 1999-2008. https://doi.org/10.1021/acs.biochem.4c00211
  3. Gustavo J. Costa, Ruibin Liang. Understanding the Multifaceted Mechanism of Compound I Formation in Unspecific Peroxygenases through Multiscale Simulations. The Journal of Physical Chemistry B 2023, 127 (41) , 8809-8824. https://doi.org/10.1021/acs.jpcb.3c04589
  4. Brian Koronkiewicz, John Swierk, Kevin Regan, James M. Mayer. Shallow Distance Dependence for Proton-Coupled Tyrosine Oxidation in Oligoproline Peptides. Journal of the American Chemical Society 2020, 142 (28) , 12106-12118. https://doi.org/10.1021/jacs.0c01429
  5. Mette L. H. Sørensen, Brian C. Sanders, L. Perry Hicks, Maria H. Rasmussen, Andreas L. Vishart, Jacob Kongsted, Jay R. Winkler, Harry B. Gray, Thorsten Hansen. Hole Hopping through Cytochrome P450. The Journal of Physical Chemistry B 2020, 124 (15) , 3065-3073. https://doi.org/10.1021/acs.jpcb.9b09414
  6. Jessica H. van Wonderen, Christopher R. Hall, Xiuyun Jiang, Katrin Adamczyk, Antoine Carof, Ismael Heisler, Samuel E. H. Piper, Thomas A. Clarke, Nicholas J. Watmough, Igor V. Sazanovich, Michael Towrie, Stephen R. Meech, Jochen Blumberger, Julea N. Butt. Ultrafast Light-Driven Electron Transfer in a Ru(II)tris(bipyridine)-Labeled Multiheme Cytochrome. Journal of the American Chemical Society 2019, 141 (38) , 15190-15200. https://doi.org/10.1021/jacs.9b06858
  7. Laura Zanetti-Polzi, Isabella Daidone, Stefano Corni. Evidence of a Thermodynamic Ramp for Hole Hopping to Protect a Redox Enzyme from Oxidative Damage. The Journal of Physical Chemistry Letters 2019, 10 (7) , 1450-1456. https://doi.org/10.1021/acs.jpclett.9b00403
  8. Nicole L. Ing, Mohamed Y. El-Naggar, Allon I. Hochbaum. Going the Distance: Long-Range Conductivity in Protein and Peptide Bioelectronic Materials. The Journal of Physical Chemistry B 2018, 122 (46) , 10403-10423. https://doi.org/10.1021/acs.jpcb.8b07431
  9. Harry B. Gray, Jay R. Winkler. Living with Oxygen. Accounts of Chemical Research 2018, 51 (8) , 1850-1857. https://doi.org/10.1021/acs.accounts.8b00245
  10. Maxim V. Ivanov, Neil Reilly, Brandon Uhler, Damian Kokkin, Rajendra Rathore, and Scott A. Reid . Cofacially Arrayed Polyfluorenes: Spontaneous Formation of π-Stacked Assemblies in the Gas Phase. The Journal of Physical Chemistry Letters 2017, 8 (21) , 5272-5276. https://doi.org/10.1021/acs.jpclett.7b02627
  11. Jillian L. Dempsey and Matthew R. Hartings . Hop to It. Biochemistry 2017, 56 (42) , 5623-5624. https://doi.org/10.1021/acs.biochem.7b00950
  12. Peter Agbo. Rate-potential decoupling: a biophysical perspective of electrocatalysis. Journal of Physics D: Applied Physics 2024, 57 (46) , 462001. https://doi.org/10.1088/1361-6463/ad6008
  13. Xingzhu Huang, Shaofeng Zhou, Jianjun Li, Xiaojun Wang, Shaobin Huang, Guoping Sun, Shan Yang, Jia Xing, Meiying Xu. Complexing agents-free bioelectrochemical trickling systems for highly-efficient mesothermal NO removal: The role of extracellular polymer substances. Bioresource Technology 2023, 368 , 128286. https://doi.org/10.1016/j.biortech.2022.128286
  14. Shirsendu Ghosh, Koyel Banerjee-Ghosh, Dorit Levy, David Scheerer, Inbal Riven, Jieun Shin, Harry B. Gray, Ron Naaman, Gilad Haran. Control of protein activity by photoinduced spin polarized charge reorganization. Proceedings of the National Academy of Sciences 2022, 119 (35) https://doi.org/10.1073/pnas.2204735119
  15. Cecilia Tommos. Insights into the Thermodynamics and Kinetics of Amino-Acid Radicals in Proteins. Annual Review of Biophysics 2022, 51 (1) , 453-471. https://doi.org/10.1146/annurev-biophys-100521-103031
  16. Luiz Gonzaga de França Lopes, Florêncio S. Gouveia Júnior, Alda Karine Medeiros Holanda, Idalina Maria Moreira de Carvalho, Elisane Longhinotti, Tércio F. Paulo, Dieric S. Abreu, Paul V. Bernhardt, Marie-Alda Gilles-Gonzalez, Izaura Cirino Nogueira Diógenes, Eduardo Henrique Silva Sousa. Bioinorganic systems responsive to the diatomic gases O2, NO, and CO: From biological sensors to therapy. Coordination Chemistry Reviews 2021, 445 , 214096. https://doi.org/10.1016/j.ccr.2021.214096
  17. Anthony J. Pastore, Ruijie D. Teo, Alvaro Montoya, Matthew J. Burg, Umar T. Twahir, Steven D. Bruner, David N. Beratan, Alexander Angerhofer. Oxalate decarboxylase uses electron hole hopping for catalysis. Journal of Biological Chemistry 2021, 297 (1) , 100857. https://doi.org/10.1016/j.jbc.2021.100857
  18. Celine Eidenschenk, Lionel Cheruzel. Ru(II)-diimine complexes and cytochrome P450 working hand-in-hand. Journal of Inorganic Biochemistry 2020, 213 , 111254. https://doi.org/10.1016/j.jinorgbio.2020.111254
  19. Ruijie D. Teo, Ruobing Wang, Elizabeth R. Smithwick, Agostino Migliore, Michael J. Therien, David N. Beratan. Mapping hole hopping escape routes in proteins. Proceedings of the National Academy of Sciences 2019, 116 (32) , 15811-15816. https://doi.org/10.1073/pnas.1906394116
  20. Collin T. Zahler, Bryan F. Shaw. What Are We Missing by Not Measuring the Net Charge of Proteins?. Chemistry – A European Journal 2019, 25 (32) , 7581-7590. https://doi.org/10.1002/chem.201900178
  21. Ticyano P. de Souza, Dieric S. Abreu, Marta S. P. Carepo, Maria A. S. Silva, Dávila Zampieri, Marcos N. Eberlin, Tércio F. Paulo, Eduardo H. S. Sousa, Elisane Longhinotti, Izaura C. N. Diógenes. Effect of Crotalus basiliscus snake venom on the redox reaction of myoglobin. JBIC Journal of Biological Inorganic Chemistry 2019, 24 (2) , 171-178. https://doi.org/10.1007/s00775-019-01636-7
  22. Mihaela Puiu, Camelia Bala. Peptide-based electrochemical biosensors. 2019, 277-306. https://doi.org/10.1016/B978-0-12-816491-4.00010-3
  23. David B. Goodin, Shih-Wei Chuo, Shu-Hao Liou. Conformational Changes in Cytochrome P450cam and the Effector Role of Putidaredoxin. 2018, 292-310. https://doi.org/10.1039/9781788012911-00292
  24. Mihaela Puiu, Camelia Bala. Peptide-based biosensors: From self-assembled interfaces to molecular probes in electrochemical assays. Bioelectrochemistry 2018, 120 , 66-75. https://doi.org/10.1016/j.bioelechem.2017.11.009
  25. Yifeng Wei, Ee Lui Ang, Huimin Zhao. Recent developments in the application of P450 based biocatalysts. Current Opinion in Chemical Biology 2018, 43 , 1-7. https://doi.org/10.1016/j.cbpa.2017.08.006
Download PDF
Go to Biochemistry
Get e-Alerts
Get e-Alerts

Biochemistry

Cite this: Biochemistry 2017, 56, 28, 3531–3538
Click to copy citationCitation copied!
https://doi.org/10.1021/acs.biochem.7b00432
Published July 9, 2017

Copyright © 2017 American Chemical Society. This publication is licensed under these Terms of Use.

Request reuse permissions

Article Views

4005

Altmetric

-

Citations

25
Learn about these metrics

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

  • Abstract

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 1

    Figure 1. Overlay of the heme environments of CYP102A1 (gray carbon atoms) and CYP119 (green carbon atoms) illustrating the relative positions of W96 in CYP102A1 and H76 in CYP119. Atomic coordinates were taken from PDB IDs 2IJ2 (CYP102A1) (34) and 1IO7 (CYP119). (35)

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 2

    Figure 2. Transient absorption kinetics following 480 nm laser excitation of [Ru(bpy)2(Aphen)]2+ in the presence of [Ru(NH3)6]3+ (17 mM). The purple curve is a luminescence decay trace.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 3

    Figure 3. Transient kinetics following oxidative quenching ([Ru(NH3)6]3+, 17 mM) in four Ru–P450 conjugates: λex = 480 nm; λobsd = 420 nm (green), 440 nm (red). Signals normalized to the magnitude of the 440 nm prompt bleach.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 4

    Figure 4. Transient kinetics following reductive quenching (pMeODMA, 10 mM) of four Ru–P450 conjugates: λex = 480 nm; λobsd = 420 nm (green), 440 nm (red). Signals normalized to the magnitude of the 440 nm prompt bleach.

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 5

    Figure 5. Structural model of RuC97–CYP102A1 (PDB ID 3NPL) highlighting the electron-transfer distances from RuC97 to the porphryin (20.76 Å), RuC97 to W96 (11.88 Å), and W96 to the porphyrin (7.15 Å).

    High Resolution Image
    Download MS PowerPoint Slide

    Figure 6

    Figure 6. Photochemical ET reaction scheme in RuC97(CYP102A1) and RuC77(CYP119). Blue arrows indicate excitation processes, solid green arrows indicate bimolecular quenching reactions, dashed green arrows indicate bimolecular charge-recombination processes with quencher redox products, and red arrows indicate intraprotein ET reactions. With an intervening W residue (a, CYP102A, W96; CYP119 H76W), oxidative quenching of *Ru2+ by QO (left path) leads to heme oxidation via an intermediate Trp radical; reductive quenching by QR (right path) leads to heme reduction in a single-step tunneling reaction. With an intervening H residue (b, CYP102A, W96H; CYP119 H76), oxidative quenching of *Ru2+ by QO produces Ru3+ but not heme oxidation, whereas reductive quenching again leads to single-step electron transfer from Ru+ to the heme.

    High Resolution Image
    Download MS PowerPoint Slide

  • References

    This article references 44 other publications.

    1. 1
      Heinze, J. (2016) Aliphatic and Aromatic Hydrocarbons - Reduction, in Organic Electrochemistry (Hammerich, O. and Speiser, B., Eds.), pp 861– 890, Taylor and Francis Group, Boca Raton, FL.
      There is no corresponding record for this reference.
    2. 2
      Holton, D. M., Edwards, P. P., and Salmon, G. A. (1984) Electrons, alkali metal-electron species and radical anions in substituted organic amides J. Phys. Chem. 88, 3855– 3859 DOI: 10.1021/j150661a034
      There is no corresponding record for this reference.
    3. 3
      Knecht, L. A. and Kolthoff, I. M. (1962) N-Methylacetamide as a Polarographic Solvent Inorg. Chem. 1, 195– 203 DOI: 10.1021/ic50002a002
      There is no corresponding record for this reference.
    4. 4
      Harriman, A. (1987) Further Comments on the Redox Potentials of Tryptophan and Tyrosine J. Phys. Chem. 91, 6102– 6104 DOI: 10.1021/j100308a011
      4
      Further comments on the redox potentials of tryptophan and tyrosine
      Harriman, Anthony
      Journal of Physical Chemistry (1987), 91 (24), 6102-4CODEN: JPCHAX; ISSN:0022-3654.
      The redox potentials for 1-electron oxidn. of tryptophan and tyrosine, as well as for few simple indoles and phenols, were detd. by cyclic voltammetry. Mostly, the values obsd. are in reasonable agreement with those detd. earlier by pulsed radiolysis but the value obsd. for tryptophan (E° = 1.015 V vs. a normal H electrode at pH 7) is much higher than that derived from pulsed radiolysis. The neg. magnitude of the redox potentials for tryptophan and tyrosine shows a marked pH dependence.
    5. 5
      Fourré, I., Bergès, J., and Houée-Levin, C. (2010) Structural and Topological Studies of Methionine Radical Cations in Dipeptides: Electron Sharing in Two-Center Three-Electron Bonds J. Phys. Chem. A 114, 7359– 7368 DOI: 10.1021/jp911983a
      5
      Structural and Topological Studies of Methionine Radical Cations in Dipeptides: Electron Sharing in Two-Center Three-Electron Bonds
      Fourre, Isabelle; Berges, Jacqueline; Houee-Levin, Chantal
      Journal of Physical Chemistry A (2010), 114 (27), 7359-7368CODEN: JPCAFH; ISSN:1089-5639. (American Chemical Society)
      One electron oxidn. of methionine in peptides is highly dependent on the local structure. The sulfur-centered radical cation can complex with oxygen, nitrogen, or other sulfur atoms from a neighboring residue or from the peptidic bond, forming an intramol. S X two-center three-electron bond (X = S, N, O). This stabilization was investigated computationnally in the radical cations of three peptides, methionine glycine (Met Gly) and its reverse sequence Gly Met, and Met Met. Geometry optimizations were done at the BH&HLYP/6-31G(d) level of theory and the effect of solvation was taken into account using a continuum model (CPCM). Up to seven stable conformations were considered for each peptide, with formation of 5-10 member cycles involving nitrogen from the peptidic bond or from the amine, oxygen from the peptidic bond or from the carboxylate group, or sulfur from the other residue for Met Met. The absorption wavelengths corresponding to the σ → σ* transition calcd. for each complex at the TD-BH&HLYP/6-311+G(d,p)//BH&HLYP/6-31G(d) level of theory vary from the near-UV for the S O bonds to the green visible for the S S bonds. For X = N, they increase with the SN distance as expected for a 2c-3e bond, whereas for X = O they slightly decrease. Characterization of these 2c-3e bonds as a function of the sequence, using the ELF and the AIM topol. analyses, shows the different natures of the S X bonds, which is purely 2c-3e for X = S, mainly 2c-3e with a part of electrostatic interaction for X = N and mainly electrostatic for X = O.
    6. 6
      Glass, R. S., Hug, G. L., Schoneich, C., Wilson, G. S., Kuznetsova, L., Lee, T. M., Ammam, M., Lorance, E., Nauser, T., Nichol, G. S., and Yamamoto, T. (2009) Neighboring Amide Participation in Thioether Oxidation: Relevance to Biological Oxidation J. Am. Chem. Soc. 131, 13791– 13805 DOI: 10.1021/ja904895u
      There is no corresponding record for this reference.
    7. 7
      Glass, R. S., Petsom, A., Hojjatie, M., Coleman, B. R., Duchek, J. R., Klug, J., and Wilson, G. S. (1988) Facilitation of Electrochemical Oxidation of Dialkyl Sulfides Appended with Neighboring Carboxylate and Alcohol Groups J. Am. Chem. Soc. 110, 4772– 4778 DOI: 10.1021/ja00222a040
      There is no corresponding record for this reference.
    8. 8
      Jovanovic, S. V., Harriman, A., and Simic, M. G. (1986) Electron-Transfer Reactions of Tryptophan and Tyrosine Derivatives J. Phys. Chem. 90, 1935– 1939 DOI: 10.1021/j100400a039
      8
      Electron-transfer reactions of tryptophan and tyrosine derivatives
      Jovanovic, Slobodan V.; Harriman, Anthony; Simic, Michael G.
      Journal of Physical Chemistry (1986), 90 (9), 1935-9CODEN: JPCHAX; ISSN:0022-3654.
      Oxidn. of tryptophan, tyrosine, and their derivs. by oxidizing radicals was studied by pulse radiolysis in aq. solns. at 20°. Rate consts. for the oxidn. of tryptophan derivs. with •N3 and Br2-• radicals vary from 8 × 108 to 4.8 × 109 M-1 s-1 and oxidn. goes to completion; no pH dependence was obsd. Oxidn. rate consts. for tyrosine derivs. increase upon deprotonation of the phenolic residue at higher pH. Redox potentials for the indolyl and phenoxyl radicals were derived from the measured equil. consts. by using p-methoxyphenol (E7.5 = 0.6 and E13 = 0.4 V), bisulfite (E3 = 0.84 V), and guanosine (E = 0.91 V) redox couples as ref. systems. The redox potential of the tryptophyl radical was measured by pulse radiolysis and laser photolysis and found, by both techniques, to be E = 0.64 V at pH 7. Redox potentials of tryptophan derivs. were dependent on the nature of the side chain possibly due to interaction of the side chain with the nitrogen atom in the pyrrole ring. Redox potentials of tyrosine derivs. were independent of the nature of the side chain and higher than the redox potentials of tryptophan derivs. The values E7 = 0.85 V and E13 = 0.65 V were measured for the tyrosine/phenoxyl radical redox couple at pH 7 and 13, resp. Electron transfer from tyrosine to tryptophyl radicals was slow in neutral media, k = 5 × 105-1.3 × 106 M-1 s-1, and proceeded via multiple steps, one of which is proton transfer from tyrosine to tryptophyl radicals followed by electron transfer.
    9. 9
      Surdhar, P. S. and Armstrong, D. A. (1987) Reduction potentials and exchange reactions of thiyl radicals and disulfide anion radicals J. Phys. Chem. 91, 6532– 6537 DOI: 10.1021/j100310a022
      9
      Reduction potentials and exchange reactions of thiyl radicals and disulfide anion radicals
      Surdhar, Parminder S.; Armstrong, David A.
      Journal of Physical Chemistry (1987), 91 (26), 6532-7CODEN: JPCHAX; ISSN:0022-3654.
      Redox equil. between RS• and -s•-S= radicals, and between these types of radical and phenoxyl and chlorpromazine radicals were investigated in aq. solns. at pHs over the range 6-10 to obtain a self-consistent set of redox potentials for the reaction: PhO• + H+ + e- = PhOH; RṠSR- + 2H+ + e- = 2RSH; and RS• + H+ + e- = RSH (18), in S systems with alkyl R groups. Abs. std. potentials were calcd. on the basis of E0 = 0.83 V for the chlorpromazine couple. The results for E04 (-1.35 ± 0.02 V) and E018 (=1.33 ± 0.02 V) were in agreement with values calcd. from thermodn. data within the known uncertainties. E018 Was found to exhibit a falloff when electron-rich groups, such as the 2 methyls of penicillamine or the CO2- of β-mercaptoacetic acid, were present on the C adjacent to the S atom. However, the effect was relatively small (∼10-14 mV). The E011 was 1.72 ± 0.02 V for β-mercaptoethanol. The corresponding potentials for the cyclic anions of dithiothreitol, dithioerythreitol, and lipoamide were the same within exptl. error, but the uncertainties were larger (±0.4 V). (e- + -S-S- = -Ṡ-S= of E022 was calcd. to be -1.60 V, showing that only strongly reducing species could donate electrons to disulfide. Rate consts. for several of the forward and backward reactions in the equil. were also detd.
    10. 10
      Yashiro, H., White, R. C., Yurkovskaya, A. V., and Forbes, M. D. E. (2005) Methionine radical cation: Structural studies as a function of pH using X- and Q-band time-resolved electron paramagnetic resonance spectroscopy J. Phys. Chem. A 109, 5855– 5864 DOI: 10.1021/jp051551k
      10
      Methionine Radical Cation: Structural Studies as a Function of pH Using X- and Q-Band Time-Resolved Electron Paramagnetic Resonance Spectroscopy
      Yashiro, Haruhiko; White, Ryan C.; Yurkovskaya, Alexandra V.; Forbes, Malcolm D. E.
      Journal of Physical Chemistry A (2005), 109 (26), 5855-5864CODEN: JPCAFH; ISSN:1089-5639. (American Chemical Society)
      A comprehensive high resoln. ESR (EPR) characterization of the L-methionine radical cation and its N-acetyl deriv. in liq. soln. at room temp. is presented. The cations were generated photochem. in high yield by excimer laser excitation of a water sol. dye, anthraquinone sulfonate sodium salt, the excited triplet state of which is quenched by electron transfer from the side chain sulfur atom of methionine or N-acetylmethionine. The radicals were detected by continuous wave (CW) time-resolved ESR (TREPR) spectroscopy at X-band (9.5 GHz) and Q-band (35 GHz) microwave frequencies. At pH values well below the pKa of the protonated amine nitrogen, the cation forms a dimer with another ground-state methionine mol. through a S-S three-electron bond. In basic soln., the lone pair on the nitrogen of the amino acid is available to make an intramol. S-N three-electron bond with the side chain sulfur atom, leading to a five-membered ring structure for the cation. When the amino acid nitrogen is unsubstituted (methionine itself), rapid deprotonation to an aminyl radical takes place at high pH values. If the nitrogen is substituted (N-acetylmethionine), the cyclic structure is obsd. within its electron spin relaxation time at about 1 μs. Spectral simulation provides chem. shifts (g-factors) and hyperfine coupling consts. for all structures, and isotopic labeling expts. strongly support the assignments.
    11. 11
      Navaratnam, S. and Parsons, B. J. (1998) Reduction Potential of Histidine Free Radicals: a Pulse Radiolysis Study J. Chem. Soc., Faraday Trans. 94, 2577– 2581 DOI: 10.1039/a803477j
      11
      Reduction potential of histidine free radicals: a pulse radiolysis study
      Navaratnam, S.; Parsons, B. J.
      Journal of the Chemical Society, Faraday Transactions (1998), 94 (17), 2577-2581CODEN: JCFTEV; ISSN:0956-5000. (Royal Society of Chemistry)
      The technique of pulse radiolysis has been used to demonstrate that all histidine free radicals (designated HisNsbd+) produced by oxidn. of histidine by Br2- radical anions can oxidize the water sol. vitamin E analog, Trolox C (k = 1.0±0.2 × 109 d mol-1 s-1 at pH 6.95). It has also been shown that HisNsbd+ radicals can react with tryptophan in electron transfer equil. involving both HisNsbd+ and TrpNsbd+ species over the pH range 6.4-9.0. The ΔE values [E(TrpNsbd+/Trp)-E(HisNsbd+/His)] range from -140 to -161 mV and indicate an E7(HisNsbd+/His) value of 1170 mV [based on E7(TrpNsbd+/Trp) = 1015 mV at pH 7]. The effect of pH on E(HisNsbd+/His) was accounted for by assuming that HisNsbd+ can deprotonate to yield a bi-allylic free radical, designated His (-H+). The pKa for this dissocn. was estd. to be in the range 5-7. The implications of the relatively high redn. potential for HisNsbd+ in its possible participation in the mechanism of action of non-heme metalloenzymes is discussed.
    12. 12
      Stubbe, J. and van der Donk, W. A. (1998) Protein Radicals in Enzyme Catalysis Chem. Rev. 98, 705– 762 DOI: 10.1021/cr9400875
      12
      Protein Radicals in Enzyme Catalysis
      Stubbe, JoAnne; van der Donk, Wilfred A.
      Chemical Reviews (Washington, D. C.) (1998), 98 (2), 705-762CODEN: CHREAY; ISSN:0009-2665. (American Chemical Society)
      A review with 559 refs. with emphasis on the general principles that have evolved governing the formation of protein radicals and their roles in catalysis. New exptl. information that has emerged since 1988 is summarized for each system that has been thus far characterized. The scope of this review is limited to enzymic systems that utilize amino acid or modified amino acid based radicals that are covalently linked to the protein. The discussion covers one electron oxidized amino acids identified in proteins, biosynthesis of (modified) amino acid radicals, methods to examine radical dependent reactions, and ribonucleotide reductases, cytochrome c peroxidase, prostaglandin H synthase, pyruvate formate lyase, galactose oxidase, photosynthetic oxygen evolution, quinoproteins, and other systems in which protein-based radicals have been proposed or detected.
    13. 13
      Aubert, C., Mathis, P., Eker, A. P. M., and Brettel, K. (1999) Intraprotein Electron Transfer between Tyrosine and Tryptophan in DNA photolysase from Anacystis nidulans Proc. Natl. Acad. Sci. U. S. A. 96, 5423– 5427 DOI: 10.1073/pnas.96.10.5423
      There is no corresponding record for this reference.
    14. 14
      Aubert, C., Vos, M. H., Mathis, P., Eker, A. P. M., and Brettel, K. (2000) Intraprotein Radical Transfer during Photoactivation of DNA Photolyase Nature 405, 586– 590 DOI: 10.1038/35014644
      14
      Intraprotein radical transfer during photoactivation of DNA photolyase
      Aubert, Corinne; Vos, Marten H.; Mathis, Paul; Eker, Andre P. M.; Brettel, Kiaus
      Nature (London) (2000), 405 (6786), 586-590CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)
      Amino-acid radicals play key roles in many enzymic reactions. Catalysis often involves transfer of a radical character within the protein, as in class I ribonucleotide reductase where radical transfer occurs over 35 Å, from a tyrosyl radical to a cysteine. It is currently debated whether this kind of long-range transfer occurs by electron transfer, followed by proton release to create a neutral radical, or by H-atom transfer, i.e., simultaneous transfer of electrons and protons. The latter mechanism avoids the energetic cost of charge formation in the low dielec. protein, but it is less robust to structural changes than is electron transfer. Available exptl. data do not clearly discriminate between these proposals. We have studied the mechanism of photoactivation (light-induced redn. of the FAD cofactor) of Escherichia coli DNA photolyase using time-resolved absorption spectroscopy. Here we show that the excited FAD radical abstrs. an electron from a nearby tryptophan in 30 ps. After subsequent electron transfer along a chain of three tryptophans, the most remote tryptophan (as a cation radical) releases a proton to the solvent in about 300 ns, showing that electron transfer occurs before proton dissocn. A similar process may take place in photolyase-like blue-light receptors.
    15. 15
      DeGray, J. A., Lassmann, G., Curtis, J. F., Kennedy, T. A., Marnett, L. J., Eling, T. E., and Mason, R. P. (1992) Spectral-Analysis of the Protein-Derived Tyrosyl Radicals from Prostaglandin-H Synthase J. Biol. Chem. 267, 23583– 23588
      There is no corresponding record for this reference.
    16. 16
      Eklund, H., Eriksson, M., Uhlin, U., Nordlund, P., and Logan, D. (1997) Ribonucleotide Reductase - Structural Studies of a Radical Enzyme Biol. Chem. 378, 821– 825
      There is no corresponding record for this reference.
    17. 17
      Goodin, D. B., Mauk, A. G., and Smith, M. (1986) Studies of the Radical Species in Compound ES of Cytochrome c Peroxidase Altered by Site-Directed Mutagenesis Proc. Natl. Acad. Sci. U. S. A. 83, 1295– 1299 DOI: 10.1073/pnas.83.5.1295
      There is no corresponding record for this reference.
    18. 18
      Green, M. T. (1999) Evidence for Sulfur-Based Radicals in Thiolate Compound I Intermediates J. Am. Chem. Soc. 121, 7939– 7940 DOI: 10.1021/ja991541v
      18
      Evidence for Sulfur-Based Radicals in Thiolate Compound I Intermediates
      Green, Michael T.
      Journal of the American Chemical Society (1999), 121 (34), 7939-7940CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
      Compd. I species are believed to be the active intermediates in the catalytic cycles of a no. of oxidative heme enzymes. With one exception, these reactive complexes are thought to be best formulated as ferryl porphyrin radical cations. Recent findings, however, indicate that the electronic structure of compd. I may depend dramatically upon the nature of the axial ligand and suggest that in some cases (thiolate-ligated heme proteins in particular) an alternative formulation of the compd. I species may be more appropriate. A few researchers have suggested that, in thiolate-heme proteins, the thiolate ligand (rather than the porphyrin) may give up an electron to stabilize the Fe(IV)-oxo species, thereby generating a sulfur radical. In support of this hypothesis, Xα calcns. on a thiolate compd. I complex do show significant spin d. on sulfur. However, these Xα calcns. yield a quartet ground state, while compd. I is known to be a doublet. To investigate the possibility that thiolate compd. I species possess sulfur-based radicals, calcns. have been performed using th B3LYP functional. Using GAUSSIAN94, unrestricted calcns. were performed on a 43 atom active site model of a thiolate compd. I intermediate. The cysteinate axial ligand was replaced with a Me mercaptide unit and hydrogen atoms were substituted for the eight carbons directly attached to the porphyrin ring, yielding the Fe(N4C20H12)(SCH3)O 43 atom species. Our calcns. predict a doublet ground state, in agreement with EPR expts. that show chloroperoxidase compd. I to display strong antiferromagnetic coupling (J = -35 cm-1). Since chloroperoxidase compd. I is the only known compd. I system to show this sort of coupling, our calcd. value of J = -77 cm-1 is an important indicator of the quality of our calcns.
    19. 19
      Licht, S., Gerfen, G. J., and Stubbe, J. A. (1996) Thiyl radicals in ribonucleotide reductases Science 271, 477– 481 DOI: 10.1126/science.271.5248.477
      19
      Thiyl radicals in ribonucleotide reductases
      Licht, Stuart; Gerfen, Gary J.; Stubbe, JoAnne
      Science (Washington, D. C.) (1996), 271 (5248), 477-81CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
      The ribonucleoside triphosphate reductase (RTPR) from Lactobacillus leichmannii catalyzes adenosylcobalamin (AdoCbl)-dependent nucleotide redn., as well as exchange of the 5' hydrogens of AdoCbl with solvent. A protein-based thiyl radical is proposed as an intermediate in both of these processes. In the presence of RTPR contg. specifically deuterated cysteine residues, the ESR spectrum of an intermediate in the exchange reaction and the redn. reaction, trapped by rapid freeze quench techniques, exhibits narrowed hyperfine features relative to the corresponding unlabeled RTPR. The spectrum was interpreted to represent a thiyl radical coupled to cob(II)alamin. Another proposed intermediate, 5'-deoxyadenosine, was detected by rapid acid quench techniques. Similarities in mechanism between RTPR and the Escherichia coli ribonucleotide reductase suggest that both enzymes require a thiyl radical for catalysis.
    20. 20
      Pogni, R., Baratto, M. C., Teutloff, C., Giansanti, S., Ruiz-Dueñas, F. J., Choinowski, T., Piontek, K., Martínez, A. T., Lendzian, F., and Basosi, R. (2006) A Tryptophan Neutral Radical in the Oxidized State of Versatile Peroxidase from Pleurotus eryngii: a Combined Multifrequency EPR and Density Functional Theory Study J. Biol. Chem. 281, 9517– 9526 DOI: 10.1074/jbc.M510424200
      20
      A Tryptophan Neutral Radical in the Oxidized State of Versatile Peroxidase from Pleurotus eryngii: A combined multifrequency EPR and density functional theory study
      Pogni, Rebecca; Baratto, M. Camilla; Teutloff, Christian; Giansanti, Stefania; Ruiz-Duenas, Francisco J.; Choinowski, Thomas; Piontek, Klaus; Martinez, Angel T.; Lendzian, Friedhelm; Basosi, Riccardo
      Journal of Biological Chemistry (2006), 281 (14), 9517-9526CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)
      Versatile peroxidases are heme enzymes that combine catalytic properties of lignin peroxidases and manganese peroxidases, being able to oxidize Mn2+ as well as phenolic and non-phenolic arom. compds. in the absence of mediators. The catalytic process (initiated by hydrogen peroxide) is the same as in classical peroxidases, with the involvement of 2 oxidizing equiv. and the formation of the so-called Compd. I. This latter state contains an oxoferryl center and an org. cation radical that can be located on either the porphyrin ring or a protein residue. In this study, a radical intermediate in the reaction of versatile peroxidase from the ligninolytic fungus Pleurotus eryngii with H2O2 has been characterized by multifrequency (9.4 and 94 GHz) EPR and assigned to a tryptophan residue. Comparison of exptl. data and d. functional theory theor. results strongly suggests the assignment to a tryptophan neutral radical, excluding the assignment to a tryptophan cation radical or a histidine radical. Based on the exptl. detd. side chain orientation and comparison with a high resoln. crystal structure, the tryptophan neutral radical can be assigned to Trp164 as the site involved in long-range electron transfer for arom. substrate oxidn.
    21. 21
      Bernini, C., Pogni, R., Basosi, R., and Sinicropi, A. (2012) The nature of tryptophan radicals involved in the long-range electron transfer of lignin peroxidase and lignin peroxidase-like systems: Insights from quantum mechanical/molecular mechanics simulations Proteins: Struct., Funct., Genet. 80, 1476– 1483 DOI: 10.1002/prot.24046
      There is no corresponding record for this reference.
    22. 22
      Gray, H. B. and Winkler, J. R. (2015) Hole hopping through tyrosine/tryptophan chains protects proteins from oxidative damage Proc. Natl. Acad. Sci. U. S. A. 112, 10920– 10925 DOI: 10.1073/pnas.1512704112
      22
      Hole hopping through tyrosine/tryptophan chains protects proteins from oxidative damage
      Gray, Harry B.; Winkler, Jay R.
      Proceedings of the National Academy of Sciences of the United States of America (2015), 112 (35), 10920-10925CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
      Living organisms have adapted to atm. dioxygen by exploiting its oxidizing power while protecting themselves against toxic side effects. Reactive oxygen and nitrogen species formed during oxidative stress, as well as high-potential reactive intermediates formed during enzymic catalysis, could rapidly and irreversibly damage polypeptides were protective mechanisms not available. Chains of redox-active tyrosine and tryptophan residues can transport potentially damaging oxidizing equiv. (holes) away from fragile active sites and toward protein surfaces where they can be scavenged by cellular reductants. Precise positioning of these chains is required to provide effective protection without inhibiting normal function. A search of the structural database reveals that about one third of all proteins contain Tyr/Trp chains composed of three or more residues. Although these chains are distributed among all enzyme classes, they appear with greatest frequency in the oxidoreductases and hydrolases. Consistent with a redox-protective role, approx. half of the dioxygen-using oxidoreductases have Tyr/Trp chain lengths ≥3 residues. Among the hydrolases, long Tyr/Trp chains appear almost exclusively in the glycoside hydrolases. These chains likely are important for substrate binding and positioning, but a secondary redox role also is a possibility.
    23. 23
      Muller, P., Yamamoto, J., Martin, R., Iwai, S., and Brettel, K. (2015) Discovery and functional analysis of a 4th electron-transferring tryptophan conserved exclusively in animal cryptochromes and (6–4) photolyases Chem. Commun. 51, 15502– 15505 DOI: 10.1039/C5CC06276D
      There is no corresponding record for this reference.
    24. 24
      Winkler, J. R. and Gray, H. B. (2015) Electron flow through biological molecules: does hole hopping protect proteins from oxidative damage? Q. Rev. Biophys. 48, 411– 420 DOI: 10.1017/S0033583515000062
      24
      Electron flow through biological molecules: does hole hopping protect proteins from oxidative damage?
      Winkler, Jay R.; Gray, Harry B.
      Quarterly Reviews of Biophysics (2015), 48 (4), 411-420CODEN: QURBAW; ISSN:0033-5835. (Cambridge University Press)
      Biol. electron transfers often occur between metal-contg. cofactors that are sepd. by very large mol. distances. Employing photosensitizer-modified iron and copper proteins, we have shown that single-step electron tunneling can occur on nanosecond to microsecond timescales at distances between 15 and 20 Å. We also have shown that charge transport can occur over even longer distances by hole hopping (multistep tunneling) through intervening tyrosines and tryptophans. In this perspective, we advance the hypothesis that such hole hopping through Tyr/Trp chains could protect oxygenase, dioxygenase, and peroxidase enzymes from oxidative damage. In support of this view, by examg. the structures of P 450 (CYP102A) and 2OG-Fe (TauD) enzymes, we have identified candidate Tyr/Trp chains that could transfer holes from uncoupled high-potential intermediates to reductants in contact with protein surface sites.
    25. 25
      Kathiresan, M. and English, A. M. (2017) LC-MS/MS suggests that hole hopping in cytochrome c peroxidase protects its heme from oxidative modification by excess H2O2 Chem. Sci. 8, 1152– 1162 DOI: 10.1039/C6SC03125K
      25
      LC-MS/MS suggests that hole hopping in cytochrome c peroxidase protects its heme from oxidative modification by excess H2O2
      Kathiresan, Meena; English, Ann M.
      Chemical Science (2017), 8 (2), 1152-1162CODEN: CSHCCN; ISSN:2041-6520. (Royal Society of Chemistry)
      We recently reported that cytochrome c peroxidase (Ccp1) functions as a H2O2 sensor protein when H2O2 levels rise in respiring yeast. The availability of its reducing substrate, ferrocytochrome c (CycII), dets. whether Ccp1 acts as a H2O2 sensor or peroxidase. For H2O2 to serve as a signal it must modify its receptor so we employed high-performance LC-MS/MS to investigate in detail the oxidn. of Ccp1 by 1, 5 and 10 M eq. of H2O2 in the absence of CycII to prevent peroxidase activity. We observe strictly heme-mediated oxidn., implicating sequential cycles of binding and redn. of H2O2 at Ccp1's heme. This results in the incorporation of ∼20 oxygen atoms predominantly at methionine and tryptophan residues. Extensive intramol. dityrosine crosslinking involving neighboring residues was uncovered by LC-MS/MS sequencing of the crosslinked peptides. The proximal heme ligand, H175, is converted to oxo-histidine, which labilizes the heme but irreversible heme oxidn. is avoided by hole hopping to the polypeptide until oxidn. of the catalytic distal H52 in Ccp1 treated with 10 M eq. of H2O2 shuts down heterolytic cleavage of H2O2 at the heme. Mapping of the 24 oxidized residues in Ccp1 reveals that hole hopping from the heme is directed to three polypeptide zones rich in redox-active residues. This unprecedented anal. unveils the remarkable capacity of a polypeptide to direct hole hopping away from its active site, consistent with heme labilization being a key outcome of Ccp1-mediated H2O2 signaling. LC-MS/MS identification of the oxidized residues also exposes the bias of ESR (EPR) detection toward transient radicals with low O2 reactivity.
    26. 26
      Ortiz de Montellano, P. R., Ed. (2015) Cytochrome P450 - Structure, Mechanism, and Biochemistry, Springer, Switzerland.
      There is no corresponding record for this reference.
    27. 27
      Green, M. T., Dawson, J. H., and Gray, H. B. (2004) Oxoiron(IV) in Chloroperoxidase Compound II is Basic: Implications for P450 Chemistry Science 304, 1653– 1656 DOI: 10.1126/science.1096897
      27
      Oxoiron(IV) in Chloroperoxidase Compound II Is Basic: Implications for P450 Chemistry
      Green, Michael T.; Dawson, John H.; Gray, Harry B.
      Science (Washington, DC, United States) (2004), 304 (5677), 1653-1656CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
      With the use of x-ray absorption spectroscopy, we have found that the Fe-O bond in chloroperoxidase compd. II (CPO-II) is much longer than expected for an oxoiron(IV) (ferryl) unit; notably, the exptl. detd. bond length of 1.82(1) Å accords closely with d. functional calcns. on a protonated ferryl (FeIV-OH, 1.81 Å). The basicity of the CPO-II ferryl [pKa > 8.2 (where Ka is the acid dissocn. const.)] is attributable to strong electron donation by the axial thiolate. We suggest that the CPO-II protonated ferryl is a good model for the rebound intermediate in the P 450 oxygenation cycle; with elevated pKa values after one-electron redn., thiolate-ligated ferryl radicals are competent to oxygenate satd. hydrocarbons at potentials that can be tolerated by folded polypeptide hosts.
    28. 28
      Behan, R. K., Hoffart, L. M., Stone, K. L., Krebs, C., and Green, M. T. (2006) Evidence for basic ferryls in cytochromes P450 J. Am. Chem. Soc. 128, 11471– 11474 DOI: 10.1021/ja062428p
      28
      Evidence for Basic Ferryls in Cytochromes P450
      Behan, Rachel K.; Hoffart, Lee M.; Stone, Kari L.; Krebs, Carsten; Green, Michael T.
      Journal of the American Chemical Society (2006), 128 (35), 11471-11474CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
      Using a combination of Mossbauer spectroscopy and d. functional calcns., we have detd. that the ferryl forms of P 450BM3 and P450cam are protonated at physiol. pH. D. functional calcns. were performed on large active-site models of these enzymes to det. the theor. Mossbauer parameters for the ferryl and protonated ferryl (FeIVOH) species. These calcns. revealed a significant enlargement of the quadrupole splitting parameter upon protonation of the ferryl unit. The calcd. quadrupole splittings for the protonated and unprotonated ferryl forms of P 450BM3 are ΔEq = 2.17 mm/s and ΔEq = 1.05 mm/s, resp. For P450cam, they are ΔEq = 1.84 mm/s and ΔEq = 0.66 mm/s, resp. The exptl. detd. quadrupole splittings (P 450BM3, ΔEq = 2.16 mm/s; P450cam, ΔEq = 2.06 mm/s) are in good agreement with the values calcd. for the protonated forms of the enzymes. Our results suggest that basic ferryls are a natural consequence of thiolate-ligated hemes.
    29. 29
      Krest, C. M., Onderko, E. L., Yosca, T. H., Calixto, J. C., Karp, R. F., Livada, J., Rittle, J., and Green, M. T. (2013) Reactive Intermediates in Cytochrome P450 Catalysis J. Biol. Chem. 288, 17074– 17081 DOI: 10.1074/jbc.R113.473108
      29
      Reactive Intermediates in Cytochrome P450 Catalysis
      Krest, Courtney M.; Onderko, Elizabeth L.; Yosca, Timothy H.; Calixto, Julio C.; Karp, Richard F.; Livada, Jovan; Rittle, Jonathan; Green, Michael T.
      Journal of Biological Chemistry (2013), 288 (24), 17074-17081CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)
      A review. Recently, we reported the spectroscopic and kinetic characterizations of cytochrome P 450 compd. I in CYP119A1, effectively closing the catalytic cycle of cytochrome P 450-mediated hydroxylations. In this minireview, we focus on the developments that made this breakthrough possible. We examine the importance of enzyme purifn. in the quest for reactive intermediates and report the prepn. of compd. I in a second P 450 (P450ST). In an effort to bring clarity to the field, we also examine the validity of controversial reports claiming the prodn. of P 450 compd. I through the use of peroxynitrite and laser flash photolysis.
    30. 30
      Rittle, J. and Green, M. T. (2010) Cytochrome P450 Compound I: Capture, Characterization, and C-H Bond Activation Kinetics Science 330, 933– 937 DOI: 10.1126/science.1193478
      30
      Cytochrome P450 Compound I: Capture, Characterization, and C-H Bond Activation Kinetics
      Rittle, Jonathan; Green, Michael T.
      Science (Washington, DC, United States) (2010), 330 (6006), 933-937CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
      Cytochrome P 450 enzymes are responsible for the phase I metab. of approx. 75% of known pharmaceuticals. P 450s perform this and other important biol. functions through the controlled activation of C-H bonds. Here, we report the spectroscopic and kinetic characterization of the long-sought principal intermediate involved in this process, P 450 compd. I (P 450-I), which we prepd. in approx. 75% yield by reacting ferric CYP119 with m-chloroperbenzoic acid. The Mossbauer spectrum of CYP119-I is similar to that of chloroperoxidase compd. I, although its ESR spectrum reflects an increase in |J|/D, the ratio of the exchange coupling to the zero-field splitting. CYP119-I hydroxylates the unactivated C-H bonds of lauric acid [D(C-H) ~ 100 kcal per mol], with an apparent second-order rate const. of kapp = 1.1 × 107 per M per s at 4°. Direct measurements put a lower limit of k ≥ 210 per s on the rate const. for bound substrate oxidn., whereas analyses involving kinetic isotope effects predict a value in excess of 1400 per s.
    31. 31
      Yosca, T. H., Rittle, J., Krest, C. M., Onderko, E. L., Silakov, A., Calixto, J. C., Behan, R. K., and Green, M. T. (2013) Iron(IV)hydroxide pK(a) and the Role of Thiolate Ligation in C-H Bond Activation by Cytochrome P450 Science 342, 825– 829 DOI: 10.1126/science.1244373
      31
      Iron(IV)hydroxide pKa and the Role of Thiolate Ligation in C-H Bond Activation by Cytochrome P450
      Yosca, Timothy H.; Rittle, Jonathan; Krest, Courtney M.; Onderko, Elizabeth L.; Silakov, Alexey; Calixto, Julio C.; Behan, Rachel K.; Green, Michael T.
      Science (Washington, DC, United States) (2013), 342 (6160), 825-829CODEN: SCIEAS; ISSN:0036-8075. (American Association for the Advancement of Science)
      Cytochrome P 450 enzymes activate oxygen at heme iron centers to oxidize relatively inert substrate carbon-hydrogen bonds. Cysteine thiolate coordination to iron is posited to increase the pKa (where Ka is the acid dissocn. const.) of compd. II, an iron(IV)hydroxide complex, correspondingly lowering the one-electron redn. potential of compd. I, the active catalytic intermediate, and decreasing the driving force for deleterious auto-oxidn. of tyrosine and tryptophan residues in the enzyme's framework. Here, we report on the prepn. of an iron(IV)hydroxide complex in a P 450 enzyme (CYP158) in ≥90% yield. Using rapid mixing technologies in conjunction with Moessbauer, UV/visible, and x-ray absorption spectroscopies, we det. a pKa value for this compd. of 11.9. Marcus theory anal. indicates that this elevated pKa results in a >10,000-fold redn. in the rate const. for oxidns. of the protein framework, making these processes noncompetitive with substrate oxidn.
    32. 32
      Modi, A. R., Dawson, J. H., Hrycay, E. G., and Bandiera, S. M. (2015) Oxidizing Intermediates in P450 Catalysis: A Case for Multiple Oxidants Adv. Exp. Med. Biol. 851, 63– 81 DOI: 10.1007/978-3-319-16009-2_2
      32
      Oxidizing intermediates in P450 catalysis: a case for multiple oxidants
      Modi, Anuja R.; Dawson, John H.
      Advances in Experimental Medicine and Biology (2015), 851 (Monooxygenase, Peroxidase and Peroxygenase Properties and Mechanisms of Cytochrome P450), 63-81CODEN: AEMBAP; ISSN:2214-8019. (Springer)
      A review. Cytochrome P 450 (P 450 or CYP) catalysis involves the oxygenation of org. compds. via a series of catalytic intermediates, namely, the ferric-peroxo, ferric-hydroperoxo, Compd. I (Cpd I) and FeIII -(H2O2) intermediates. Now that the structures of P 450 enzymes have been well established, a major focus of current research in the P 450 area has been unraveling the intimate details and activities of these reactive intermediates. The general consensus is that the Cpd I intermediate is the most reactive species in the reaction cycle, esp. when the reaction involves hydrocarbon hydroxylation. Cpd I has recently been characterized exptl. Other than Cpd I, there is a multitude of evidence, both exptl. as well as theor., supporting the involvement of other intermediates in various types of oxidn. reactions. The involvement of these multiple oxidants has been exptl. demonstrated using P 450 active-site mutants in epoxidn., heteroatom oxidn. and dealkylation reactions. In this chapter, we will review the P 450 reaction cycle and each of the reactive intermediates to discuss their role in oxidn. reactions.
    33. 33
      Sutin, N. and Creutz, C. (1978) Properties and Reactivities of the Luminescent Excited States of Polypyridine Complexes of Ruthenium(II) and Osmium(II), in Inorganic and Organometallic Photochemistry (Wrighton, M. S., Ed.), pp 1– 27, American Chemical Society, Washington, DC.
      There is no corresponding record for this reference.
    34. 34
      Creutz, C., Chou, M., Netzel, T. L., Okumura, M., and Sutin, N. (1980) Lifetimes, Spectra, and Quenching of the Excited-States of Polypyridine Complexes of Iron(II), Ruthenium(II), and Osmium(II) J. Am. Chem. Soc. 102, 1309– 1319 DOI: 10.1021/ja00524a014
      There is no corresponding record for this reference.
    35. 35
      Ener, M. E., Lee, Y. T., Winkler, J. R., Gray, H. B., and Cheruzel, L. (2010) Photooxidation of cytochrome P450-BM3 Proc. Natl. Acad. Sci. U. S. A. 107, 18783– 18786 DOI: 10.1073/pnas.1012381107
      35
      Photooxidation of cytochrome P450-BM3
      Ener, Maraia E.; Lee, Young-Tae; Winkler, Jay R.; Gray, Harry B.; Cheruzel, Lionel
      Proceedings of the National Academy of Sciences of the United States of America (2010), 107 (44), 18783-18786, S18783/1-S18783/6CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)
      High-valent iron-oxo species are thought to be intermediates in the catalytic cycles of oxygenases and peroxidases. An attractive route to these iron-oxo intermediates involves laser flash-quench oxidn. of ferric hemes, as demonstrated by our work on the ferryl (compd. II) and ferryl porphyrin radical cation (compd. I) intermediates of horseradish peroxidase. Extension of this work to include cytochrome P 450-BM3 (CYP102A1) has required covalent attachment of a RuII photosensitizer to a nonnative cysteine near the heme (RuIIK97C-FeIIIP450), in order to promote electron transfer from the FeIII porphyrin to photogenerated RuIII. The RuIIK97C- FeIII,P450 conjugate was structurally characterized by X-ray crystallog. (2.4 Å resoln.; Ru-Fe distance, 24 Å). Flash-quench oxidn. of the ferric-aquo heme produces an FeIV-hydroxide species (compd. II) within 2 ms. Difference spectra for three singly oxidized P 450-BM3 intermediates were obtained from kinetics modeling of the transient absorption data in combination with generalized singular value decompn. anal. and multiexponential fitting.
    36. 36
      Girvan, H. M., Seward, H. E., Toogood, H. S., Cheesman, M. R., Leys, D., and Munro, A. W. (2007) Structural and spectroscopic characterization of P450BM3 mutants with unprecedented P450 heme iron ligand sets - New heme ligation states influence conformational equilibria in P450BM3 J. Biol. Chem. 282, 564– 572 DOI: 10.1074/jbc.M607949200
      There is no corresponding record for this reference.
    37. 37
      Park, S.-Y., Yamane, K., Adachi, S.-i., Shiro, Y., Weiss, K. E., Maves, S. A., and Sligar, S. G. (2002) Thermophilic cytochrome P450 (CYP119) from Sulfolobus solfataricus: high resolution structure and functional properties J. Inorg. Biochem. 91, 491– 501 DOI: 10.1016/S0162-0134(02)00446-4
      37
      Thermophilic cytochrome P450 (CYP119) from Sulfolobus solfataricus: high resolution structure and functional properties
      Park, Sam-Yong; Yamane, Kazuhide; Adachi, Shin-ichi; Shiro, Yoshitsugu; Weiss, Kara E.; Maves, Shelley A.; Sligar, Stephen G.
      Journal of Inorganic Biochemistry (2002), 91 (4), 491-501CODEN: JIBIDJ; ISSN:0162-0134. (Elsevier Science Inc.)
      Crystal structures of a thermostable cytochrome P 450 (CYP119) and a site-directed mutant, (Phe24Leu), from the acidothermophilic archaea Sulfolobus solfataricus were detd. at 1.5-2.0 A resoln. The authors identify important crystallog. waters in the ferric heme pocket, observe protein conformational changes upon inhibitor binding, and detect a unique distribution of surface charge not found in other P 450s. An anal. of factors contributing to thermostability of CYP119 of these high resoln. structures shows an apparent increase in clustering of arom. residues and optimum stacking. The contribution of arom. stacking was investigated further with the mutant crystal structure and differential scanning calorimetry.
    38. 38
      Castellano, F. N., Dattelbaum, J. D., and Lakowicz, J. R. (1998) Long-lifetime Ru(II) complexes as labeling reagents for sulfhydryl groups Anal. Biochem. 255, 165– 170 DOI: 10.1006/abio.1997.2468
      38
      Long-lifetime Ru(II) complexes as labeling reagents for sulfhydryl groups
      Castellano, Felix N.; Dattelbaum, Jonathan D.; Lakowicz, Joseph R.
      Analytical Biochemistry (1998), 255 (2), 165-170CODEN: ANBCA2; ISSN:0003-2697. (Academic Press)
      We report the synthesis and spectral properties of two long-lifetime highly luminescent Ru(II) complexes contg. either a sulfhydryl reactive iodoacetamido group or a less reactive chloroacetamido group, [Ru(bpy)2(5-iodoacetamido-1,10-phenanthroline)] (PF6)2 and [Ru(bpy)2(5-chloroacetamido-1,10-phenanthroline)](PF6)2, resp., where bpy is 2,2'-bipyridine. Ru(bpy)2(phen-IA)(PF6)2 was covalently linked to human serum albumin (HSA) and human IgG (IgG). The photoluminescence lifetime of protein-bound probes approaches 1 μs under ambient conditions. In the absence of rotational motions, this probe displayed an anisotropy of 0.18 for excitation at 472 nm. Anisotropy decay data were used to det. the overall rotational correlation times of HSA and IgG. These long-lifetime sulfhydryl-reactive probes can be used to recover microsecond rotational motions and/or domain motions of proteins and/or macromol. complexes.
    39. 39
      Mines, G. A., Bjerrum, M. J., Hill, M. G., Casimiro, D. R., Chang, I.-J., Winkler, J. R., and Gray, H. B. (1996) Rates of Heme Oxidation and Reduction in Ru(His33)cytochrome c at Very High Driving Forces J. Am. Chem. Soc. 118, 1961– 1965 DOI: 10.1021/ja9519243
      39
      Rates of Heme Oxidation and Reduction in Ru(His33)cytochrome c at Very High Driving Forces
      Mines, Gary A.; Bjerrum, Morten J.; Hill, Michael G.; Casimiro, Danilo R.; Chang, I-Jy; Winkler, Jay R.; Gray, Harry B.
      Journal of the American Chemical Society (1996), 118 (8), 1961-5CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
      The rates of Ru(His33)cytochrome c electron-transfer (ET) reactions have been measured over a driving-force range of 0.59 to 1.89 eV. The driving-force dependence of Fe2+ → Ru3+ ET in RuL2(i.m.)(His33)cytc [L = 2,2'-bipyridine (bpy), 4,4',5,5'-tetramethyl-2,2'-bipyridine (4,4',5,5'-(CH3)4-bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-(CH3)2-bpy), 4,4'-bis(N-ethylcarbamoyl)-2,2'-bipyridine (4,4'-(CONH(C2H5))2-bpy), 1,10-phenanthroline (phen); i.m. = imidazole] is well described by semiclassical ET theory with kmax = 2.5×106 s-1 (HAB = 0.092 cm-1) and λ = 0.76 eV. As predicted by theory, the rate of an exergonic (-ΔG° = 1.3 eV) heme redn. reaction, *Ru2+(bpy)2(i.m.)(His)→Fe3+, falls in the inverted region (k = 2.0×105 s-1). In contrast, the rates of three highly exergonic heme redns., *Ru2+(phen)2(CN)(His)→Fe3+ (2.0×105 s-1; 1.40 eV), Ru+(4,4'-(CONH(C2H5))2-bpy)2(i.m.)(His)→Fe3+ (2.3×105 s-1; 1.44 eV), and Ru+(phen)2(CN)(His)→Fe3+ (4.5×105 s-1; 1.89 eV), are much higher than expected for reactions directly to ground-state products. Agreement with theory is greatly improved by assuming that an electronically excited ferroheme (Fe2+ → *Fe2+ ∼ 1.05 eV) is the initial product in each of these reactions.
    40. 40
      Munro, A. W., Malarkey, K., McKnight, J., Thomson, A. J., Kelly, S. M., Price, N. C., Lindsay, J. G., Coggins, J. R., and Miles, J. S. (1994) The Role of Tryptophan-97 of Cytochrome P450-BM3 from Bacillus megaterium in Catalytic Function - Evidence Against the Covalent Switching Hypothesis of P450 Electron Transfer Biochem. J. 303, 423– 428 DOI: 10.1042/bj3030423
      There is no corresponding record for this reference.
    41. 41
      Coelho, P. S., Wang, Z. J., Ener, M. E., Baril, S. A., Kannan, A., Arnold, F. H., and Brustad, E. M. (2013) A serine-substituted P450 catalyzes highly efficient carbene transfer to olefins in vivo Nat. Chem. Biol. 9, 485– 487 DOI: 10.1038/nchembio.1278
      41
      A serine-substituted P450 catalyzes highly efficient carbene transfer to olefins in vivo
      Coelho, Pedro S.; Wang, Z. Jane; Ener, Maraia E.; Baril, Stefanie A.; Kannan, Arvind; Arnold, Frances H.; Brustad, Eric M.
      Nature Chemical Biology (2013), 9 (8), 485-487CODEN: NCBABT; ISSN:1552-4450. (Nature Publishing Group)
      Whole-cell catalysts for non-natural chem. reactions will open new routes to sustainable prodn. of chems. We designed a cytochrome 'P411' with unique serine-heme ligation that catalyzes efficient and selective olefin cyclopropanation in intact Escherichia coli cells. The mutation C400S in cytochrome P450BM3 gives a signature ferrous CO Soret peak at 411 nm, abolishes monooxygenation activity, raises the resting-state FeIII-to-FeII redn. potential and substantially improves NAD(P)H-driven activity.
    42. 42
      Whited, C. A., Belliston-Bittner, W., Dunn, A. R., Winkler, J. R., and Gray, H. B. (2009) Nanosecond photoreduction of inducible nitric oxide synthase by a Ru-diimine electron tunneling wire bound distant from the active site J. Inorg. Biochem. 103, 906– 911 DOI: 10.1016/j.jinorgbio.2009.04.001
      42
      Nanosecond photoreduction of inducible nitric oxide synthase by a Ru-diimine electron tunneling wire bound distant from the active site
      Whited, Charlotte A.; Belliston-Bittner, Wendy; Dunn, Alexander R.; Winkler, Jay R.; Gray, Harry B.
      Journal of Inorganic Biochemistry (2009), 103 (6), 906-911CODEN: JIBIDJ; ISSN:0162-0134. (Elsevier B.V.)
      A Ru-diimine wire, [(4,4',5,5'-tetramethylbipyridine)2Ru(F9bp)]2+ (tmRu-F9bp, where F9bp is 4-methyl-4'-methylperfluorobiphenylbipyridine), binds tightly to the oxidase domain of inducible nitric oxide synthase (iNOSoxy). The binding of tmRu-F9bp is independent of tetrahydrobiopterin, arginine, and imidazole, indicating that the wire resides on the surface of the enzyme, distant from the active-site heme. Photoredn. of an imidazole-bound active-site heme iron in the enzyme-wire conjugate (kET = 2(1) × 107 s-1) is fully seven orders of magnitude faster than the in vivo process.
    43. 43
      Dunn, A. R., Dmochowski, I. J., Winkler, J. R., and Gray, H. B. (2003) Nanosecond Photoreduction of Cytochrome P450cam by Channel-Specific Ru-Diimine Electron Tunneling Wires J. Am. Chem. Soc. 125, 12450– 12456 DOI: 10.1021/ja0294111
      43
      Nanosecond Photoreduction of Cytochrome P450cam by Channel-Specific Ru-diimine Electron Tunneling Wires
      Dunn, Alexander R.; Dmochowski, Ivan J.; Winkler, Jay R.; Gray, Harry B.
      Journal of the American Chemical Society (2003), 125 (41), 12450-12456CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)
      We report the synthesis and characterization of Ru-diimine complexes designed to bind to cytochrome P450cam (CYP101). The sensitizer core has the structure [Ru(L2)L']2+, where L' is a perfluorinated biphenyl bridge (F8bp) connecting 4,4'-dimethylbipyridine to an enzyme substrate (adamantane, F8bp-Ad), a heme ligand (imidazole, F8bp-Im), or F (F9bp). The electron-transfer (ET) driving force (-ΔG°) is varied by replacing the ancillary 2,2'-bipyridine ligands with 4,4',5,5'-tetramethylbipyridine (tmRu). The four complexes all bind P450cam tightly: Ru-F8bp-Ad (1, Kd = 0.077 μM); Ru-F8bp-Im (2, Kd = 3.7 μM); tmRu-F9bp (3, Kd = 2.1 μM); and tmRu-F8bp-Im (4, Kd = 0.48 μM). Binding is predominantly driven by hydrophobic interactions between the Ru-diimine wires and the substrate access channel. With Ru-F8bp wires, redox reactions can be triggered on the nanosecond time scale. Ru-wire 2, which ligates the heme iron, shows a small amt. of transient heme photoredn. (∼30%), whereas the transient photoredn. yield for 4 is 76%. Forward ET with 4 occurs in roughly 40 ns (kf = 2.8×107 s-1), and back ET (FeII → RuIII, kb ≈ 1.7×108 s-1) is near the coupling-limited rate (kmax). Direct photoredn. was not obsd. for 1 or 3. The large variation in ET rates among the Ru-diimine:P 450 conjugates strongly supports a through-bond model of Ru-heme electronic coupling.
    44. 44
      Denisov, I. G., Makris, T. M., and Sugar, S. G. (2002) Cryoradiolysis for the Study of P450 Reaction Intermediates Methods Enzymol. 357, 103– 115 DOI: 10.1016/S0076-6879(02)57670-9
      There is no corresponding record for this reference.

  • Supporting Information

    Supporting Information

    The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.biochem.7b00432.

    • Additional experimental details, spectra of ferric and ferrous wild-type P450-BM3 and the ferrous–ferric difference spectrum, details of electron transfer rate calculations, and estimated electron transfer rate constants (PDF)


    Terms & Conditions

    Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.